ID: 1195413263

View in Genome Browser
Species Human (GRCh38)
Location X:104592340-104592362
Sequence ACTGATAAGCACAATGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195413263_1195413266 21 Left 1195413263 X:104592340-104592362 CCTTCTACATTGTGCTTATCAGT 0: 1
1: 0
2: 0
3: 19
4: 238
Right 1195413266 X:104592384-104592406 GACTGTCTACTCCAAGATCGTGG 0: 1
1: 0
2: 0
3: 3
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195413263 Original CRISPR ACTGATAAGCACAATGTAGA AGG (reversed) Intronic
906125098 1:43422792-43422814 AATGATACGGACCATGTAGAAGG - Exonic
908230060 1:62095657-62095679 ACTGGGAAGCACAATGTGAAAGG - Intronic
908812259 1:67994899-67994921 ACTAATATCCAAAATGTAGAAGG + Intergenic
909029968 1:70528185-70528207 ACTGACATGCACAATGTCAAAGG + Intergenic
909253846 1:73393090-73393112 ACTGAGAACCACAATAGAGAAGG + Intergenic
909733456 1:78925979-78926001 AATGGTAAGCACTATGTTGAGGG - Intronic
909876417 1:80810042-80810064 ACTGATAAACAATATGAAGAAGG - Intergenic
909989353 1:82203694-82203716 ACTGATATACACAATCTATAAGG - Intergenic
910655009 1:89610219-89610241 ACTGACAAGCACAGTGGGGAGGG - Intergenic
911679295 1:100695856-100695878 ACTAATAACCACAATATATAAGG - Intergenic
911754148 1:101533394-101533416 ACTGAAAAGAACAAGGCAGATGG + Intergenic
913456297 1:119034782-119034804 ATCTATAAGTACAATGTAGATGG + Intronic
915817824 1:158988687-158988709 ACTTCTAAGCACAATGTTGAAGG + Intergenic
918995133 1:191749061-191749083 ACTGATTAGCAATATGGAGAAGG - Intergenic
1062807884 10:437973-437995 ACTGCTAAGCACAAAATAGCTGG + Intronic
1062942077 10:1430219-1430241 ACTGATAAGAAAACTGTAAAAGG + Intronic
1063912645 10:10848088-10848110 ACTGATATGCACAATATAGCGGG - Intergenic
1066639775 10:37544217-37544239 GATGATAAGCTCAATGTAAATGG - Intergenic
1071898974 10:90097786-90097808 ACTTATAAGCACTTTGAAGATGG + Intergenic
1073180886 10:101582529-101582551 ACTGAGAACCAGAATCTAGAGGG + Intronic
1073810701 10:107149537-107149559 TCTGATTAGCACAATGGTGATGG - Intronic
1073827711 10:107344464-107344486 ACTGATATCCAGAATGTATAAGG - Intergenic
1074038519 10:109765004-109765026 ACTGCTCAGAACAATGAAGAAGG + Intergenic
1075601534 10:123772876-123772898 AGTGATAACCACAATGAAGGAGG - Intronic
1077480068 11:2809956-2809978 ACTGATAAGAACTGTGTGGAAGG + Intronic
1079748051 11:24157681-24157703 ACAGATAAGCTCAAAGTACAGGG + Intergenic
1080017363 11:27521589-27521611 ATTGATAAGGACAAAGTTGAGGG - Intergenic
1080950993 11:37032677-37032699 ACAGATAAGCAGCATTTAGAGGG + Intergenic
1082132207 11:48504877-48504899 ATTAATAATGACAATGTAGAAGG + Intergenic
1082244599 11:49906565-49906587 ATTAATAAGGACAATGTAGAAGG - Intergenic
1082565669 11:54675495-54675517 ATTAATAATGACAATGTAGAAGG + Intergenic
1084280686 11:68089406-68089428 ACTGGTAAGGACAAAGAAGAAGG + Intronic
1084365746 11:68696727-68696749 ACTAAATAGCAGAATGTAGAGGG + Intergenic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1085657928 11:78333613-78333635 ACTGAAAAACAAAATGTAGGTGG + Intronic
1086461787 11:87013068-87013090 TCTGAGAGGCACAATGTGGATGG - Intergenic
1087862754 11:103182550-103182572 ACAGATAACCACAATTTAGCAGG + Intronic
1088115794 11:106311317-106311339 CCAGAAAAGCACAATGTGGAAGG + Intergenic
1088817105 11:113428924-113428946 AATTATGAGTACAATGTAGATGG + Intronic
1089069904 11:115691533-115691555 ACTCAGAAGCACAGAGTAGAAGG + Intergenic
1089072038 11:115708106-115708128 ACTCTTAAGCACATTGCAGAAGG - Intergenic
1090239064 11:125169329-125169351 ACTGAGAAGCAGAATTTAGAGGG + Intronic
1092832050 12:12453709-12453731 ACTGAAATGCACACTGTAAAAGG - Intronic
1093480225 12:19596774-19596796 ATTGATAAGAATAATGAAGAGGG + Intronic
1093772890 12:23038004-23038026 ACTGGAAAACACAATGAAGATGG - Intergenic
1093902829 12:24655279-24655301 ACTAATAATCAGAATGTATAAGG - Intergenic
1094723949 12:33093094-33093116 ACAGATCACCACAATGTATAAGG + Intergenic
1094789681 12:33897602-33897624 ACTAATAACCAGAATCTAGAAGG + Intergenic
1095422244 12:42037157-42037179 AGTGATAAGCAGAATATATAAGG + Intergenic
1095578914 12:43772515-43772537 ACTGATTAATACAATGAAGATGG - Intronic
1098801711 12:74968165-74968187 ACTCATAAGCTCAAAGTAAAGGG + Intergenic
1099100491 12:78433826-78433848 ATTAATAAGCACAATATATAAGG - Intergenic
1099482035 12:83179541-83179563 ACTACTTAGCACAATATAGAAGG - Intergenic
1099759823 12:86905101-86905123 ACTGAGAACCAAAATGTAAAAGG + Intergenic
1099826743 12:87785329-87785351 ACTGTGAAGCACAAAGAAGAGGG - Intergenic
1100096788 12:91049142-91049164 ACTTAGCAGCACAAGGTAGAAGG - Intergenic
1100208299 12:92375305-92375327 ACTGAGAAGATCAATTTAGAAGG - Intergenic
1102904929 12:116667187-116667209 ACTGACAAGCTGAAGGTAGAAGG + Intergenic
1104521786 12:129482193-129482215 ACGCATAAGCACAGTGGAGATGG - Intronic
1105554156 13:21429871-21429893 ACTGAACAGCAGAATGGAGAGGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106010702 13:25818999-25819021 ACTGATAATAAAAATGTATAAGG + Intronic
1106696173 13:32175905-32175927 AGTGATAAGTACAATGAAAAAGG - Intronic
1107724384 13:43283422-43283444 AATAATAAACACAAAGTAGAGGG - Intronic
1108183769 13:47868058-47868080 AGTGTTAAAAACAATGTAGAAGG - Intergenic
1109112100 13:58334452-58334474 ACACATACGCACAATGTATATGG + Intergenic
1109173355 13:59124091-59124113 ATTAATAACCACAATATAGAAGG + Intergenic
1110822947 13:79937535-79937557 GCTGTGAAGAACAATGTAGAAGG - Intergenic
1111067209 13:83109115-83109137 ATTGGAAAGCACAATTTAGATGG - Intergenic
1111519454 13:89381275-89381297 AATGATAAGCACTGTATAGATGG + Intergenic
1112194694 13:97213644-97213666 AAAGATAAGCAAGATGTAGATGG - Intergenic
1113316571 13:109186382-109186404 ACAGATGAGCACAAGGCAGATGG + Intronic
1115063517 14:29224553-29224575 TATGATAAGCTCAATGCAGATGG + Intergenic
1118437070 14:65781364-65781386 AGTGATGAGGACAATGAAGAAGG - Intergenic
1120131666 14:80815173-80815195 ACTGATAAACAGAATTTACAAGG + Intronic
1120465206 14:84847995-84848017 ACTGAGAATCACAATGTAAGAGG - Intergenic
1121988980 14:98536490-98536512 ACTCATAAGCACAATGCATTGGG + Intergenic
1122536412 14:102466691-102466713 ACTGAGCTGCACACTGTAGAAGG - Intronic
1123136925 14:106036550-106036572 ACTGATAGGCAGAATTTACACGG - Intergenic
1126860560 15:52878615-52878637 ACATATAAACACAAAGTAGAAGG - Intergenic
1127018922 15:54723087-54723109 ATTGATAACCCGAATGTAGAAGG - Intergenic
1127090746 15:55464565-55464587 ACTAATATCCACAATGTACAGGG + Intronic
1129732836 15:77941726-77941748 ACTGCCAAGCACAGTGTCGATGG - Intergenic
1131608992 15:93941151-93941173 ACTGAAATGCAAAATGTAAATGG - Intergenic
1131778155 15:95824553-95824575 ACAGAGAATCACAATGTTGACGG + Intergenic
1137313979 16:47297332-47297354 TCTTATAAGCAGCATGTAGATGG + Intronic
1138214507 16:55191482-55191504 TCTGATCAGCATATTGTAGAAGG + Intergenic
1144486427 17:15668902-15668924 ATTAATAAGCAAAATGTATAAGG + Intronic
1144914593 17:18713390-18713412 ATTAATAAGCAAAATGTATAAGG - Intronic
1146125224 17:30226031-30226053 ACTGATAGGCATCAAGTAGATGG - Intronic
1147670280 17:42173087-42173109 ATTGATAACCACAATGCAGATGG - Intronic
1149418991 17:56490187-56490209 ACACATAAGTACAATGTAGTAGG + Intronic
1150192053 17:63253320-63253342 ATTAATAAGCAGAATGTATAAGG - Intronic
1150918059 17:69456461-69456483 TCTGATAATTACAATGGAGAAGG - Intronic
1150940351 17:69686524-69686546 ACTCATAAGCTCAAAGTAAAAGG - Intergenic
1153206192 18:2704729-2704751 ACAGATAATTACAAGGTAGAAGG + Intronic
1153317990 18:3743188-3743210 ACAGATGTGCACAAAGTAGAAGG + Intronic
1153553061 18:6282721-6282743 ACTGAAAAGAACAATGCAGCTGG + Intronic
1153801812 18:8677842-8677864 ACTTATATGCACAATATATAAGG + Intergenic
1155612968 18:27689191-27689213 AATGATAATAACAATGAAGATGG - Intergenic
1156083868 18:33375883-33375905 ACTGAGAAGCATAAGGCAGAAGG + Intronic
1157365544 18:47061050-47061072 CCTCAAAGGCACAATGTAGATGG + Intronic
1160608431 18:80069491-80069513 ATTGCAAAGCAAAATGTAGATGG + Intronic
1164833523 19:31341041-31341063 ACTGAAAAATACAATATAGATGG + Intronic
1165408930 19:35646619-35646641 ACAAATAATCACAATGTTGATGG + Intergenic
925600492 2:5604095-5604117 ACTGAGATGCTCAATCTAGAAGG - Intergenic
925800545 2:7595191-7595213 GCATATAAGCACAAGGTAGAGGG + Intergenic
925926412 2:8674111-8674133 ACTCAAAAGCACAGTGGAGAGGG + Intergenic
926945405 2:18182223-18182245 ACTGATGAGCACAATGGGTAGGG - Intronic
926951364 2:18247049-18247071 ACAGATAAACACAATGAAGGTGG + Intronic
928284660 2:29979345-29979367 ACAGAAAAGCACAAGGGAGAAGG + Intergenic
928882313 2:36111083-36111105 ACTGATATCCAGAATGTACAGGG - Intergenic
929679993 2:43983992-43984014 AATGATCAGCACATTGTAGATGG + Intronic
930618739 2:53622750-53622772 ACTGATAAGGCCTATGTAGAAGG + Intronic
931940837 2:67250312-67250334 ATTGATAACCAGAATGTATAAGG - Intergenic
935834879 2:107039310-107039332 ACTCATAAGCTCAAAGTAAAGGG + Intergenic
937745335 2:125405527-125405549 ATTAATAAGCAGAATGTATACGG - Intergenic
939994448 2:148907090-148907112 ACTGAGAAGGACAATGAAGGTGG + Intronic
940550526 2:155150118-155150140 AATGAAAAGCACAATATATATGG + Intergenic
942836824 2:180309731-180309753 ACTGATACACACAACATAGATGG - Intergenic
943312269 2:186340957-186340979 ACTGATACACACAACATAGATGG + Intergenic
943494391 2:188602259-188602281 ACAGATCAGCATAATATAGAAGG + Intergenic
943745532 2:191458158-191458180 ACAGATAAGCTCAAAGTAGAAGG - Intergenic
945480098 2:210335507-210335529 ACTGATAAGCTCAAAATAAAGGG - Intergenic
945949931 2:216029518-216029540 AATGATAAACACAAGGCAGAAGG + Intronic
1169760657 20:9089385-9089407 ACTTAAAAGCACAAAGAAGAAGG + Intronic
1175192263 20:57219404-57219426 ACTGAGAAGCACAGGGTGGAGGG - Intronic
1175873333 20:62218521-62218543 GCTGATGAGCACGATGTTGAAGG + Exonic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1179038220 21:37778663-37778685 ACGGATACACACAATGTAGTGGG - Intronic
1179986529 21:44924840-44924862 TCTGAAAAGCAAAATGTAGAAGG + Intronic
1181646536 22:24234234-24234256 ACTGAGAAGCACCTTGTATATGG - Intronic
1184569679 22:45314243-45314265 AATGATAAGCACACTGTGCAGGG + Intronic
1184712351 22:46259744-46259766 AATGAAAAGCACAGTGAAGAGGG + Exonic
949359149 3:3213507-3213529 AATGATAAGCAAAATTTGGACGG + Intergenic
949465639 3:4340315-4340337 AGTGGTAAGCACAATGTGAATGG - Intronic
951027406 3:17844588-17844610 ACAGATAAGCACAGTGTACAGGG + Intronic
952361125 3:32631125-32631147 ACAGATAAGTACAAAGAAGACGG - Intergenic
953248301 3:41217735-41217757 TCTGATAAGCAAAAAGTAAATGG + Intronic
955155396 3:56412130-56412152 ACTGATACACACAAAGGAGAAGG + Intronic
957130972 3:76222260-76222282 ACTGAGAGGCATAAGGTAGAAGG + Intronic
957307325 3:78474381-78474403 ATTCATAAGCTCAAAGTAGAGGG + Intergenic
957867783 3:86046783-86046805 ACTAATAAGCACAATGAGGGGGG - Intronic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
959854614 3:111136319-111136341 ACAAATAACCACAATGTAAAAGG - Intronic
959931672 3:111990972-111990994 ACTGAAAAGAAAAATGAAGAGGG - Intronic
960352320 3:116608245-116608267 ACTGATATCCTCAATCTAGAGGG - Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963523552 3:146387313-146387335 ACTGATAAGCAAAATGTTCTTGG + Intergenic
965311905 3:167138977-167138999 ACTCATATGCCCAAGGTAGAAGG + Intergenic
967457917 3:189711202-189711224 TCTGAAAAGCAAATTGTAGATGG - Intronic
968171274 3:196512006-196512028 CCTCATAAGGACAATGTAGGTGG - Intronic
970817038 4:20168806-20168828 AATGAGAAGCAAAATGTAGGGGG - Intergenic
970871339 4:20820384-20820406 ACTGCTAAGCAAAATATTGAGGG + Intronic
970946913 4:21705050-21705072 AGTGATAGACACAATTTAGATGG + Intronic
972564056 4:40254287-40254309 ACAGATAAGATCAATGTAGCTGG + Intergenic
973904455 4:55513975-55513997 ACCAATAAGCACAAGGTAGCAGG - Intronic
975036547 4:69691244-69691266 ATTGATAAGCAGAATCTATAAGG - Intergenic
975708073 4:77130339-77130361 ACTAATAACCAGAATGTATAAGG - Intergenic
977214483 4:94263387-94263409 CCTGAAAAGCACAAAGTAGGGGG + Intronic
977277073 4:94991013-94991035 ACTGAAATGCACAATTTAAAAGG - Intronic
978917112 4:114140681-114140703 ACTGATATCCAGAATGTACAAGG - Intergenic
979046711 4:115875201-115875223 ATTTCTAAGGACAATGTAGAAGG - Intergenic
979911438 4:126371693-126371715 ACTGATAAGTAAACTGCAGAAGG + Intergenic
984275310 4:177602571-177602593 CCTTAAAAGCACAATGTATATGG + Intergenic
984751118 4:183276225-183276247 ACTTATAAGCAGTATGTAGTTGG + Intronic
985262983 4:188132004-188132026 ACTCAGAAGCAGAAAGTAGAAGG - Intergenic
985574575 5:668060-668082 ACCGACAAGCACACTGGAGAGGG + Intronic
986345352 5:6829894-6829916 CCTGAAAAGCAGAATGGAGATGG - Intergenic
989361392 5:40605534-40605556 TATCATAAGCACAGTGTAGAGGG - Intergenic
990106624 5:52271607-52271629 GCTAATATGCACAATGTATAAGG - Intergenic
991132942 5:63146297-63146319 ACTGATAAGCAAAATTTGCAAGG + Intergenic
994386638 5:99141403-99141425 ACTAATATGCACAAATTAGATGG - Intergenic
995997054 5:118313556-118313578 AATGATGAGCACTATGTAGATGG + Intergenic
996694582 5:126379786-126379808 ACTGATATCCAGAATGTACAAGG - Intronic
996998131 5:129724481-129724503 ACTGAGAAGCATAAGGCAGAAGG + Intronic
997100737 5:130966159-130966181 AGTGAAAAGCAAACTGTAGAGGG + Intergenic
997480656 5:134182132-134182154 ACTGATATACACAATGTGGATGG + Intronic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
998816317 5:146017656-146017678 ACTGATTAGCTGAATGTAGGAGG - Intronic
999156667 5:149462992-149463014 ATTGATAAGCAGAATATACAAGG - Intergenic
999552141 5:152700873-152700895 ACTGATAACTACCATGTAGATGG + Intergenic
1003358142 6:5395043-5395065 ACCAATCAGCACAATGTTGACGG - Intronic
1003431455 6:6042301-6042323 ACTAATAAGAAAACTGTAGAAGG - Intergenic
1003994771 6:11528907-11528929 ATTAATAAGCACAATTTATAAGG + Intergenic
1004330657 6:14717542-14717564 AGTCATAGGCACCATGTAGAGGG - Intergenic
1004749112 6:18542569-18542591 AGTGATAAGCAAAATCAAGAAGG - Intergenic
1005409273 6:25525630-25525652 AATGATAACCACAATGTACTGGG + Intronic
1006606085 6:35259031-35259053 ATTGAAAAGGACGATGTAGAGGG - Intronic
1007534851 6:42577239-42577261 ACTGATATCCATAATGCAGAAGG + Intronic
1008402540 6:51080172-51080194 ACTGATAGGAAGAAAGTAGAAGG + Intergenic
1008420941 6:51298428-51298450 AGTGACAAGCCCAAAGTAGAAGG - Intergenic
1009388405 6:63114966-63114988 ACTAAAAAGCACAGTGTAAATGG - Intergenic
1009803658 6:68574192-68574214 ATTGATAACCAGAATATAGAAGG + Intergenic
1012652535 6:101773610-101773632 ACTGATAATATCAATTTAGATGG - Intronic
1012756132 6:103232680-103232702 ACTGATAAGCAGCATGTAAATGG + Intergenic
1012840875 6:104327491-104327513 ACTGACAAGCAAAAAGGAGATGG - Intergenic
1013799726 6:113929020-113929042 AATAATAAGCAGAATGTATAAGG - Intergenic
1014732621 6:125051528-125051550 ACTGGTAGGCATATTGTAGAGGG - Intronic
1014764771 6:125393704-125393726 ACTGGTAACCACAATGATGAGGG + Intergenic
1015724080 6:136281645-136281667 ACTGATTAGTACAATGAAAAAGG - Intronic
1017035451 6:150263114-150263136 AGTGATGAGCTCATTGTAGAAGG - Intergenic
1018297983 6:162369806-162369828 AGTGCTATGCAAAATGTAGACGG - Intronic
1019861652 7:3664422-3664444 ATTTATAAGCACAATGAAAAAGG - Intronic
1020468097 7:8503935-8503957 ACTTAGGACCACAATGTAGATGG - Intronic
1020734436 7:11929525-11929547 AAAGATAAGCAAAATGAAGAAGG + Intergenic
1023220853 7:37919161-37919183 TTTGATGATCACAATGTAGATGG - Intronic
1024509816 7:50195016-50195038 ACGGATAAACAAAATGTAGTGGG + Intergenic
1024767799 7:52681651-52681673 ATTGCTAAGCATGATGTAGAGGG - Intergenic
1027515157 7:79133028-79133050 ACTGGTAAGCAGAATCTACAAGG - Intronic
1028026115 7:85842977-85842999 ACTGATATGCAGAATTTATAAGG - Intergenic
1028041101 7:86056039-86056061 ACTCATAAGCTCAAAGTAAAAGG - Intergenic
1028054048 7:86221876-86221898 ACTTATAAGCTCAAAGTAAAGGG + Intergenic
1028753787 7:94411797-94411819 ACTGTTAAGCAACATGTATATGG - Intronic
1029112356 7:98219497-98219519 ACTCATAACCAGAATCTAGAAGG + Intronic
1029969572 7:104776225-104776247 ACTGATAAGAAAAATGTATTTGG + Intronic
1030543564 7:110863881-110863903 ACTGATAAGCCCAATATCAATGG + Intronic
1030663140 7:112244510-112244532 ACTGATACGCAGAATGTCAATGG - Intronic
1030790725 7:113724843-113724865 ACTAATAAGCAAAATGTACAAGG + Intergenic
1031964370 7:128017111-128017133 GCTGCTCAGCACAGTGTAGAGGG + Intronic
1034843589 7:154422545-154422567 TCTGATCAGCACATTTTAGATGG + Intronic
1037152973 8:15661034-15661056 AATGATAATCACAAAGCAGATGG - Intronic
1039220481 8:35325126-35325148 ACAGATAAGCAGAATTCAGAGGG + Intronic
1039332678 8:36556137-36556159 ACTGATATCCACAATTTACATGG + Intergenic
1039853613 8:41393949-41393971 ACATTTAAGAACAATGTAGAGGG + Intergenic
1040432037 8:47352482-47352504 ACTGAAAACTACAATGTTGAGGG + Intronic
1040454172 8:47579565-47579587 ACTGGCCAACACAATGTAGAAGG + Intronic
1041497184 8:58498723-58498745 AGTGATGAGCACATAGTAGACGG - Intronic
1044792071 8:95857972-95857994 AGAGATAAGGAAAATGTAGAAGG + Intergenic
1045731950 8:105252473-105252495 ACTAATAACCAGAATGTATAAGG - Intronic
1046644595 8:116771813-116771835 TCTGAGAAGCAGAATGCAGAAGG + Exonic
1046765331 8:118063122-118063144 ACTGACAAGCACAAATTAGGTGG + Intronic
1047912159 8:129542091-129542113 AATAACAAGCACAATGTATAAGG - Intergenic
1050101459 9:2124279-2124301 ACTGAGAATCAAAATGTGGAAGG + Intronic
1052107305 9:24535103-24535125 ACTAATATCCACAATCTAGAAGG - Intergenic
1052474281 9:28938413-28938435 ACTCATAAGTAAAATGTAAAAGG - Intergenic
1052718092 9:32143056-32143078 ACTTATAAACATAATGTTGATGG + Intergenic
1055201331 9:73666262-73666284 ACAAATATGTACAATGTAGAGGG + Intergenic
1056039151 9:82643107-82643129 ACTAATATCCAGAATGTAGAAGG + Intergenic
1056099094 9:83283693-83283715 GCTGATAAGCACATAGTAGCTGG - Intronic
1185969627 X:4648013-4648035 ACAGAGGAGCACAAGGTAGAAGG + Intergenic
1188087479 X:25918436-25918458 AGTGATAACCACAATGTATGGGG + Intergenic
1188205278 X:27348235-27348257 ACCAATACGCAGAATGTAGACGG + Intergenic
1188357068 X:29204730-29204752 ATTAATAAGCACAATGTATAGGG - Intronic
1190220090 X:48507337-48507359 ACAGAAAAGGACAATGGAGACGG + Intergenic
1192957071 X:76083210-76083232 ACTAATAAGCAGAATATATAAGG - Intergenic
1193486969 X:82097261-82097283 ATTAATAACCACAATGTATAAGG - Intergenic
1193881941 X:86934374-86934396 ACTGATAGGCCTAATGTAGACGG - Intergenic
1194888602 X:99349741-99349763 ACTGATAAAAAAAATGTAGATGG - Intergenic
1195413263 X:104592340-104592362 ACTGATAAGCACAATGTAGAAGG - Intronic
1195845215 X:109220372-109220394 ACTGGTAAGTACAATTTAAATGG + Intergenic
1196357174 X:114808845-114808867 ATTAATAAGCAGAATGTATAAGG - Intronic
1198714993 X:139549004-139549026 GCTGATCAGCACAATCTATATGG + Intronic
1198835489 X:140800334-140800356 ACTGATATGCTCAAAGTAGATGG - Intergenic
1199082402 X:143591517-143591539 ACTGAGAGGCATAAGGTAGAAGG + Intergenic
1199202518 X:145109150-145109172 AGTTAAAATCACAATGTAGAGGG - Intergenic
1200014833 X:153151944-153151966 GCTGATAGGAACAATATAGAGGG + Intergenic
1202018508 Y:20437131-20437153 ATTGATAACCAAAATGTATAAGG + Intergenic