ID: 1195394616

View in Genome Browser
Species Human (GRCh38)
Location X:104397595-104397617
Sequence CACCCTGACCATAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195394616_1195394619 -8 Left 1195394616 X:104397595-104397617 CCTTCTGCCCTATGGTCAGGGTG No data
Right 1195394619 X:104397610-104397632 TCAGGGTGAATCCTAGAGTGCGG No data
1195394616_1195394621 -6 Left 1195394616 X:104397595-104397617 CCTTCTGCCCTATGGTCAGGGTG No data
Right 1195394621 X:104397612-104397634 AGGGTGAATCCTAGAGTGCGGGG No data
1195394616_1195394624 16 Left 1195394616 X:104397595-104397617 CCTTCTGCCCTATGGTCAGGGTG No data
Right 1195394624 X:104397634-104397656 GCAGATCCGAGCCTGCAGCTGGG No data
1195394616_1195394620 -7 Left 1195394616 X:104397595-104397617 CCTTCTGCCCTATGGTCAGGGTG No data
Right 1195394620 X:104397611-104397633 CAGGGTGAATCCTAGAGTGCGGG No data
1195394616_1195394623 15 Left 1195394616 X:104397595-104397617 CCTTCTGCCCTATGGTCAGGGTG No data
Right 1195394623 X:104397633-104397655 GGCAGATCCGAGCCTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195394616 Original CRISPR CACCCTGACCATAGGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr