ID: 1195404012

View in Genome Browser
Species Human (GRCh38)
Location X:104492944-104492966
Sequence TTTAATTATGAAAATCAATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195404012_1195404014 -1 Left 1195404012 X:104492944-104492966 CCGCATTGATTTTCATAATTAAA No data
Right 1195404014 X:104492966-104492988 AAACACGTTTTTACCATTGTGGG No data
1195404012_1195404017 8 Left 1195404012 X:104492944-104492966 CCGCATTGATTTTCATAATTAAA No data
Right 1195404017 X:104492975-104492997 TTTACCATTGTGGGGGCAGTAGG No data
1195404012_1195404021 14 Left 1195404012 X:104492944-104492966 CCGCATTGATTTTCATAATTAAA No data
Right 1195404021 X:104492981-104493003 ATTGTGGGGGCAGTAGGGTAGGG No data
1195404012_1195404020 13 Left 1195404012 X:104492944-104492966 CCGCATTGATTTTCATAATTAAA No data
Right 1195404020 X:104492980-104493002 CATTGTGGGGGCAGTAGGGTAGG No data
1195404012_1195404025 22 Left 1195404012 X:104492944-104492966 CCGCATTGATTTTCATAATTAAA No data
Right 1195404025 X:104492989-104493011 GGCAGTAGGGTAGGGGTACGGGG No data
1195404012_1195404013 -2 Left 1195404012 X:104492944-104492966 CCGCATTGATTTTCATAATTAAA No data
Right 1195404013 X:104492965-104492987 AAAACACGTTTTTACCATTGTGG No data
1195404012_1195404023 20 Left 1195404012 X:104492944-104492966 CCGCATTGATTTTCATAATTAAA No data
Right 1195404023 X:104492987-104493009 GGGGCAGTAGGGTAGGGGTACGG No data
1195404012_1195404022 15 Left 1195404012 X:104492944-104492966 CCGCATTGATTTTCATAATTAAA No data
Right 1195404022 X:104492982-104493004 TTGTGGGGGCAGTAGGGTAGGGG No data
1195404012_1195404024 21 Left 1195404012 X:104492944-104492966 CCGCATTGATTTTCATAATTAAA No data
Right 1195404024 X:104492988-104493010 GGGCAGTAGGGTAGGGGTACGGG No data
1195404012_1195404018 9 Left 1195404012 X:104492944-104492966 CCGCATTGATTTTCATAATTAAA No data
Right 1195404018 X:104492976-104492998 TTACCATTGTGGGGGCAGTAGGG No data
1195404012_1195404016 1 Left 1195404012 X:104492944-104492966 CCGCATTGATTTTCATAATTAAA No data
Right 1195404016 X:104492968-104492990 ACACGTTTTTACCATTGTGGGGG No data
1195404012_1195404015 0 Left 1195404012 X:104492944-104492966 CCGCATTGATTTTCATAATTAAA No data
Right 1195404015 X:104492967-104492989 AACACGTTTTTACCATTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195404012 Original CRISPR TTTAATTATGAAAATCAATG CGG (reversed) Intergenic
No off target data available for this crispr