ID: 1195405424

View in Genome Browser
Species Human (GRCh38)
Location X:104507900-104507922
Sequence ATGCTGTTACTGATGACACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195405424_1195405427 27 Left 1195405424 X:104507900-104507922 CCTAGTGTCATCAGTAACAGCAT No data
Right 1195405427 X:104507950-104507972 AGACCAACCCTTACCTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195405424 Original CRISPR ATGCTGTTACTGATGACACT AGG (reversed) Intergenic
No off target data available for this crispr