ID: 1195395875

View in Genome Browser
Species Human (GRCh38)
Location X:104409849-104409871
Sequence CTTTGAGCTGAGTCCTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195395875_1195395878 -8 Left 1195395875 X:104409849-104409871 CCCAAAGAGGACTCAGCTCAAAG No data
Right 1195395878 X:104409864-104409886 GCTCAAAGCTGTCAGGACATTGG No data
1195395875_1195395879 8 Left 1195395875 X:104409849-104409871 CCCAAAGAGGACTCAGCTCAAAG No data
Right 1195395879 X:104409880-104409902 ACATTGGTACTCTCAGCAAGTGG No data
1195395875_1195395880 9 Left 1195395875 X:104409849-104409871 CCCAAAGAGGACTCAGCTCAAAG No data
Right 1195395880 X:104409881-104409903 CATTGGTACTCTCAGCAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195395875 Original CRISPR CTTTGAGCTGAGTCCTCTTT GGG (reversed) Intergenic
No off target data available for this crispr