ID: 1195405986

View in Genome Browser
Species Human (GRCh38)
Location X:104513912-104513934
Sequence CAGTGACCCAAAAGGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195405986_1195405990 4 Left 1195405986 X:104513912-104513934 CCTATTTCCCTTTTGGGTCACTG No data
Right 1195405990 X:104513939-104513961 GCTTTGGATTCCAGCCAACTTGG No data
1195405986_1195405991 11 Left 1195405986 X:104513912-104513934 CCTATTTCCCTTTTGGGTCACTG No data
Right 1195405991 X:104513946-104513968 ATTCCAGCCAACTTGGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195405986 Original CRISPR CAGTGACCCAAAAGGGAAAT AGG (reversed) Intergenic
No off target data available for this crispr