ID: 1195409627

View in Genome Browser
Species Human (GRCh38)
Location X:104555807-104555829
Sequence GCTTCTATCAAGGTGAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195409627_1195409635 10 Left 1195409627 X:104555807-104555829 CCCCAGCTCACCTTGATAGAAGC No data
Right 1195409635 X:104555840-104555862 GTGGATGTGGCCAAGAAATCAGG No data
1195409627_1195409633 -3 Left 1195409627 X:104555807-104555829 CCCCAGCTCACCTTGATAGAAGC No data
Right 1195409633 X:104555827-104555849 AGCTTTACTCCAGGTGGATGTGG No data
1195409627_1195409632 -9 Left 1195409627 X:104555807-104555829 CCCCAGCTCACCTTGATAGAAGC No data
Right 1195409632 X:104555821-104555843 GATAGAAGCTTTACTCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195409627 Original CRISPR GCTTCTATCAAGGTGAGCTG GGG (reversed) Intergenic
No off target data available for this crispr