ID: 1195408561

View in Genome Browser
Species Human (GRCh38)
Location X:104544056-104544078
Sequence CAGTGGAGATGGAGAGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1072
Summary {0: 3, 1: 12, 2: 44, 3: 191, 4: 822}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195408561_1195408565 12 Left 1195408561 X:104544056-104544078 CCTACTTCTCTCCATCTCCACTG 0: 3
1: 12
2: 44
3: 191
4: 822
Right 1195408565 X:104544091-104544113 TCTCAGCTACCACTACCTCCTGG No data
1195408561_1195408566 16 Left 1195408561 X:104544056-104544078 CCTACTTCTCTCCATCTCCACTG 0: 3
1: 12
2: 44
3: 191
4: 822
Right 1195408566 X:104544095-104544117 AGCTACCACTACCTCCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195408561 Original CRISPR CAGTGGAGATGGAGAGAAGT AGG (reversed) Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900779331 1:4607484-4607506 CAGTGGAGAGGATGAAAAGTAGG + Intergenic
901175585 1:7296467-7296489 TAGTGGGGATGGGAAGAAGTGGG + Intronic
901203583 1:7481082-7481104 CAGAAGAGAGGGAGAGAAGGAGG - Intronic
901635346 1:10667856-10667878 CAGCCGAGATGGGGAGAAGGTGG - Intronic
901855134 1:12039573-12039595 CAGTGGAGAAGGGGAGAGGGAGG + Intergenic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
902997801 1:20240487-20240509 GAGTGGATATGGAGAGAATTGGG + Intergenic
903064562 1:20691925-20691947 TAGCAAAGATGGAGAGAAGTGGG - Intronic
903662970 1:24989941-24989963 CACTGGAGGTGGGGAGAAATGGG + Intergenic
904026213 1:27505132-27505154 CTGGGGAGTTGGAGAGAACTAGG + Intergenic
904037722 1:27567787-27567809 CTGTGAAGAGGGAGAGATGTTGG - Intronic
904183909 1:28687724-28687746 CAGTGGAGATAGAGACAGGGAGG + Intronic
904254744 1:29247819-29247841 CCGTGGAGATGGCAAGATGTTGG + Intronic
904416347 1:30363177-30363199 CACAGGAGATGGTGGGAAGTGGG + Intergenic
904724479 1:32536753-32536775 GAGTGGAGGTAGATAGAAGTGGG - Intronic
904753531 1:32755311-32755333 CAGAGGAGGTGGAGTGAAGGGGG + Intronic
904865357 1:33574666-33574688 CTGTTCAGAGGGAGAGAAGTTGG + Intronic
904921849 1:34014129-34014151 CGGTGAAGGCGGAGAGAAGTGGG - Intronic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
905337680 1:37256724-37256746 GAGGAGAGATGGAGAGAAGGAGG - Intergenic
905689844 1:39934944-39934966 GAGTGGAGATGGAAAGAATGAGG + Intergenic
905776382 1:40669985-40670007 CAAGAGGGATGGAGAGAAGTGGG - Intergenic
905836018 1:41121971-41121993 CAGTAGAGATGGTGAAATGTGGG - Intronic
905864669 1:41370284-41370306 CAGAGAAGAGGGAGAGAAGAGGG + Intronic
905921015 1:41718697-41718719 CAGGAGAGATGGAGAGAGGAGGG - Intronic
905972124 1:42150180-42150202 CAGTGGAGATGATGAGAAACGGG + Intergenic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906227658 1:44134800-44134822 GAGTGGAGGTAGGGAGAAGTAGG + Exonic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
906713222 1:47948184-47948206 CAGTGGGGATAGAGAGACTTGGG + Intronic
907085299 1:51666998-51667020 CAGAGAGGATGGAGACAAGTTGG + Intronic
907181599 1:52575397-52575419 CAGTGAAGATTGTGTGAAGTGGG - Intergenic
907194992 1:52679287-52679309 CAGTGGAGAAGGGAAAAAGTAGG + Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907839509 1:58142760-58142782 CAGGAAAGATGGAGAGAGGTAGG - Intronic
907853767 1:58281428-58281450 TAGTGGAGATGGAGAGATATAGG - Intronic
907901565 1:58746303-58746325 TGGTGGACATGGAGAGAAGGGGG - Intergenic
908241742 1:62194499-62194521 CTGTGGAGTTGGAGAGACGCCGG + Intergenic
908522227 1:64955515-64955537 CAGTGTAGAAGGAGAGAAATAGG + Intronic
908777336 1:67653249-67653271 CAGTGGAAGTGGGGAGGAGTAGG - Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
908982621 1:69977048-69977070 CAATGGAGATGCAGAGTATTGGG - Intronic
909132490 1:71755260-71755282 CAGTGGAGGTGAAGAGGACTCGG - Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909845663 1:80390725-80390747 AAGGGGAGATAGAGAGAAGTTGG + Intergenic
909914235 1:81298052-81298074 CAGAGAAGATGGAGAGGACTGGG + Intergenic
910313584 1:85856679-85856701 CAGTGGAGGTGGGGAAGAGTAGG - Intronic
910476455 1:87612811-87612833 CAGTGGAGGTGACGAAAAGTTGG - Intergenic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
910726438 1:90344835-90344857 TAGTGACGATGGAGGGAAGTGGG - Intergenic
911047919 1:93643637-93643659 CAGAGGAAATGGGGAGATGTAGG + Intronic
911093573 1:94037423-94037445 AAGGGGAAGTGGAGAGAAGTAGG - Intronic
911433430 1:97823471-97823493 GAGTGGAAATGGGGAGAGGTTGG - Intronic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
911825152 1:102474028-102474050 CAGTGGGGATAGAGAGAGGAAGG - Intergenic
912204476 1:107494800-107494822 AAGGGGAGATGGAGTGAAGAGGG - Intergenic
912346154 1:108965137-108965159 CAGTGGAGATGTGGGGAAATTGG - Intergenic
912348150 1:108985014-108985036 CAGTGGAGGTGGAGCAAAGTGGG - Intronic
912499078 1:110110027-110110049 CAGTGGGGATGCAGAGGAGGAGG + Intergenic
912552519 1:110493359-110493381 CAGAGGAGTTGGAGAGGAGTTGG - Intergenic
912580796 1:110719243-110719265 GAATGGAGATGAAGAGAACTGGG + Intergenic
912865467 1:113252410-113252432 AAGTGGTAATGGAGATAAGTGGG + Intergenic
912949933 1:114113681-114113703 CACTGGAGATGGAGAGAGGTGGG - Intronic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
913693212 1:121299431-121299453 CAGTGGAGATGTATAAAAGGAGG - Intronic
914144343 1:144980648-144980670 CAGTGGAGATGTATAAAAGGAGG + Intronic
914191912 1:145419221-145419243 AAGTAGGGAAGGAGAGAAGTAGG + Intergenic
914319043 1:146541726-146541748 CAGTGAAGGTGATGAGAAGTAGG + Intergenic
914949652 1:152101561-152101583 AAGAGGAGATGGGTAGAAGTAGG - Intergenic
914984889 1:152448003-152448025 CAGAGGAGACAGAGAGAAGGTGG + Intergenic
915288517 1:154867944-154867966 GAGTGGAGATGGAGGAAGGTGGG - Intronic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915594588 1:156888812-156888834 CAGTGGAGGTGCTGAGGAGTGGG - Intergenic
915727103 1:158025714-158025736 CAAAGGAGATGGAGAGGAGAGGG + Intronic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915858298 1:159414221-159414243 GGGTGGTGATGAAGAGAAGTTGG - Intergenic
915940906 1:160117674-160117696 CAGTGGAGATGCAGGGGAGAAGG - Intronic
916489065 1:165285615-165285637 CAGTGGAGATGGTGAACAGCTGG - Intronic
917063260 1:171063982-171064004 GAGGAGAGATGGAGAGAAGGGGG + Intronic
917104278 1:171476736-171476758 CAGTAGGGGTTGAGAGAAGTAGG - Intergenic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
917261037 1:173169753-173169775 CAGTGGGGATGAAGAGAGGTTGG + Intergenic
918004244 1:180526769-180526791 CAGTGGTGTGGGAGAGAAGGGGG + Intergenic
918107366 1:181426243-181426265 GACTTGAGATGGAGAGAGGTTGG - Intronic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918321622 1:183370514-183370536 AAGTGGAGAAGTGGAGAAGTGGG - Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918691290 1:187483359-187483381 CAGTGGAGATGGAGGGGTTTGGG - Intergenic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
919083852 1:192897045-192897067 AAGGGGAGATGGGGAGAGGTTGG + Intergenic
919158879 1:193803050-193803072 GAATTGAGATGGAGAGGAGTTGG + Intergenic
919598887 1:199599001-199599023 CAGGGGAGACGAAGAGAAATTGG + Intergenic
919664438 1:200278729-200278751 CAGTAGAGATAGAGAGAGGGAGG + Intergenic
919721240 1:200838822-200838844 CAGTTATGATGGAGAGAAGTTGG + Intronic
919797640 1:201331038-201331060 CAGTGGAGAGGGGAACAAGTGGG + Exonic
920274032 1:204790574-204790596 CAGTGGGGATGAAGGGAACTAGG - Intergenic
920480536 1:206317801-206317823 CAGTGGAGATGTATAAAAGGAGG - Intronic
920622937 1:207566272-207566294 AAGGGGAGAAGGAGAGAAGAAGG - Intronic
920716759 1:208347332-208347354 CAGAGGAGATGGAGAACAGCTGG + Intergenic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
922659155 1:227414082-227414104 CTGAGGAGAGGGAGAGAAATGGG + Intergenic
922769099 1:228172489-228172511 AGCTGGAGATGGACAGAAGTGGG - Intronic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923230481 1:231981929-231981951 CAGTTGGTATGTAGAGAAGTGGG + Intronic
923271258 1:232357172-232357194 CAGTGGAGGTGGTGAGGCGTGGG + Intergenic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923310524 1:232730355-232730377 TGGTAGAAATGGAGAGAAGTAGG - Intergenic
923374642 1:233348630-233348652 CAAGGAAGATGGAGAGAAATCGG - Intronic
923570328 1:235107704-235107726 CAGTGAGGCTGGAAAGAAGTGGG + Intergenic
923850620 1:237790335-237790357 CTGTGGAGATGGCAAGAACTGGG - Intronic
924144488 1:241060017-241060039 CTGTGGAGTGGGAGAGAAATGGG - Intronic
924292270 1:242548565-242548587 GTGAGGAGATGGAGAGATGTGGG + Intergenic
1063281634 10:4635866-4635888 CACTGGAGATGCTGAGAATTTGG - Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1063972474 10:11390853-11390875 CAATGGAGATAGAGAGTAGAAGG + Intergenic
1064325135 10:14343433-14343455 GAGGGGAGATGGAGAGGAGCTGG - Intronic
1064810247 10:19188855-19188877 CAGTAGAGATGGTCAGAAGTGGG + Intronic
1064943324 10:20759080-20759102 AGGTGGAGATGGGGAGATGTTGG + Intergenic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065030653 10:21582655-21582677 TAGTGGAGATGGAGAGAGAGAGG + Intronic
1065111589 10:22445221-22445243 AACTGGAGAAGGAGAGAAATGGG + Intronic
1065367989 10:24953159-24953181 GAGCGGAGGTGGAGAGAGGTGGG - Intergenic
1065645294 10:27827630-27827652 CCCTGGAGATGAAGAGAAATGGG - Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065762552 10:28995774-28995796 CTGTGGAAAGGTAGAGAAGTGGG - Intergenic
1065886825 10:30085671-30085693 CAGTGGAGATGGGGAGTGATAGG + Intronic
1066331188 10:34425114-34425136 CAGTAGAGATGGAAAAAAATTGG - Intronic
1066493510 10:35918170-35918192 CAGTGGAGTTGGAGATAGGCAGG + Intergenic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1068090534 10:52427645-52427667 CAGTGGAGAGGGAGATATATGGG - Intergenic
1068379607 10:56234037-56234059 TAGTGGAAATGGAGATAACTGGG - Intergenic
1068519887 10:58066467-58066489 CAGGTGGGATGAAGAGAAGTGGG - Intergenic
1068714866 10:60177005-60177027 CAGTGGAGATGGTGAAATGTAGG - Intronic
1069166931 10:65171894-65171916 TAGTGGAGATGGAGAAGAATAGG + Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069757176 10:70780425-70780447 CAGAGGAGATGAGGAGAGGTAGG - Intronic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1070109193 10:73466077-73466099 AAGTGAAGATGGAGAACAGTAGG - Intronic
1070495293 10:77015836-77015858 GAGTGGAGGTGGAGAGAGGTGGG - Intronic
1070541805 10:77420817-77420839 AAGCTGAGATGGAGAGAAGTGGG - Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070757370 10:79001691-79001713 CAGTGGAGTGGGAAGGAAGTGGG + Intergenic
1071706946 10:88009414-88009436 AAGTGGGGATAGAGAAAAGTAGG + Intergenic
1071981965 10:91012491-91012513 CAGTATAGTTGGAGAAAAGTTGG + Intergenic
1072310320 10:94148211-94148233 AAGTGGAGATGGAGCGAAGAAGG + Intronic
1072422848 10:95304024-95304046 CAGTGGAGATGTAGAGCAGGCGG + Intergenic
1073312243 10:102551324-102551346 CAGTTGAGTTGGCCAGAAGTGGG + Intronic
1074052873 10:109895764-109895786 TATTAGAAATGGAGAGAAGTGGG - Intronic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1074554282 10:114474233-114474255 CAGTAGAGAGGGAGAGAAATGGG - Intronic
1075159585 10:120011574-120011596 AAGTGAAGAGGGAGAGAATTCGG + Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075719146 10:124574865-124574887 GAGTGGAGAAGGACAGCAGTGGG - Intronic
1075878487 10:125828105-125828127 CAATGGAGAGGGAGAGAAGTGGG + Intronic
1076205922 10:128602760-128602782 CTGAGGAGAGGGAGAGAATTGGG - Intergenic
1076262294 10:129076424-129076446 CACAGGAGATGGAGAGAGATAGG - Intergenic
1076726072 10:132413900-132413922 CAGTGGGGTGGGAGAGAGGTAGG + Intronic
1076768469 10:132650573-132650595 CTGTGTAAATGGAGAGAGGTCGG + Intronic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1076899720 10:133332190-133332212 CATTGGAAATGGAGAGGTGTGGG + Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077279648 11:1736850-1736872 GAGTGGAGCTGGAAAAAAGTTGG + Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078496314 11:11820732-11820754 CAGTGGAGATGGAAAAACCTGGG + Intergenic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1078822260 11:14894007-14894029 CGTGGGAGATGGAGAGAAATTGG - Intergenic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079594766 11:22229121-22229143 GAGAGGACATGGAGAGAAGGTGG - Intronic
1080049580 11:27845807-27845829 CTGTGGAGATTGAGAGAAAAAGG - Intergenic
1080075510 11:28142953-28142975 CAGTTTAAATGGAGAGAGGTGGG + Intronic
1080360499 11:31507667-31507689 CAGGGGGGATGGGGAGAATTTGG + Intronic
1080514431 11:33006899-33006921 AAGTGGAGATGTAGTGGAGTTGG + Intergenic
1080935832 11:36862470-36862492 CAGAAGAGATGGAGAAAAGTGGG - Intergenic
1081075938 11:38673753-38673775 AAGTTGAGAAGGAGAGAAGGTGG - Intergenic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081284334 11:41248988-41249010 CAGTGGCTATAGTGAGAAGTGGG - Intronic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1084032704 11:66490467-66490489 GAGGGGAGCTGGAGTGAAGTTGG - Intronic
1084157367 11:67321409-67321431 CTGTGGAGCGGGAGTGAAGTGGG - Intronic
1084461614 11:69299459-69299481 CAGGGGAGATGCAGAGGAGGGGG + Intronic
1084770902 11:71342283-71342305 CAGTGGAGAACGTGAGAAGTGGG + Intergenic
1084904750 11:72336936-72336958 CACTGGAGGAGGAGAGAACTGGG - Intronic
1085014962 11:73167909-73167931 TAGGAGAGAGGGAGAGAAGTGGG + Intergenic
1085143619 11:74171861-74171883 CAGGGAAGGTGGAGGGAAGTGGG + Intronic
1085198603 11:74687759-74687781 CAACAGAGAGGGAGAGAAGTGGG - Intergenic
1085407617 11:76272719-76272741 CAGGTGTGATGGAGAGAGGTGGG - Intergenic
1086074866 11:82839777-82839799 TAGTGGAGTGGGAGAGGAGTTGG - Intronic
1086101865 11:83109095-83109117 CAGTAGAGGTAGAGAGAAGTAGG + Intergenic
1086123067 11:83320578-83320600 CAGTGGTGGTTGGGAGAAGTGGG - Intergenic
1086138063 11:83462612-83462634 GAGGGGAGATGAAGAGAAGCTGG + Intronic
1086162641 11:83739835-83739857 CAGTGCAGCTGGAGAGGAGCTGG + Intronic
1087177605 11:95109756-95109778 CAGTGGTGATGGGGAGGAGAAGG - Intronic
1087204039 11:95375277-95375299 TGGTGGAGATAGACAGAAGTGGG + Intergenic
1087653261 11:100892939-100892961 CACTGGAGATGGAGAACAGGTGG + Intronic
1087876270 11:103361686-103361708 CAGAGCAGATGAAGAGCAGTGGG + Intronic
1087913954 11:103786394-103786416 CAGAGGAGAGGGAGAGAGATGGG + Intergenic
1088245843 11:107817336-107817358 CATTAGAGATGGAGATAAGAGGG + Intronic
1088567875 11:111192130-111192152 CAGAGGAGAGGGAGAGACATGGG - Intergenic
1088821265 11:113459644-113459666 AGGGGGAGATGGAGAGAGGTTGG + Intronic
1088831449 11:113540234-113540256 CAGAGGAGAAGCAGAGAAGCAGG + Intergenic
1089547620 11:119241842-119241864 GTGTAGAGATGGAAAGAAGTGGG + Intronic
1089768651 11:120786621-120786643 CAGTTGAAATGAAGAGATGTTGG - Intronic
1091096119 11:132823761-132823783 CAGTGGAGAGGCAGAGATGAAGG - Intronic
1091096198 11:132824592-132824614 CAGTGGAGAAGCAGAGATGAAGG - Intronic
1091340352 11:134807405-134807427 CACTGGAGATAGAGAGGAGGAGG + Intergenic
1091626690 12:2126584-2126606 AAGTGGAGGTGGAGAGAAGACGG + Intronic
1091636828 12:2203490-2203512 CACGGGAGATGGCGAGAAGCTGG - Intronic
1091675657 12:2487283-2487305 CAGTGTCGATGGAGAAAATTAGG - Intronic
1092074054 12:5658213-5658235 AAGTGGAGGTATAGAGAAGTTGG - Intronic
1092229871 12:6770369-6770391 CTGTGGAGAGGGAGAGAATGGGG - Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092650781 12:10632439-10632461 CAGTGTAGCTGGAGCCAAGTGGG + Intronic
1092655802 12:10684431-10684453 CCGTGGAGAGAGAAAGAAGTGGG + Intergenic
1092749456 12:11705036-11705058 CGGTGGAAATGGGGAGATGTGGG + Intronic
1092798209 12:12135338-12135360 GAGTGGAGGGGGAGAGAAGTGGG + Intronic
1093676888 12:21952085-21952107 CAGGGGAGGCGGGGAGAAGTTGG + Intergenic
1093713004 12:22349292-22349314 CAGTAGAGATGAAGAAAAGAGGG + Intronic
1094083738 12:26566041-26566063 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094083745 12:26566079-26566101 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094361349 12:29634558-29634580 CAGTAGTGATGGAGTGAAATCGG + Intronic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1095370859 12:41465731-41465753 CAGTGGAGATGAAGAGGAGCAGG + Intronic
1095559161 12:43545109-43545131 CAGTGGGGAAGGAGAAGAGTGGG - Intronic
1095716547 12:45352313-45352335 GAGTGGGGAGGGAAAGAAGTGGG - Intronic
1095966515 12:47870725-47870747 CAGTGGAGATGGAGCCCAGAGGG - Intronic
1096083620 12:48850196-48850218 CGATGGAGATGGAAAGAAGTAGG + Intronic
1096250393 12:50028258-50028280 CAGGGGTGAGGGAGAGAAGCAGG + Intronic
1096259041 12:50079652-50079674 CGATGTAGATGGAGAGAACTAGG - Intronic
1096263774 12:50108437-50108459 TAGGGGTGATGGACAGAAGTGGG - Intronic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1096739876 12:53685274-53685296 TAGTGGGGATGGTGAGGAGTAGG + Intergenic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1096816893 12:54207469-54207491 CAGTGGAGGTGGGGGGAAGCAGG + Intergenic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1097623168 12:61966139-61966161 CAGTGAAGATGAGGAGAAGTTGG - Intronic
1097652842 12:62323094-62323116 CAATGGACATTGAGAGAAATAGG - Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1099039959 12:77640409-77640431 GGATGGAAATGGAGAGAAGTAGG - Intergenic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1100497283 12:95137810-95137832 CAGTGGAAATGGTGAAAAGTAGG - Intronic
1101006620 12:100406959-100406981 CAATGGAGATGGAGAGAGGGGGG + Intronic
1101580659 12:106038585-106038607 CCGTGGAGTTAGAGAGAACTGGG + Intergenic
1101728924 12:107410615-107410637 CAGTGGAGATGGGGAGGACTTGG + Intronic
1101730443 12:107422601-107422623 CAGTGGAGGTGATGAGAAGTTGG + Intronic
1102172585 12:110853381-110853403 TGGGGGAGATGGAGAGGAGTGGG - Intronic
1102306515 12:111808835-111808857 CAGTGCAGGTGGAGAAAAGAGGG + Intronic
1102392758 12:112562904-112562926 CAGTAGGGATAGGGAGAAGTGGG - Intergenic
1102736504 12:115165608-115165630 CAGGGGAGATAGAGAGAGGTTGG - Intergenic
1102933672 12:116880335-116880357 CACTCGAGAAGGAGCGAAGTTGG + Intronic
1103049109 12:117763852-117763874 CAGCAAAGATGGAGAGAAGTCGG + Intronic
1103082741 12:118038287-118038309 CTCTGCAGCTGGAGAGAAGTCGG - Exonic
1103099298 12:118158597-118158619 TAATGGAGATGGAGAGGAGTGGG - Intronic
1103235026 12:119364963-119364985 CAGTGGACATGGAAGGCAGTTGG + Intronic
1103325243 12:120116311-120116333 CTCTGGAGTTGGAGAGACGTGGG - Intronic
1103781581 12:123402319-123402341 GAATGGAGATGGAGAGGAGGTGG + Intronic
1103844292 12:123890726-123890748 CACTGGGGACAGAGAGAAGTGGG + Intronic
1104278717 12:127354140-127354162 TGGTGGAGGTGGAGGGAAGTGGG + Intergenic
1104300614 12:127561832-127561854 GAGTGAAGATGGAAGGAAGTGGG + Intergenic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1104501740 12:129292957-129292979 CAGTGGAGAAGTAGAGATATTGG + Intronic
1104577383 12:129980263-129980285 CAGTGAAGATGGAAAGAATTGGG + Intergenic
1104666828 12:130653555-130653577 CAGTGGAGTTGGTGAGAAGAGGG - Intronic
1104805445 12:131586581-131586603 CAGTGGAGCTGGGGAGAAACGGG + Intergenic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105211056 13:18257293-18257315 GGGTGGAGATGGAGAGAGTTAGG + Intergenic
1105580481 13:21691368-21691390 CAGAGGAGATGGAGAAAAACAGG + Intronic
1105605447 13:21922957-21922979 CAGTGGAGATGGACAAGTGTCGG + Intergenic
1106155536 13:27152011-27152033 CAATGGGGATGCAGAGAAATGGG + Intronic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1106653492 13:31717384-31717406 CATTGAAAATGAAGAGAAGTTGG - Intergenic
1106769222 13:32945418-32945440 CCTTGGAGATGGGGAGAAATGGG + Intergenic
1107131507 13:36901308-36901330 CAGTGAGGATGTAGAGAAATTGG - Intronic
1107223482 13:38016844-38016866 GAGTGGAGGTGAAGAGAGGTTGG - Intergenic
1107317542 13:39149995-39150017 AAGTAGAGAAGGAAAGAAGTCGG + Intergenic
1107404985 13:40103784-40103806 CATTGGAGCTGGAGAGATCTTGG - Intergenic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1109287420 13:60426287-60426309 CAGAGGAAATGGGGAGATGTGGG + Intronic
1109826569 13:67729063-67729085 CAGTGCAGATTCAGAGAAGAAGG - Intergenic
1110009274 13:70311386-70311408 GAGTGTCAATGGAGAGAAGTTGG - Intergenic
1110100505 13:71595491-71595513 TAATGGAGAAGGAAAGAAGTAGG + Intronic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1111489761 13:88956514-88956536 CATTGGAAATGGAAAGAAGATGG + Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111846071 13:93510292-93510314 GAGGGAAGATGAAGAGAAGTGGG - Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112566800 13:100558836-100558858 GAGAGGGGATGGAGAGAGGTTGG + Intronic
1113599300 13:111557437-111557459 GAGTGGTGATGGAGAGAAAATGG + Intergenic
1114409320 14:22485996-22486018 CAGAGGAAATGGAGAGAGATGGG + Intergenic
1114450322 14:22821283-22821305 CAGTGAAGCTGGAGTGGAGTGGG - Intronic
1114523649 14:23354125-23354147 TGGTAGAGATGGAGAGATGTGGG - Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115001112 14:28420731-28420753 CAAAAGAGATGGTGAGAAGTGGG - Intergenic
1115141746 14:30179614-30179636 GAGGAGAGATGGAGAGAACTAGG + Intronic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116619268 14:47177661-47177683 CAGTGGGGAGGGATAGCAGTAGG + Intronic
1117108384 14:52422255-52422277 AATTGGAGTTGGAGGGAAGTGGG + Intergenic
1117201685 14:53396228-53396250 CAGAGGAGAGGGAGAGAAATGGG - Intergenic
1117201917 14:53399053-53399075 CAGTGGAGATGGGGTGGGGTGGG + Intergenic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117762355 14:59042999-59043021 CAGTGGAGATGCAGAGCAACTGG - Intergenic
1117840588 14:59856650-59856672 GATTGGGGGTGGAGAGAAGTCGG - Intronic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118148199 14:63163501-63163523 CAGTGGAGGCGTAGGGAAGTGGG - Intergenic
1118151773 14:63197257-63197279 CAGTAGCCATGGACAGAAGTAGG - Intergenic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118480539 14:66160786-66160808 CAGTGGACCTGGGTAGAAGTAGG + Intergenic
1118688385 14:68314237-68314259 CAGTGGAGTAGGAGTGAACTGGG - Intronic
1118723249 14:68608931-68608953 CAGTGCAGAGGTTGAGAAGTGGG - Intronic
1119402218 14:74370661-74370683 TGGTGGAAGTGGAGAGAAGTAGG - Intergenic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119663979 14:76471204-76471226 CCATGGAGATGAAGAAAAGTAGG - Intronic
1119885001 14:78132837-78132859 CAGGGGAGATGCAGAGATATTGG + Intergenic
1120138676 14:80901763-80901785 AGGTGGAGCTGGAGAGAAGGAGG - Intronic
1120295925 14:82640755-82640777 GAGGGGAGATGGGGAAAAGTAGG + Intergenic
1120545769 14:85809406-85809428 AAGTGGAGATGTAGAGAGGTAGG + Intergenic
1121303242 14:92888611-92888633 CCATGGAGGTGGAGAAAAGTGGG + Intergenic
1121328984 14:93037734-93037756 CAGTGGAGATGGTGAGACTCAGG + Intronic
1121456342 14:94041106-94041128 CAGTGGGCATGGCAAGAAGTGGG + Intronic
1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG + Intronic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1121727551 14:96164087-96164109 CGAGGGAGATGGAGAGAGGTTGG + Intergenic
1122149606 14:99717830-99717852 AAGTGGAGGTGGAGAGGAATGGG - Intronic
1122403765 14:101484238-101484260 CAGGAGGGAGGGAGAGAAGTTGG + Intergenic
1122629156 14:103099438-103099460 TGGTGGAGAGGGAGAGGAGTGGG + Intergenic
1123509361 15:20981081-20981103 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123566583 15:21554821-21554843 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123602844 15:21992114-21992136 CAGTGGGGATGGGGAGATATTGG - Intergenic
1124241133 15:28028484-28028506 CAGTGGAGCTGTAGGGAAGGTGG + Intronic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1124427381 15:29572995-29573017 TAGTGGAGATGTCGAGAATTGGG + Intergenic
1124936207 15:34173748-34173770 GAGAGGAGATGGAGACAACTGGG + Intronic
1125012637 15:34897072-34897094 CAGAAGAGATTGAGAGAACTGGG - Intronic
1125241927 15:37585953-37585975 GTTTGGAGATGGAGAGTAGTGGG - Intergenic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125329142 15:38565015-38565037 CAGGGGAGTTGGAGAGGAGCGGG + Intronic
1125466696 15:39960358-39960380 CAGGGGAGATAGAGAGGAGAAGG + Intronic
1125551102 15:40545505-40545527 CAGAGGAGGTGGAGAGAATGGGG + Intronic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127213613 15:56801127-56801149 CAGTTGAGAGGCAAAGAAGTTGG - Intronic
1127215611 15:56820356-56820378 GAGTGGAGATGTAGAGATGGTGG - Intronic
1127492703 15:59480047-59480069 TGGTGGAGATGGGGAGAAGATGG + Intronic
1127697994 15:61470581-61470603 CAGTGGAAATGGAGTGGAATTGG - Intergenic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128511818 15:68318247-68318269 GAGTGGAGGTAAAGAGAAGTGGG - Intronic
1128637315 15:69311486-69311508 CAGGGGAGATGGAAACAACTTGG - Intronic
1129229176 15:74187227-74187249 CAGTGGAGGGAGAGAGAGGTAGG - Intronic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129646231 15:77436338-77436360 CAGTGGAGATGTAGCAAAGAGGG - Intronic
1129714612 15:77839866-77839888 TAGTGGGGTTGGAGAGAAATGGG - Intergenic
1129769090 15:78192354-78192376 CAGAGGTGGTGTAGAGAAGTGGG - Intronic
1130244328 15:82230405-82230427 CAGTGTAGATCGGGAGAGGTGGG - Intronic
1130456124 15:84110718-84110740 CAGTGTAGATCGGGAGAGGTGGG + Intergenic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130960558 15:88656061-88656083 CTGTGGAGTCAGAGAGAAGTAGG + Exonic
1131515862 15:93076257-93076279 GAGTGGAAAGGGAGAGAAGGTGG - Intronic
1131545828 15:93314754-93314776 AGGTGGAGATGGTGAGAAGGTGG + Intergenic
1131867864 15:96731303-96731325 GAGTTGAGATGGGGAGAGGTGGG - Intergenic
1132175272 15:99709161-99709183 CAGTAGAGATGGTGAGACCTGGG + Intronic
1132202226 15:99962888-99962910 CAGTGAAGATAGGGAGAAGTGGG + Intergenic
1132299524 15:100767432-100767454 GAGGGGAGATGGAGAGAGGGAGG - Intergenic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1202974944 15_KI270727v1_random:281916-281938 CAGTGGGGATGGGGAGATATTGG - Intergenic
1133478622 16:6147886-6147908 CAATGGAGATGACTAGAAGTGGG - Intronic
1133537070 16:6712708-6712730 GAGGGGAGGTGGGGAGAAGTGGG - Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134201765 16:12205094-12205116 CAGTGAAGATGGAGAGTCGTGGG + Intronic
1134629810 16:15748508-15748530 CAATGGTGGTGAAGAGAAGTGGG - Intronic
1135030604 16:19035274-19035296 GAGTGGAGAGGGAGAGAGGGAGG + Intronic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135244426 16:20842976-20842998 CAGTGAAGATGTAGATAAGTTGG - Intronic
1135248293 16:20876963-20876985 GAGGGGAGATGAAAAGAAGTGGG + Intronic
1135511454 16:23088101-23088123 CAGTGAAGATGGAGAGCACAGGG + Intronic
1136173457 16:28502285-28502307 CAGTGGAGATGGAAGGAATGGGG - Intronic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1136409719 16:30069232-30069254 CAGTGGCTGTGGAGAGATGTAGG + Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1137847720 16:51708470-51708492 TAGTGGAGCTGGAGAAAAGATGG + Intergenic
1139120215 16:64007274-64007296 GTGTGGAGAGAGAGAGAAGTGGG - Intergenic
1139197029 16:64931182-64931204 GGGTGGAAATGGGGAGAAGTAGG + Intergenic
1139738138 16:69010758-69010780 CACTGGAGATTGAGAGATGATGG - Intronic
1139823725 16:69740719-69740741 CAGTGGAGATGGTAGGAAGGAGG - Intergenic
1140014478 16:71168358-71168380 CAGTGAAGGTGATGAGAAGTAGG - Intronic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1141074776 16:80994697-80994719 CAGTGGTGATGGACAGTGGTAGG + Intronic
1141816163 16:86410594-86410616 GAGTGGAGATGGTGAGTAGGTGG + Intergenic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1142008010 16:87699385-87699407 CAGTGGTGATGTAGAAAAGCAGG + Intronic
1142134178 16:88444094-88444116 AAGTGGGGTAGGAGAGAAGTGGG + Intergenic
1142591710 17:1009170-1009192 CAGTGGGGATGGACAGCAGTGGG - Intronic
1142591719 17:1009204-1009226 TAGTGGGGATGGACAGCAGTGGG - Intronic
1144213819 17:13037157-13037179 CACTGGAGATGAAGAGCAGATGG + Intergenic
1144462328 17:15468181-15468203 CAATGGAGTTGGGGAGAAGGAGG - Intronic
1144505279 17:15824149-15824171 CAGTGAAGATGTGGAGAAATCGG - Intergenic
1145838088 17:27969993-27970015 CAGTGAAGCTGGAGAAAAGAGGG - Intergenic
1145886217 17:28384241-28384263 CAGGGCAGATGGAGAGACTTTGG + Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146477055 17:33171524-33171546 CAATGGTGATGGAGAAAAGCAGG - Intronic
1146506867 17:33413459-33413481 CAACAGAGAGGGAGAGAAGTGGG - Intronic
1146530546 17:33604341-33604363 GAGTGGACATGGAGAGCAGGTGG + Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146833641 17:36091976-36091998 CAGTGGAGCTGCAGAGCAGTGGG + Intergenic
1146848231 17:36198815-36198837 CAGTGGAGCTGCAGAGCAGTGGG + Intronic
1146949314 17:36894697-36894719 CAGTGGTGATGGAGAGTGTTGGG - Intergenic
1147062013 17:37887596-37887618 TAGTGGAGATGGAGAGAGATAGG - Intergenic
1147166472 17:38596189-38596211 CAGAGGAGCTGGAGAGAGGAGGG + Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147685980 17:42287265-42287287 GAGTGGAAATGGAGAGAAAAGGG + Intergenic
1148105069 17:45114626-45114648 CAGTGGAGCTGGAGGGCCGTGGG - Intronic
1148675323 17:49441580-49441602 CAATGGAGAGGCAGAGAAGATGG + Intronic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1149003987 17:51785526-51785548 CAGTGAAGATGTAGAGAAAAGGG + Intronic
1149106703 17:52976033-52976055 CAGTGAAGATGTGGAGCAGTAGG - Intergenic
1149317321 17:55450836-55450858 CAAAGGAGATGGAAAGAAGTGGG - Intergenic
1149585717 17:57785011-57785033 CAGTGGAGATTTCAAGAAGTGGG - Intergenic
1149630257 17:58116216-58116238 CAGTGGGGTAGCAGAGAAGTTGG + Intergenic
1150383746 17:64741145-64741167 CAGTGGAGAGGAAGGGAAGCTGG - Intergenic
1150506822 17:65707315-65707337 TACTAGAGATGGAGAGAAGTGGG - Intronic
1150628610 17:66859846-66859868 GGGTGGAGAGGGAGAGAAGAGGG - Intronic
1150772652 17:68054725-68054747 CAGTGGAGAGGAAGGGAAGCTGG + Intergenic
1150901420 17:69282289-69282311 CAGTGGAGAAGGAGCCAAGAGGG - Intronic
1150935928 17:69635694-69635716 CTGTGGAGATGGACAGAAAAGGG + Intergenic
1152154794 17:78625927-78625949 CAGTGGCCATGCAGAGAAGCAGG + Intergenic
1152816278 17:82410018-82410040 CAGGAGAGATGGGGAGCAGTGGG - Intronic
1153098343 18:1435428-1435450 CAGTGAAGTTGGAAAGAAGTAGG - Intergenic
1153546338 18:6209502-6209524 CAGTGAAGATGTGGAGAAATTGG + Intronic
1154196520 18:12271358-12271380 CAGAGGAGGAGGAGAGATGTGGG + Intronic
1154247550 18:12713122-12713144 CAGTGGAGGAGGAAAGAAGTCGG - Intronic
1154473184 18:14724633-14724655 CAGTGAAGATGCAGAGGAATTGG - Intergenic
1155078041 18:22380270-22380292 CAGTGGTGATGGAGCGGGGTGGG + Intergenic
1155351117 18:24907241-24907263 CAGTACAGGTGGAGAGAAGTAGG - Intergenic
1155530326 18:26760091-26760113 CCTTGGAGTTGGAGAGAAGGGGG + Intergenic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155582329 18:27323844-27323866 CTGGGGAGATGCAGAGAAGCTGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1155662045 18:28260811-28260833 GGGTGGAGATGAAGAGAAGTTGG + Intergenic
1155692277 18:28639787-28639809 CAGTGAAGATGTGGAGAAATTGG - Intergenic
1156452697 18:37275423-37275445 GAGGGGCGAGGGAGAGAAGTAGG + Intronic
1156761308 18:40594540-40594562 CAGTAGAGATGAAAAGATGTGGG - Intergenic
1156920985 18:42522116-42522138 CAGTGGAGATGAAGAGTAATAGG - Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157279339 18:46335369-46335391 GAGTGGAGGTGGGGAGAAGAGGG - Intronic
1157477559 18:48033155-48033177 CAGGGCAGATGGAGAGAATCTGG + Intronic
1157544010 18:48535262-48535284 CAGTGCAGAAGGAAGGAAGTTGG - Intergenic
1157726886 18:49971250-49971272 GAGTAGAGAGGGCGAGAAGTGGG + Intronic
1158387846 18:57014948-57014970 CAGTAGAGATGGAGAACAGCTGG - Intronic
1158777876 18:60608047-60608069 CTGTGGAAATGGATAGAACTAGG - Intergenic
1159046016 18:63368898-63368920 TAGTGAAGATGTAGAGAAATTGG - Intergenic
1159514497 18:69440119-69440141 CTGAGAAGAGGGAGAGAAGTGGG + Intronic
1159626383 18:70700149-70700171 AAGGGGAGATGGAGAGAAGCTGG - Intergenic
1159744195 18:72210995-72211017 CAGTGAAGATGCAGAACAGTTGG + Intergenic
1159920244 18:74221265-74221287 CAGGTGAGAAGGAGAGAAGGAGG + Intergenic
1160133006 18:76246414-76246436 CATTGGAGATGGACAGGAGAAGG - Intergenic
1160591020 18:79944802-79944824 CATGGGAGCTGGAGAGAGGTGGG - Intronic
1161857111 19:6772409-6772431 CAGAGGAGGGGGTGAGAAGTGGG + Intergenic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162080458 19:8214874-8214896 CAGAGGAGATGAAGGGCAGTGGG + Intronic
1162756424 19:12863286-12863308 CAGAGGAGGAGGAGAGAAGGGGG + Intronic
1162915180 19:13870914-13870936 CAGGGGAGCTGGGGATAAGTGGG - Intronic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1163255953 19:16155968-16155990 TGGTGGAGATGGAAAGAAGGAGG + Intronic
1164741143 19:30576358-30576380 CAGTGGAGATGGAGGAACGATGG - Intronic
1165340181 19:35205683-35205705 AAATGGAGAGGGAGAGAAGGAGG - Intergenic
1166549352 19:43654873-43654895 CAGTGGAGCAGGGGAGGAGTGGG + Intronic
1166559766 19:43724596-43724618 CAGTGGAAATGCTGAGAAATTGG + Intergenic
1166594598 19:44034361-44034383 CAAAGGAGATAGAGAGAAGGAGG + Intergenic
1166974828 19:46599952-46599974 CAGTGGAGAGGTAAAGAAGATGG - Intronic
1167163173 19:47780673-47780695 CAGGGGAGAGAGGGAGAAGTGGG - Intronic
1167428797 19:49442857-49442879 CAGTGGCGAGGGTCAGAAGTCGG - Intergenic
1167787840 19:51650363-51650385 CAGTGGAAGTGGTGAGAAGAGGG + Intergenic
1168099486 19:54133743-54133765 GAGGGGAGGTGGAGAGAAGGAGG - Intergenic
1168138924 19:54371769-54371791 CAGTGGAAATGGAGAAACGCAGG - Intergenic
1168159010 19:54496094-54496116 CAGTGGAAATGGAGAAACGCAGG + Intergenic
1168167925 19:54565999-54566021 CAGTGGACAGGGAGAAAAGTAGG + Intergenic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
925663579 2:6228668-6228690 CAGTGAAGATGGTCAGAAATAGG - Intergenic
926114982 2:10207265-10207287 CCATGGAGATGGAGAGAAAAGGG - Intronic
926400402 2:12490698-12490720 CAGAGGAGGAGGAGAGAAGTGGG - Intergenic
926449977 2:12991213-12991235 CAGAGGAGAGGGAGAGAGATGGG - Intergenic
926560051 2:14406863-14406885 CAGTGGAGATGAAGAAGAGTAGG - Intergenic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
926803582 2:16684072-16684094 AAGTGGAGATGAAGAGAAACTGG - Intergenic
927099115 2:19774362-19774384 CAGTGTAGATGGAGATATGAGGG + Intergenic
928660851 2:33500451-33500473 CGGTGGAGATGAAGGGCAGTGGG + Intronic
928814007 2:35267545-35267567 CAGGGGAAAGGGAGAGAAGTTGG - Intergenic
928922453 2:36539659-36539681 CCGTGGAGGTGGGGAGAAGTGGG + Intronic
929241665 2:39659779-39659801 CAGTGGAAACAGAGAGAAATGGG - Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
931666554 2:64613349-64613371 CAGTGGAGGAGGAGAGAGCTGGG - Intergenic
931777650 2:65554163-65554185 CAGTTGAGGTGGAGAGTGGTAGG + Intergenic
931807361 2:65820172-65820194 TAGTAGAGGTGGAGAGAAGCAGG - Intergenic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
932326301 2:70864267-70864289 CCATGTGGATGGAGAGAAGTAGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
933350026 2:81142083-81142105 GAGAGGGGATGAAGAGAAGTTGG - Intergenic
933676613 2:85063204-85063226 CAGTGAAGATGGTGGGAAGGGGG - Intergenic
934087901 2:88525509-88525531 CAGGGAAGATGGGGAGGAGTGGG + Intronic
936019441 2:108983737-108983759 CTTTGGAGTTGGAGAGAAGGTGG - Intronic
936260267 2:110953818-110953840 CAGGAGAGAGAGAGAGAAGTCGG + Intronic
936574419 2:113641530-113641552 CAGGTGTGATGGAGAGAACTGGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936806538 2:116339236-116339258 GAGTGGAGAAGAAGAGAATTTGG - Intergenic
936911902 2:117602240-117602262 TGGGGGAGATGGAGAGAAGCAGG - Intergenic
937048841 2:118871609-118871631 CAGAGGAGCTGGAAAGAAGTAGG - Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938256388 2:129862898-129862920 CAGTGCAGAGAGAGAGAAGAGGG - Intergenic
939017981 2:136923590-136923612 TAATGAAGATGGAGAGAAATTGG - Intronic
939167141 2:138652145-138652167 TAGTGGAGAGGGAGAGGTGTGGG + Intergenic
939424660 2:142019558-142019580 CAATGGGGAAGGATAGAAGTGGG - Intronic
939706428 2:145458920-145458942 CAGTGGAGCTGGTGAGAACAAGG + Intergenic
939786237 2:146516692-146516714 CAGTAGAGATGGAGATAAGCGGG + Intergenic
939835386 2:147124138-147124160 GAGTAGAGAAGGAGAGAAATGGG + Intergenic
939945319 2:148402518-148402540 CATGGAAGATGGGGAGAAGTAGG - Intronic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
940382008 2:153025699-153025721 CAGCAGATATAGAGAGAAGTGGG - Intergenic
941447301 2:165617915-165617937 GAGTGGATGTGGAGAGATGTTGG + Intronic
941885324 2:170521785-170521807 CAGTGGACCTGGACAGCAGTTGG - Intronic
942840946 2:180360061-180360083 CACAGGAAATGGAGAGAAGCAGG + Intergenic
942917637 2:181330771-181330793 GAAAGGAGATGGTGAGAAGTAGG + Intergenic
943748385 2:191486106-191486128 CAAGGGAAATGGAGAGGAGTGGG - Intergenic
944457179 2:199907849-199907871 CAGTTGAGAGGGAGAGGAGTGGG - Intergenic
944529572 2:200653999-200654021 CTGAGGAGAGGGAGAGAAATGGG - Intronic
944877058 2:203972939-203972961 GAGTGGAGTTGGAGAAGAGTGGG - Intergenic
945519966 2:210814211-210814233 CAGGAGCAATGGAGAGAAGTAGG + Intergenic
945654544 2:212607156-212607178 CAGTGGAGGTGGTAAGAAATGGG - Intergenic
945712767 2:213320532-213320554 AAGGGGAGATGAAGAGAAATTGG - Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
946419075 2:219554746-219554768 CGGGGGAGATGGAGAGAGGGAGG + Intronic
946512219 2:220370379-220370401 CAGTGCAGGTGGTGAGAAGTGGG - Intergenic
946628195 2:221637580-221637602 GAGTGGACATGGAAAGAGGTGGG + Intergenic
946867924 2:224059186-224059208 CAGTATAGATGCTGAGAAGTGGG + Intergenic
946919232 2:224560692-224560714 GAGTGGAGATGGAGACCAGTTGG - Intronic
946950699 2:224871398-224871420 CAAGGGAGAAGGAGAGAAATGGG - Intronic
947403052 2:229747978-229748000 CAGTTGAGGTGTAGAGAAGCTGG - Intergenic
948238992 2:236412980-236413002 CCGTGGAGATGGGGAGATGTGGG + Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948481081 2:238251020-238251042 GAGTGGAGATGGTGAGAGCTTGG - Intronic
948551600 2:238776244-238776266 CAGTGGGGAAGGGGAGATGTCGG + Intergenic
948584390 2:239009799-239009821 CAGAGGAGCTGGAGAGGAGACGG + Intergenic
948670633 2:239566472-239566494 CAGTGGAGATGAAGAGAGACAGG + Intergenic
948879133 2:240847259-240847281 CAGCGGAGAGGGAGAGAAGGAGG - Intergenic
949043286 2:241859074-241859096 CAGAGGAGATGGGGAGGAGGTGG + Intergenic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169688108 20:8299827-8299849 AAGTGAAAATGGAGAGAAGTGGG - Intronic
1169843492 20:9965140-9965162 CAGAGGAGATGAGGAGAAATGGG + Intergenic
1170434418 20:16310966-16310988 GAGAGCAGAAGGAGAGAAGTGGG - Intronic
1170545664 20:17433898-17433920 GAGAGGAAAGGGAGAGAAGTAGG - Intronic
1170630246 20:18058822-18058844 GAGGGGAGAGGGAGAGAAGGAGG + Intronic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1170801938 20:19597702-19597724 GAGGGGAGATGAAGAGAGGTTGG - Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171067776 20:22035610-22035632 CACTGGAGACTGAGAAAAGTGGG - Intergenic
1172074292 20:32282210-32282232 CAGTGGAGATGGTAAGAGGACGG + Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1172790505 20:37502095-37502117 AGGTGGAGCTGGAGAGAAGGAGG - Intronic
1172977140 20:38914641-38914663 CACTGGAGATGGATATAGGTGGG + Intronic
1173046792 20:39520461-39520483 CAGTGGACATACAGAGTAGTGGG + Intergenic
1173230945 20:41197073-41197095 CAGGGCTGATGGAGAGAAGAAGG + Intronic
1173861684 20:46287917-46287939 CAGTGAGGTTGGAGAGGAGTGGG + Intronic
1174052865 20:47779418-47779440 CAATGGAGATGGAGTGAAATGGG - Intronic
1174332272 20:49829849-49829871 CATGGGAGATGGAAAGAAGGGGG + Intronic
1174747554 20:53078709-53078731 CAATAGAGATGTAGAGAAGTGGG + Intronic
1174921783 20:54711008-54711030 CAGTGGAGAGGTGGAGAATTTGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175309089 20:57999056-57999078 CAGACTAGGTGGAGAGAAGTTGG + Intergenic
1175853262 20:62104927-62104949 CAGGGGAGGTGGAGAAAAGGAGG + Intergenic
1175857306 20:62129015-62129037 GGGAGGAGATGGAGAGAGGTGGG + Intronic
1176801300 21:13433216-13433238 CAGTGAAGATGCAGAGGAATTGG + Intergenic
1177149516 21:17440897-17440919 CTGGGGTGCTGGAGAGAAGTAGG - Intronic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1177774347 21:25551272-25551294 CAGTAGAGATGGACAGATGTAGG + Intergenic
1178231407 21:30789196-30789218 TAGAGGAAATGGGGAGAAGTAGG - Intergenic
1178384599 21:32138875-32138897 CTGCTGAGATGGGGAGAAGTGGG + Intergenic
1178596858 21:33962161-33962183 GAGTGGAGTTGGAGAGAAACAGG + Intergenic
1178809863 21:35871808-35871830 CAGTGCAGATGGACAAGAGTCGG - Intronic
1180629219 22:17215808-17215830 CATGGGGGATGAAGAGAAGTTGG + Intronic
1181499256 22:23306558-23306580 TAGAGGAGATGGAGACACGTTGG + Intronic
1181922978 22:26334906-26334928 AAGGGGAGATGGAGAGATGCTGG - Intronic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1182729806 22:32479026-32479048 CACTGGAGATGAAGAGACCTTGG + Exonic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1182983171 22:34691755-34691777 AAAGGGAAATGGAGAGAAGTAGG - Intergenic
1182994150 22:34797503-34797525 CAGTGGAGAGAGATAAAAGTAGG + Intergenic
1183084457 22:35478056-35478078 GAGAGGAGAAGGAGGGAAGTGGG - Intergenic
1183381494 22:37492560-37492582 GAGTGGAGAGGGAGAGATGAAGG + Intronic
1183724559 22:39581217-39581239 AAGTGGGGAGGCAGAGAAGTGGG + Intronic
1183832624 22:40426469-40426491 CAGTTGAGTAGGAGAGAAGGAGG - Intronic
1184772769 22:46607605-46607627 CAGCGGAGATGGAGCCAAGCAGG - Intronic
1184968740 22:48000085-48000107 GAGTGGAGATGGGGAGAGGTTGG - Intergenic
1185096933 22:48814003-48814025 CAGAGGAGAGGGAGAGAGATGGG - Intronic
949165160 3:931597-931619 CCATGGAGGTGGGGAGAAGTGGG - Intergenic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950011579 3:9727898-9727920 CAGTGGGGAGGGAGAGAAAGTGG + Intronic
950119772 3:10474097-10474119 CAGTGGTGTTGGAGAGGTGTGGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
951214917 3:20014740-20014762 CACTGGGGATGGAGACAAGTGGG - Intergenic
951245586 3:20337774-20337796 CAGTGGACTTGGAAAGAAATGGG + Intergenic
951651302 3:24954652-24954674 CAATAGAGAGGGAGAGAAGGGGG + Intergenic
952439762 3:33314308-33314330 CAGGGGAAATGGGGAGATGTTGG - Intronic
952901383 3:38114178-38114200 GAGTGGAGATGGCGGGAAGTGGG + Intronic
953005963 3:38979680-38979702 CAGTGGAGATAGAGAGACTTTGG - Intergenic
953237811 3:41121402-41121424 AAGTGGAAATGGAGAGGGGTTGG + Intergenic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
953849485 3:46455071-46455093 CCGTGGGGCTGGTGAGAAGTTGG + Intronic
953924931 3:46978014-46978036 CAGTGGAGGTGGAGAGGGGGCGG - Intronic
954138283 3:48592333-48592355 CAGTGGTGAGTGAGAGATGTGGG - Exonic
954444577 3:50539856-50539878 CAGTGGAGATGGGTAGGTGTGGG - Intergenic
955078067 3:55632459-55632481 CAGGTGAGATGGAGACAAGGAGG + Intronic
955521236 3:59777552-59777574 TAGTGGAGGTGGAGAGAAATAGG - Intronic
955711067 3:61779537-61779559 CAGTGAAGATGGAGGGATGTAGG + Intronic
955741539 3:62096073-62096095 GAGTTGAGCTGGAGAGAAGTAGG + Intronic
956014499 3:64867385-64867407 TAGTGGAGAAGGAAAGAAGAGGG + Intergenic
956112597 3:65884737-65884759 AAGTGGGGATGGAGAGATGGAGG - Intronic
956141278 3:66149104-66149126 CTGTGGACATGGGGATAAGTGGG + Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956471625 3:69573150-69573172 CAGTGAAGATAGAGAGAAGAGGG + Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956851716 3:73234098-73234120 CAGTGGAGATGGAGAAATTGAGG - Intergenic
957157709 3:76566725-76566747 GGGTGGAGAGGAAGAGAAGTGGG + Intronic
957343095 3:78926385-78926407 CAAAGGAAATGGAGATAAGTGGG + Intronic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
957856032 3:85879995-85880017 CAGGGGCGATGGAGAGTAGAGGG - Intronic
957941370 3:87008921-87008943 GAGGGGTGATGAAGAGAAGTTGG - Intergenic
958133442 3:89458653-89458675 CAGCGAAGATGCAGAGAAATAGG - Intronic
958676187 3:97272067-97272089 CAGAGGAAAAAGAGAGAAGTAGG - Intronic
958684015 3:97369372-97369394 CAGTGGACATATAGAAAAGTGGG + Intronic
958728299 3:97932838-97932860 CAGTGGATCTGGAAAGAAGATGG - Intronic
959089216 3:101884622-101884644 GACGCGAGATGGAGAGAAGTAGG + Intergenic
959107148 3:102077436-102077458 CAGTGGTCATGGAAAGAAATGGG + Intergenic
959325129 3:104927374-104927396 CAGAGGAGAATGAGAGATGTGGG - Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
959874598 3:111367752-111367774 AAATGGAGATGTAGAGAGGTTGG - Intronic
960454778 3:117857284-117857306 AGTTGGAGATGGAGAGAAGTAGG - Intergenic
960537036 3:118826034-118826056 TGGTGGAAATGGAGAGAAGGAGG + Intergenic
960702198 3:120450323-120450345 CAGAGGAGACTGAGAGTAGTTGG - Intronic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
961369603 3:126421507-126421529 AAGCAGGGATGGAGAGAAGTGGG + Intronic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962436260 3:135369883-135369905 CAAGGGAGAGAGAGAGAAGTTGG - Intergenic
962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG + Intergenic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963087610 3:141453121-141453143 CAGTGAAGATAGAGAGAAAGGGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
963757888 3:149255220-149255242 CATTCCAGATGGAGAGAAGAGGG + Intergenic
964159750 3:153632774-153632796 AAGGTGAGAGGGAGAGAAGTAGG - Intergenic
965382509 3:168007313-168007335 TAGTGAGTATGGAGAGAAGTGGG + Intergenic
965447367 3:168791692-168791714 ATGGGGAGATGAAGAGAAGTTGG + Intergenic
965464680 3:169013337-169013359 CAGTGCAGATAGAGAGAAGCAGG - Intergenic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966302523 3:178495381-178495403 TAGTGGAGATGAAGCCAAGTGGG - Intronic
966431051 3:179832134-179832156 CAGTGGAGAACGAGAGAATTAGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966542846 3:181111031-181111053 CAGTGAAGATCGGGAGAAATGGG - Intergenic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967367057 3:188699244-188699266 ACGTGGAGACGGAGAGAGGTGGG + Intronic
967417535 3:189235393-189235415 AAGGGAAGATGGAGAGAGGTGGG + Intronic
967954665 3:194869076-194869098 CGCTGGAGATGGGGAGAAGAAGG + Intergenic
967983945 3:195081599-195081621 CAGTGTAGATGCAGAGAACCAGG - Intronic
967992791 3:195144199-195144221 CACTCGAGATGGAGTGGAGTGGG - Intronic
968647806 4:1749010-1749032 CGGTGGGGAGGGAGAGCAGTGGG - Intergenic
968743379 4:2342839-2342861 CAATGGGAAAGGAGAGAAGTGGG + Intronic
969186668 4:5479515-5479537 CAGTGGAGGTGGAGTGGAGATGG + Intronic
969211356 4:5689939-5689961 CAGCAGAGCTGGAGAGAAGCTGG - Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969728066 4:8937272-8937294 GAAAGGAGATGAAGAGAAGTTGG + Intergenic
969890871 4:10258905-10258927 CAATGAAGATGTATAGAAGTGGG - Intergenic
969984026 4:11188507-11188529 CAGTGGAGAAGCACAGAACTTGG - Intergenic
971052424 4:22876260-22876282 CAGTGGAGATGAAGAGAGGTGGG - Intergenic
971251877 4:24979424-24979446 GAGAAGACATGGAGAGAAGTGGG + Intronic
972393335 4:38634052-38634074 GAGTGGAAATGAAGAGAAATGGG - Intergenic
972766889 4:42159466-42159488 CAGTGACGATGGAAGGAAGTGGG + Intergenic
972962607 4:44472720-44472742 TAGTGGAGGTGAAGTGAAGTGGG + Intergenic
972988128 4:44790811-44790833 CAGGGGAGATGAAGAGGGGTTGG - Intergenic
973945907 4:55955537-55955559 CAGAAGAGATAGAGAAAAGTGGG + Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
975023818 4:69524398-69524420 CAGAGGAGAGGGAGAGAGATGGG + Intronic
975583559 4:75928610-75928632 GAGTGGAGATGCTGAGAAGATGG + Intronic
975647271 4:76557464-76557486 CAGGGGAAATGGGGAGATGTTGG + Intronic
976025176 4:80679068-80679090 CAGAGGACAGGAAGAGAAGTGGG - Intronic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
976482382 4:85559742-85559764 CAGGGAAGATGAAAAGAAGTTGG - Intronic
976540443 4:86268289-86268311 CAGTAAAGATGGTGAGAAGATGG - Intronic
978277362 4:106967996-106968018 GAGAGGAGATGGAGAGATGAAGG + Intronic
978561679 4:110040775-110040797 GAGGGGAGAGAGAGAGAAGTGGG - Intergenic
978645394 4:110925079-110925101 CAGCAGAGATGGAGAGAAACTGG - Intergenic
978957652 4:114634059-114634081 CTGCAGAGATGGTGAGAAGTGGG + Intronic
979108914 4:116725115-116725137 AAGTGGAGATGGCGAAAAGTAGG - Intergenic
979995156 4:127423551-127423573 TAGTGGAAATGAAGAGAAATAGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980953284 4:139402927-139402949 ACATGGAAATGGAGAGAAGTTGG - Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981729753 4:147885013-147885035 CAGTGGGGGTGGAGCCAAGTGGG + Intronic
981756657 4:148147210-148147232 CACTGGAGATGGAGGAAAGGTGG - Intronic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
982166576 4:152618709-152618731 AAGTGGAGGTGGAGAGAAAGTGG - Exonic
982550116 4:156787190-156787212 CAGTTGAGAGAGAGAGAAGGAGG + Intronic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984500201 4:180549154-180549176 AAGGGGAGATAGAAAGAAGTTGG - Intergenic
984592924 4:181636641-181636663 CAGCAGAGGTGGGGAGAAGTGGG - Intergenic
984675125 4:182538698-182538720 TAGTGGAGTTGAAGAGAAGTGGG + Intronic
984783582 4:183548087-183548109 GGGAGGAGATGGAGAGATGTTGG - Intergenic
984837282 4:184033663-184033685 TGGTGGAGCTGGAGATAAGTGGG - Intergenic
985707084 5:1407629-1407651 CACGGGAGATGGGGAGAAGCCGG - Intronic
985715723 5:1459882-1459904 TAGTGGGGATGCTGAGAAGTGGG - Intronic
986092406 5:4523262-4523284 GGGTGGTGATGGCGAGAAGTGGG + Intergenic
986184794 5:5425158-5425180 CAGTGGAGATGTTGAAAAGTGGG - Intronic
986346339 5:6838818-6838840 CAGTGGAGATGCTGAGAAGCAGG + Intergenic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
986612137 5:9579707-9579729 CAGGGGAAAGGGTGAGAAGTGGG + Intergenic
986639349 5:9857155-9857177 AGGAGGAGATGAAGAGAAGTTGG + Intergenic
987652829 5:20766265-20766287 AAGAGGAGATGAAGAGAAGTTGG + Intergenic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
987760373 5:22154373-22154395 TAGGGGAAATGGAGAGATGTTGG - Intronic
988156097 5:27450820-27450842 AGGAGGAAATGGAGAGAAGTAGG + Intergenic
988249185 5:28732894-28732916 GAGTGGGGATGGGGAGATGTTGG - Intergenic
988285999 5:29217133-29217155 CAGTGGAAATGAAGAGCAGCTGG - Intergenic
988742729 5:34095219-34095241 AAGAGGAGATGAAGAGAAGTTGG - Intronic
989125539 5:38049108-38049130 CAGGGGAGTGGGAGAGGAGTGGG + Intergenic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
989532380 5:42523618-42523640 CAGAGGAGAGGGAGAGAGATAGG - Intronic
990058563 5:51617756-51617778 TAGAGGAGATGGAGAGAGGTTGG - Intergenic
990059546 5:51630400-51630422 CTGTGGAGATGTGGAGAAATAGG + Intergenic
990831663 5:59965815-59965837 TAGTGGAGATGGAGACCATTCGG - Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
990875172 5:60476382-60476404 CAGTGGAGATTGTGAGAGGATGG - Intronic
991481926 5:67090298-67090320 AAGTGGGGAGGGGGAGAAGTGGG - Intronic
991481938 5:67090330-67090352 AAGTGGGGAGGGGGAGAAGTGGG - Intronic
991487968 5:67157621-67157643 CAGGAGAGATGGAGAGGACTGGG + Intronic
991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG + Intergenic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991936238 5:71803628-71803650 CCAAGGAGAAGGAGAGAAGTAGG + Intergenic
993087837 5:83385769-83385791 CAGTGAGGATGGAGAAAAATTGG + Intergenic
993355564 5:86902990-86903012 TAGTGGAAAAGGAGAAAAGTGGG - Intergenic
993495096 5:88599974-88599996 CAGGGAAGGTGGAGAGGAGTGGG + Intergenic
993787316 5:92159265-92159287 CTGAGGAGATGGAGAGTGGTGGG - Intergenic
993805719 5:92406656-92406678 CTAAGGAGATGGAGAGAAATGGG - Intergenic
994021054 5:95026477-95026499 CAATGGAGATAGAGAGTAGAAGG - Intronic
994038109 5:95225799-95225821 GAAGGGAGATGGAGAGAAGAGGG - Intronic
994681626 5:102894880-102894902 CAGTAGAGAAGGAGAAAAGAGGG - Intronic
995183095 5:109247039-109247061 CAGTGGGGATGGAGTAAACTGGG + Intergenic
995298287 5:110545576-110545598 ATGTGGAGAAGGAGAGAAATAGG + Intronic
995683863 5:114749819-114749841 CAGCTGAGATGGCCAGAAGTGGG + Intergenic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996368787 5:122731257-122731279 AAGGGGAGATGAAGAGAGGTTGG - Intergenic
997063736 5:130538478-130538500 GAGAGAAGATGGGGAGAAGTTGG + Intergenic
997202254 5:132018052-132018074 CAGTACAGAGGGAGAGAAGAGGG + Intergenic
997709394 5:135990952-135990974 CAGCGGAAGTGGAGAGCAGTGGG + Intergenic
997885813 5:137629055-137629077 CAGTACAGGAGGAGAGAAGTGGG - Intronic
998046979 5:138995693-138995715 AAGAGGAGATGAAGAGAGGTTGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998386716 5:141761408-141761430 CACAGGAGGTGGTGAGAAGTAGG - Intergenic
998405271 5:141870683-141870705 CAGGGGAGATGGGCAGAAGAAGG - Intronic
998481775 5:142468895-142468917 CAGAGGATATGGGGAGATGTTGG + Intergenic
998887995 5:146714823-146714845 CAGGGGAGAGGGAGAGAATAAGG - Intronic
998892102 5:146757172-146757194 GAGTGGAGAGGGAGGGAGGTAGG + Intronic
998973130 5:147614483-147614505 CAGTAGAGATAAAAAGAAGTAGG - Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG + Intronic
1000129270 5:158279743-158279765 CTGAGGAGATGGAGAGAGATGGG - Intergenic
1000200917 5:159010208-159010230 CAGATGAGATGGAGATGAGTAGG + Intronic
1000452892 5:161412395-161412417 CAGTGGAGATGGTAAGGAATCGG - Intronic
1000993555 5:167935620-167935642 AGGTGGTGAAGGAGAGAAGTTGG + Intronic
1001061733 5:168496457-168496479 AAGCAGAGAGGGAGAGAAGTGGG + Intronic
1001064353 5:168524124-168524146 GAGGGAAGATGAAGAGAAGTGGG + Intergenic
1001528273 5:172444658-172444680 CAGTGGAGATGGAGGGAGAGAGG - Intronic
1001680375 5:173552728-173552750 GAGTGGAGATGGAGAACAGCTGG - Intergenic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1001848254 5:174940497-174940519 GGATGGAGATGGAGAGAAGGAGG + Intergenic
1002026078 5:176397132-176397154 CGGAGGAGATGGAGATAAGGAGG - Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002379304 5:178814230-178814252 CCGTTGAGAGGGAGAGAAGGGGG - Intergenic
1002533895 5:179865611-179865633 CAGGGCAGCTGGAGAGAAGCTGG + Intronic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003281503 6:4696126-4696148 GAGGGGAGATGGGGAGATGTTGG + Intergenic
1003366161 6:5476795-5476817 GAGTGGAAATGGGGAGAGGTGGG + Intronic
1003682399 6:8269040-8269062 CAGTGGTGATGGAGAAAACCAGG + Intergenic
1003722078 6:8715032-8715054 CAGTGCAGATGGAGAACAGAAGG - Intergenic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1005390928 6:25332419-25332441 CAGTGAAGGTGTAGAGAAGTGGG + Intronic
1005529706 6:26690473-26690495 GAGTGGAGATGGAAAGAAAAGGG + Intergenic
1005541090 6:26811174-26811196 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1005954354 6:30653347-30653369 TACTGGAGATTGAGAGCAGTTGG - Exonic
1006042392 6:31267221-31267243 CAGTGGAGATGGGGAGACTCTGG - Intergenic
1006051979 6:31352309-31352331 CAGTGGAGATGGGGAGACTCTGG - Intronic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1006576539 6:35050678-35050700 CTGTGCAGATGGGGAGAAGCCGG - Intronic
1006609570 6:35286098-35286120 GAGTGGAAATAGAGAGAAATGGG - Intronic
1006627590 6:35408387-35408409 GAATGGAGCTGGGGAGAAGTAGG + Intronic
1006748607 6:36362679-36362701 CTGGGGAGATGGAGAAAAGGTGG + Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006856586 6:37137846-37137868 AAATGGAGAGGGAAAGAAGTAGG - Intergenic
1006920750 6:37625655-37625677 GAGGGAAGAGGGAGAGAAGTTGG - Intergenic
1006938880 6:37738203-37738225 CAGTGGGGAGGGTGAGAAGGGGG + Intergenic
1007192190 6:40028915-40028937 CAGTGAGGGTGGAGAAAAGTAGG + Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1007995756 6:46306115-46306137 CAGGGGATATGGTGAGGAGTAGG + Intronic
1008100153 6:47381318-47381340 CAGTCCAGATGGAGAGATTTAGG + Intergenic
1008309116 6:49943218-49943240 CAGTTGAGATAGACAGAAATGGG + Intergenic
1008718435 6:54318487-54318509 TAGTGAGGATAGAGAGAAGTAGG - Intronic
1008798476 6:55337138-55337160 GAGGAGAAATGGAGAGAAGTTGG - Intronic
1008924064 6:56873723-56873745 GAGGGGAGATGAAGAGAGGTTGG + Intronic
1009011903 6:57853262-57853284 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1009609070 6:65914822-65914844 TAGTGGAGATTGAGAGGAGTTGG - Intergenic
1009912052 6:69942506-69942528 GAGTGGGGATAGGGAGAAGTTGG - Intronic
1010016585 6:71111174-71111196 TATTGGAGATGGAGAGAAAATGG - Intergenic
1010116174 6:72315273-72315295 TAGTGAAGATGGTGAGAAGAGGG + Intronic
1010246604 6:73665368-73665390 AAGGGGGGATGAAGAGAAGTTGG + Intergenic
1010306449 6:74328765-74328787 CAATGGGAATGAAGAGAAGTTGG - Intergenic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1012143790 6:95656141-95656163 AAGTGGGGATGGAGAAAAGGTGG - Intergenic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1012464734 6:99504536-99504558 CAGAGGATCTGGAGAGAAATGGG + Intronic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1014137321 6:117905433-117905455 CAGAGGAGATGTAGAGCATTTGG + Intergenic
1014340326 6:120197530-120197552 GAGTGGAGATGGAAAGCACTAGG + Intergenic
1015369181 6:132431423-132431445 GAGGGGAGATGAAGAGAGGTTGG - Intergenic
1015495984 6:133883872-133883894 CAGAGGAAATGGTGAGAAGAGGG + Intergenic
1015510222 6:134031040-134031062 GAGTGGAACTGGAGATAAGTAGG + Intronic
1015598076 6:134885144-134885166 GAGGGGAGATGGAGAGAGGGGGG + Intergenic
1015888661 6:137946864-137946886 AAGTGGAGATGGATACAAGGGGG - Intergenic
1015910524 6:138164159-138164181 CAGTGGAAATGGACTGGAGTGGG - Intronic
1016099636 6:140082744-140082766 CAATGGAAATGGTGAGAAGAAGG + Intergenic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1016616939 6:146061058-146061080 CTGTGGAGAGGGAGAGAGATGGG + Intronic
1016912598 6:149214158-149214180 CAGTGAAGATGGAGAAGAGCAGG - Intergenic
1017043464 6:150325920-150325942 CAGGGGAGGTGGTGAGAAGTGGG + Intergenic
1017165877 6:151408062-151408084 CAGTGGACATGAAGAAAAGGTGG + Intronic
1017243727 6:152198687-152198709 CAGAGGAGAAGGAGAGAGATTGG + Intronic
1017612846 6:156209473-156209495 GAGGGGAGATGAAGAGAAGCTGG - Intergenic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020442012 7:8227352-8227374 CAGAGAAGATGGAGAGAGGAAGG + Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021545464 7:21808515-21808537 GAGAGGGGATGCAGAGAAGTTGG - Intronic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021801063 7:24306752-24306774 CAGATGAGATAGAGAGAAGCTGG + Intergenic
1021946286 7:25731002-25731024 CAGTAGAGATGGAAAAAAGTGGG - Intergenic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022552471 7:31254282-31254304 TAGGGGAAATGGAGAGATGTTGG - Intergenic
1022594545 7:31699954-31699976 CAGGGGAGAGGGAGAGAGATAGG - Intronic
1022729604 7:33010082-33010104 CAGGGAAGATGGAGAGGAATAGG - Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023398966 7:39777850-39777872 CAGTGAAGATGTGGAGGAGTTGG - Intergenic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1024046223 7:45587432-45587454 CGGTGGGGTTAGAGAGAAGTTGG + Intronic
1024089798 7:45925824-45925846 CACTGGAGATGGAGAGACGGAGG + Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024313735 7:47994036-47994058 AATTGGAGATGTGGAGAAGTGGG + Intronic
1024316544 7:48024514-48024536 TAGTGGAAATGTAGAGAAATTGG + Intronic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1024651475 7:51406840-51406862 CAGTGAAGATGTGGAGGAGTTGG + Intergenic
1024657514 7:51464206-51464228 GGATGGAGATGGAGAGAAGTGGG + Intergenic
1024741595 7:52360854-52360876 CAGATGAGAAGGAGAGAAGGTGG - Intergenic
1024777323 7:52802649-52802671 CAGTGGAATAGGAGAGAAGATGG - Intergenic
1025061860 7:55816205-55816227 GATTGGGGAGGGAGAGAAGTGGG + Intronic
1025133680 7:56392650-56392672 CAGTGAAGATGTGGAGGAGTTGG + Intergenic
1025978131 7:66385759-66385781 CAGGAGAGAGGGAGAGAATTAGG - Intronic
1027271291 7:76520548-76520570 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027321055 7:77010483-77010505 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1028768606 7:94589341-94589363 CAATGGAGATGGGGAGGAATGGG - Intronic
1028831106 7:95327422-95327444 CAGTGGAAATGGGGAAAATTGGG - Intergenic
1028987194 7:97017816-97017838 CAATGGAGAGGAAGAGAAGGTGG + Intergenic
1030109853 7:106017901-106017923 CAGTGGAGATGGAGTACAGGAGG - Exonic
1030200170 7:106895223-106895245 CAGTTGAGAAGGAGAGAATGAGG + Intronic
1030350260 7:108476985-108477007 TAGGGGAAATGGAGAGATGTTGG + Intronic
1030704561 7:112678091-112678113 AGATGGAGATGGAGAGAACTGGG + Intergenic
1031132102 7:117844355-117844377 AAGTGGAGATGGGGTGAAGCAGG + Intronic
1031378170 7:121052623-121052645 CAATGGAGAAGGTGAGAAGGGGG + Intronic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032318650 7:130864771-130864793 CAGGGGGAATGAAGAGAAGTTGG + Intergenic
1032478107 7:132226025-132226047 CAGAGGAGAGGGAGTGAAGGAGG + Intronic
1032653457 7:133903411-133903433 CAGCAGAGATGGAGGGAACTGGG + Intronic
1032853623 7:135816169-135816191 TGGTTGAGATGCAGAGAAGTGGG + Intergenic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1034427354 7:151021117-151021139 CAGAGGAGAGGGGAAGAAGTGGG - Intronic
1035332546 7:158105723-158105745 CAATGGAGATGGATAGAGCTGGG - Intronic
1036445324 8:8817156-8817178 CAGTTTAGATGGAGAGAGGATGG - Intronic
1036485211 8:9173202-9173224 CAGTTGAGATGGAAAGAAAGTGG - Intergenic
1036561784 8:9904880-9904902 GAGTGGAGATGGAGGTGAGTAGG - Intergenic
1036757639 8:11481783-11481805 CAATGGAGATGGGGAAAAGTGGG + Intergenic
1037456185 8:19066566-19066588 CTGTGGAGTAGAAGAGAAGTTGG - Intronic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037802661 8:22043913-22043935 CACTGGATATGAAGAGAAGCGGG - Intronic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039158719 8:34592956-34592978 GAGTGGCAATGGAGAGATGTTGG + Intergenic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1041449610 8:57993315-57993337 TACTTGAGAGGGAGAGAAGTTGG + Intergenic
1041487187 8:58392189-58392211 CAGAGAAGATGGGGAGGAGTAGG - Intergenic
1041508865 8:58632524-58632546 CAGTGAGGTTGGAGAGAAGCAGG - Intronic
1041523463 8:58779736-58779758 AGGTGGAGATGAAGAGAAGTAGG - Intergenic
1041800051 8:61788936-61788958 TAGGGGAAATGGAGAGATGTTGG - Intergenic
1041878226 8:62715084-62715106 CAGAGGAGAGAGAGAGAAGTAGG + Intronic
1042016138 8:64314623-64314645 CAGCAGAGAGGGAGAGAAGTGGG + Intergenic
1042124734 8:65526904-65526926 CAGTGGAGAGGTAAAGAGGTTGG - Intergenic
1042838598 8:73100923-73100945 AATTGGAGATGGAAAGAACTAGG + Intronic
1042882413 8:73508359-73508381 CTGAGGAGATGGAGAGAGATGGG + Intronic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1042943452 8:74130964-74130986 CTGGGGAGATGGAGAGAGTTGGG + Intergenic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044350765 8:91163558-91163580 AAGTGGAAGTTGAGAGAAGTAGG - Intronic
1044472980 8:92593315-92593337 CAGAGCATATGGAAAGAAGTTGG - Intergenic
1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG + Intergenic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1044833889 8:96277311-96277333 TAGTGGAGATGGTGGGGAGTTGG + Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044963879 8:97556905-97556927 CGGTGTAGAGGGAGAGGAGTGGG + Intergenic
1045064685 8:98435012-98435034 CAGTCCAGGTGGAGAGCAGTGGG - Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1046026028 8:108725084-108725106 CAGGGGAGATGGCTCGAAGTGGG - Intronic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1046120858 8:109844981-109845003 GAGTGGAGATGAAGAGAGGTTGG - Intergenic
1046424025 8:114022741-114022763 CTGAGGAGAGGGAGAGAAATGGG + Intergenic
1046515000 8:115247558-115247580 CAGGGGAGCTGGAGAAATGTAGG - Intergenic
1046780164 8:118206146-118206168 CATTGGAAATGGAGACAAGCTGG - Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047634485 8:126744996-126745018 CAGTGAAGATGAAGAAAAGTAGG + Intergenic
1047703625 8:127474902-127474924 CAGAGGAGATGGGGAGAGATGGG - Intergenic
1047939777 8:129818086-129818108 CAGGAGAGATGGAGAGATGTAGG - Intergenic
1047984905 8:130222510-130222532 CAGTGGAGAAGGATAGGATTTGG - Intronic
1048001992 8:130386205-130386227 CAGTGGTGATGCAGAGAAAAGGG + Intronic
1048008759 8:130440120-130440142 CAATGGAGGTAGAGAGAAGTGGG - Intronic
1048065140 8:130960114-130960136 CAGTGGAGATGGAGAAACATGGG + Intronic
1048190204 8:132281580-132281602 AGGTGGAGATGGAATGAAGTAGG - Intronic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048451461 8:134537465-134537487 CAGTGGACCGGGAGAGATGTGGG + Intronic
1048497711 8:134948811-134948833 CAGGGAAGATGAAGAGAAGGAGG - Intergenic
1048667139 8:136674990-136675012 TAGTGGCGATGCAGAAAAGTAGG + Intergenic
1048748983 8:137649606-137649628 AAGAGGAGATGGAAAGAAGGAGG + Intergenic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049152097 8:141041603-141041625 AAGTGGATGTGGAGAGAGGTGGG + Intergenic
1049299037 8:141860088-141860110 ATGCGGAGATGGAGAGAGGTGGG + Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1050085068 9:1956562-1956584 AAGAGGAGATGGAGAGAGGTTGG + Intergenic
1050580041 9:7044494-7044516 CAGTGATGATGGAGAGAACAGGG + Intronic
1050782606 9:9356604-9356626 AAGTAGTGATGGGGAGAAGTAGG + Intronic
1050820226 9:9869866-9869888 CAGCAGAGATTGAGACAAGTGGG + Intronic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051355360 9:16235294-16235316 CAGCGGAGATGGTGGGAAGGGGG - Intronic
1052342053 9:27373562-27373584 CAGTTGAGATGGAAGAAAGTGGG - Intronic
1052658547 9:31398245-31398267 AGGGGGAGATGAAGAGAAGTTGG - Intergenic
1053025012 9:34722217-34722239 CAGTAGAGAGGGTGAGAAGTGGG + Intergenic
1053040584 9:34867395-34867417 CAGAGGTAATGGAGAGAGGTGGG + Intergenic
1053255537 9:36614062-36614084 CAGTGGAGGTGGTAAAAAGTGGG + Intronic
1053510116 9:38680569-38680591 GAGTTGAGATGTAGAAAAGTGGG + Intergenic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1055124400 9:72702592-72702614 CAAGAGAGATGGAGAGAATTTGG + Intronic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1055346934 9:75349760-75349782 CAGTGGAGGTGGCGAGGGGTGGG + Intergenic
1056139128 9:83657480-83657502 CAGTGGAGGTGGTAAGAAGTTGG - Intergenic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1056673396 9:88651347-88651369 GAGCAGAGATGGAAAGAAGTGGG + Intergenic
1056932791 9:90892726-90892748 CCTTGCAAATGGAGAGAAGTTGG + Intronic
1057786460 9:98091853-98091875 CGGTGGAGATGGTGGGATGTTGG - Intronic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1057919327 9:99083760-99083782 CAGTGGATGTGGTGAGAAGTGGG + Intergenic
1058285001 9:103166664-103166686 CAGTGAGGATGTGGAGAAGTGGG - Intergenic
1058288452 9:103209099-103209121 CAGGGGAGACAGAGAGAAGGGGG + Intergenic
1058732292 9:107861922-107861944 AAGAGCAGATGGAGAGAAGTGGG + Intergenic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1058935163 9:109763306-109763328 CTATGGAGATGGAGAGAAAAGGG - Intronic
1059710956 9:116867260-116867282 CCGAGGAGAGGGAGAGAAGGTGG + Intronic
1059770159 9:117416133-117416155 CAGGGAAGATGAAGAAAAGTAGG - Intergenic
1059975275 9:119709557-119709579 CAGTGTAGTTGGAGTGAATTAGG - Intergenic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060550683 9:124483640-124483662 CAGTGATGATGGAGACAAGATGG - Intronic
1060654376 9:125358978-125359000 CTTTGTAGATGAAGAGAAGTAGG - Intronic
1060730882 9:126036277-126036299 CAGTGGAGGTGGGGACAAGAGGG - Intergenic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1061279077 9:129586730-129586752 CAGTGGAGTTGGGTAGGAGTGGG + Intergenic
1061633137 9:131886420-131886442 CAGTGGGGGTAGGGAGAAGTGGG - Intronic
1061749532 9:132767959-132767981 CAGGGGAGGTGAAGAGAGGTTGG + Intronic
1061776226 9:132966706-132966728 CAGTTATGATGGAGAGAACTGGG + Intronic
1062170713 9:135133289-135133311 CAGGCGAGCTGGAGAGAAGGGGG + Intergenic
1062665353 9:137668101-137668123 CAGTGGGGAGGCAGACAAGTAGG + Intronic
1062703542 9:137921123-137921145 AAGTGCAGATGGAGAAAAGAAGG + Intronic
1185669524 X:1795007-1795029 AAGTGAGGATGGAGAGACGTTGG - Intergenic
1186657351 X:11629133-11629155 TGGTGGAGATGGAGGAAAGTAGG - Intronic
1186658721 X:11645736-11645758 AAGAGGAGAAGGAGAGGAGTAGG + Intronic
1187423909 X:19160384-19160406 CAGTGCAATTGGAGAGAACTAGG - Intergenic
1187454550 X:19429706-19429728 AAGTGTGGATGGAGAGAAGGTGG + Intronic
1187718717 X:22130138-22130160 CAATGGGGAGGGAAAGAAGTGGG - Intronic
1187984662 X:24797217-24797239 CAGGGGAAATGGAGAGAGGGTGG - Intronic
1188221880 X:27550662-27550684 GAGGGAAGATGGAGAGAGGTTGG - Intergenic
1188465058 X:30470367-30470389 CAGTAGAAATGGTGAGTAGTGGG - Intergenic
1188520343 X:31031581-31031603 GAGTGGTGATAGAGAGAAGCAGG + Intergenic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189778070 X:44487900-44487922 GAGGGGAGAAGGAGAGAAGCTGG + Intergenic
1189809954 X:44772713-44772735 TAGTGGTGATGGAGAGAAAAAGG - Intergenic
1190302526 X:49065010-49065032 CAGGTGAGAGGGGGAGAAGTGGG - Intronic
1190335464 X:49259073-49259095 CAGTGGAGAAGGCGAGAAGTGGG + Intronic
1191053189 X:56216143-56216165 AAGTGAAGATGAAGAGAAGTAGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191711127 X:64150991-64151013 CAGGAGAGAGAGAGAGAAGTGGG + Intergenic
1191852343 X:65594702-65594724 CAGTGAATCAGGAGAGAAGTAGG + Intronic
1191887264 X:65901474-65901496 CAGTGGTGATGGGAAGAATTAGG + Intergenic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192491419 X:71579543-71579565 CAGTGGCTGTGGGGAGAAGTGGG + Intronic
1192571461 X:72209604-72209626 TAGTAGAGATGGAAAGAAGGTGG - Intronic
1193740033 X:85205892-85205914 CAATGGAGATAGAGAGAAGTGGG + Intergenic
1193951572 X:87807302-87807324 TAATGGAGATGGAGAGTAATAGG - Intergenic
1194409954 X:93544999-93545021 CAGGGGAGAGAGAGAGAAGGGGG + Intergenic
1195084366 X:101400366-101400388 TAGTGAAGATGGAAGGAAGTGGG + Intronic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195229722 X:102834026-102834048 GAGTGGAGATGGGGGGAAGAGGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195418123 X:104642150-104642172 GAAAGGAGAGGGAGAGAAGTAGG - Intronic
1195598918 X:106724254-106724276 TAGTGGACATGAAGAGAAGTGGG - Intronic
1195635771 X:107114193-107114215 CAGTGAAATTGGAGAGAGGTAGG - Intronic
1195910064 X:109880450-109880472 CAGAGGAGATGGGGAGAAGCAGG - Intergenic
1196560128 X:117136469-117136491 GAGAGGAGATGAAGAGAGGTTGG - Intergenic
1196649010 X:118149851-118149873 CAGTGGATACGGGGAGAAGATGG - Intergenic
1196666547 X:118323179-118323201 TAGTGGACTTGGAAAGAAGTTGG - Intergenic
1196903224 X:120407134-120407156 AAGTGGGGATGGATAGAAATGGG - Intergenic
1197452163 X:126632785-126632807 TCATGGAGATGGAGAGAAGAAGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1197867230 X:131032255-131032277 GAGGGGAAATGGAGAGATGTTGG - Intergenic
1198134673 X:133736718-133736740 CAGGGGAGATGGAGAGTAATAGG + Intronic
1198171550 X:134110800-134110822 TTGTGGAGATGAAGAGAGGTTGG - Intergenic
1198629435 X:138618380-138618402 GAGTGGGGATAGAAAGAAGTAGG - Intergenic
1199226100 X:145376536-145376558 TAGTAGAGATGGAGACAAGGAGG + Intergenic
1199259783 X:145758986-145759008 AAGTGGACAGGGAGAGAAGCAGG + Intergenic
1199338734 X:146650532-146650554 CAGTGAAGTTCAAGAGAAGTGGG + Intergenic
1199397605 X:147357821-147357843 CATTGGAGACTCAGAGAAGTAGG + Intergenic
1199475029 X:148235783-148235805 TAGAGGAGATGAAGAAAAGTAGG - Intergenic
1199686702 X:150271591-150271613 CAGTGGAGGTGGAGACAAGTGGG + Intergenic
1199784112 X:151089140-151089162 TAGTGGATATTGAGAGAAATTGG - Intergenic
1200945213 Y:8828811-8828833 TGGTAGAGATGGTGAGAAGTGGG + Intergenic
1201519026 Y:14851975-14851997 CAGTGGAGATAGACATAGGTGGG - Intergenic
1201938475 Y:19433185-19433207 CAGTGCAAAAGGAGAGAATTAGG + Intergenic
1202370231 Y:24191255-24191277 CAGTGGTGCTGCAGAGAAATTGG + Intergenic
1202500553 Y:25478862-25478884 CAGTGGTGCTGCAGAGAAATTGG - Intergenic