ID: 1195416442

View in Genome Browser
Species Human (GRCh38)
Location X:104625173-104625195
Sequence ATGCATGGATGGATGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5114
Summary {0: 1, 1: 28, 2: 415, 3: 1382, 4: 3288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195416442 Original CRISPR ATGCATGGATGGATGGAGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr