ID: 1195405000

View in Genome Browser
Species Human (GRCh38)
Location X:104503107-104503129
Sequence GTGGCTGCACAGATATTTAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195404996_1195405000 19 Left 1195404996 X:104503065-104503087 CCCTTCGTTCATGTTCTTGAGAG No data
Right 1195405000 X:104503107-104503129 GTGGCTGCACAGATATTTAGCGG No data
1195404997_1195405000 18 Left 1195404997 X:104503066-104503088 CCTTCGTTCATGTTCTTGAGAGT No data
Right 1195405000 X:104503107-104503129 GTGGCTGCACAGATATTTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195405000 Original CRISPR GTGGCTGCACAGATATTTAG CGG Intergenic
No off target data available for this crispr