ID: 1195404020

View in Genome Browser
Species Human (GRCh38)
Location X:104492980-104493002
Sequence CATTGTGGGGGCAGTAGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195404012_1195404020 13 Left 1195404012 X:104492944-104492966 CCGCATTGATTTTCATAATTAAA No data
Right 1195404020 X:104492980-104493002 CATTGTGGGGGCAGTAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195404020 Original CRISPR CATTGTGGGGGCAGTAGGGT AGG Intergenic
No off target data available for this crispr