ID: 1195406341

View in Genome Browser
Species Human (GRCh38)
Location X:104518230-104518252
Sequence CCAGGCCTAAATGGTTTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195406341_1195406347 27 Left 1195406341 X:104518230-104518252 CCAGTAAAACCATTTAGGCCTGG No data
Right 1195406347 X:104518280-104518302 TTTTTTTTTTTTTTTTGAGATGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195406341 Original CRISPR CCAGGCCTAAATGGTTTTAC TGG (reversed) Intergenic
No off target data available for this crispr