ID: 1195419605

View in Genome Browser
Species Human (GRCh38)
Location X:104659151-104659173
Sequence CCTACCACTGAGAAATTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195419601_1195419605 20 Left 1195419601 X:104659108-104659130 CCAGTTATGTTGGAAAGTAGCCA 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1195419605 X:104659151-104659173 CCTACCACTGAGAAATTGTTGGG 0: 1
1: 0
2: 0
3: 6
4: 136
1195419602_1195419605 0 Left 1195419602 X:104659128-104659150 CCAAAATAAAAATGATGTTTAAT 0: 1
1: 3
2: 15
3: 96
4: 998
Right 1195419605 X:104659151-104659173 CCTACCACTGAGAAATTGTTGGG 0: 1
1: 0
2: 0
3: 6
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195419605 Original CRISPR CCTACCACTGAGAAATTGTT GGG Intronic
901683005 1:10926399-10926421 CTTCCCACTGAGGAATTGGTGGG - Intergenic
903825218 1:26139968-26139990 CCTGGCACAGAGAAATTGGTTGG - Intergenic
904894667 1:33805457-33805479 CCTAACACTTTAAAATTGTTTGG - Intronic
905688805 1:39927724-39927746 CCTGCCACTGTGACATTGGTAGG + Intergenic
907089844 1:51713008-51713030 ACTCCCACAGAGAAGTTGTTTGG + Intronic
919643309 1:200066525-200066547 CCCACCCCTGAGAAATCTTTGGG - Intronic
921366831 1:214382225-214382247 CTTACTAATGAGAAAATGTTTGG - Intronic
1064631564 10:17318937-17318959 CCTACCAGGAAGAAAATGTTAGG + Intronic
1065641230 10:27784235-27784257 TCTATCACTGAGAAAATTTTTGG - Intergenic
1068001242 10:51336612-51336634 CCTGGCATAGAGAAATTGTTTGG + Intronic
1068708169 10:60100672-60100694 CCTAGCATTGTAAAATTGTTTGG + Intronic
1071542056 10:86494537-86494559 TCTACCACTGTGAACTTGATAGG + Intronic
1072243212 10:93517284-93517306 CCTGACACTTAGAAAGTGTTCGG - Intronic
1074832099 10:117256276-117256298 CCTACCACTGGGACAGTCTTGGG - Intronic
1075594583 10:123719347-123719369 CCTAACACTGTGAAACAGTTTGG - Intronic
1076146110 10:128124277-128124299 CTTACAACTGAGAATTTGTTTGG + Intronic
1076148005 10:128140516-128140538 AATAGAACTGAGAAATTGTTTGG + Intergenic
1076715229 10:132360608-132360630 CCTGACACTTAGAAAGTGTTCGG - Intronic
1078956295 11:16199331-16199353 CCTAGCACATAGAAAGTGTTTGG - Intronic
1079061096 11:17249484-17249506 CATATCACTGAGAAAATGTTAGG - Intronic
1080539298 11:33251322-33251344 CCAACCACAGAGAGATTATTTGG + Intergenic
1085594303 11:77793865-77793887 GCTACCCCTGAGAGCTTGTTTGG - Intronic
1085807973 11:79653892-79653914 CCTACCACGGGGTAATTGTGTGG + Intergenic
1086105723 11:83144684-83144706 CCTACCACTGAGAAAGCCTAAGG + Intergenic
1086126833 11:83357309-83357331 CCTACCACTGGGAGTTTCTTAGG - Intergenic
1086514448 11:87595698-87595720 CATACCCCTCAGAGATTGTTGGG - Intergenic
1086554957 11:88098430-88098452 CCTGCTACTGAGAGAATGTTGGG - Intergenic
1086876281 11:92099619-92099641 TCTACCACAGAAAAATGGTTTGG + Intergenic
1087301709 11:96443532-96443554 CCCACCACTCAGAAATTATCAGG + Intronic
1088737034 11:112736438-112736460 CCTAAAACTGAGAAAGTGCTGGG - Intergenic
1090855899 11:130609164-130609186 CCTCCCACTGAGAAAGTGGGTGG + Intergenic
1091480656 12:827000-827022 CCTATCATTGATAACTTGTTTGG + Intronic
1091657369 12:2355365-2355387 CCTTCCACTGAGGAAATGTGGGG - Intronic
1096257951 12:50074227-50074249 CTCACCACTGAGAAGTTGTGAGG - Intronic
1097299416 12:58002542-58002564 CCTACCAGTGAGATCTTGTCAGG - Intergenic
1097700818 12:62818596-62818618 CCTACCTCTGAGAACTGATTTGG - Intronic
1098245448 12:68512620-68512642 GTTACCAATGTGAAATTGTTTGG + Intergenic
1099582599 12:84470374-84470396 TCTACCACAGTGATATTGTTTGG + Intergenic
1100729165 12:97444933-97444955 CATACCACTGAAATATTGTCAGG + Intergenic
1104111887 12:125711830-125711852 CCTACCAGTGAGACCTTATTTGG + Intergenic
1108949952 13:56079195-56079217 CCTACCACTGGGAATCTTTTGGG + Intergenic
1109336590 13:61002914-61002936 ACTACCAGTGAGAATTTGCTGGG + Intergenic
1109855778 13:68126047-68126069 GCTACCTGTGAGAAGTTGTTTGG - Intergenic
1110042576 13:70782619-70782641 CATACCACAGAGAAACTTTTTGG - Intergenic
1110562244 13:76921810-76921832 CCTACCTCAGAGATATTGCTGGG - Intergenic
1121505129 14:94471425-94471447 ATTTCCACAGAGAAATTGTTGGG - Intronic
1125337922 15:38646270-38646292 CCTATCACTGAGGAATATTTAGG - Intergenic
1132382058 15:101372881-101372903 CCTACCGATGAGCAATTGGTTGG - Intronic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1138031392 16:53562170-53562192 CCTGGCACAGAGAAATTGCTGGG - Intergenic
1139222457 16:65197619-65197641 CCTGCCACTGACAAAATATTAGG - Intergenic
1139498472 16:67339787-67339809 CATACCACGGAGAAATTAGTGGG - Intronic
1140110139 16:71997252-71997274 CATACAACTGAGCAATTGCTGGG - Intronic
1141392692 16:83677852-83677874 CCTCCCTCTGAGATATCGTTAGG - Intronic
1145745234 17:27314048-27314070 ATTTCCACTGAGAAATTATTTGG + Intergenic
1146543842 17:33721103-33721125 TCTTCCACTGAGAAATGGCTGGG - Intronic
1146651299 17:34608198-34608220 CCTATCACTCAGAAATTCTGAGG + Intronic
1147511945 17:41077397-41077419 CATCCCACTGAGAAATTTTAAGG - Intergenic
1149031730 17:52091379-52091401 TTTACCACTGAGAAGTTGTTAGG - Intronic
1151009228 17:70473743-70473765 ACTATCATTGAGAAATTATTAGG - Intergenic
1153481407 18:5550853-5550875 CCTATAATTGAGAAGTTGTTGGG - Intronic
1156338408 18:36188960-36188982 CCTACCACTCAGAAATAGAGGGG + Intronic
1163831243 19:19548124-19548146 CCTTTCATTGAGAAAGTGTTGGG + Intergenic
1164467184 19:28497293-28497315 CCAACCACAGAGAATTTTTTTGG - Intergenic
925375564 2:3381879-3381901 CCTAACACAGAAAAAGTGTTTGG + Intronic
925650174 2:6081128-6081150 CAACCCACTCAGAAATTGTTCGG + Intergenic
927395076 2:22640459-22640481 CACACTACTGAGAAATTTTTTGG - Intergenic
931326181 2:61226550-61226572 ACTACCACAGAGAAATCTTTAGG - Intronic
932129597 2:69175856-69175878 CTTGCCACAGAGAAATTTTTAGG - Intronic
934063163 2:88315525-88315547 ACTAAAACTGAGAAAATGTTAGG + Intergenic
935958560 2:108401599-108401621 TCTACCACTGAGTACCTGTTAGG - Intergenic
936724118 2:115291678-115291700 ACTACCACTGGGAAACTTTTGGG + Intronic
945727180 2:213485715-213485737 ACTTCCACTTAAAAATTGTTTGG + Intronic
947729891 2:232421800-232421822 CCTACCCCTGTGATATGGTTTGG + Intergenic
1169491263 20:6073191-6073213 CCTACCACTGAGAGATTCTGGGG + Intergenic
1176632682 21:9154288-9154310 CCTTACACTGAGGAACTGTTGGG - Intergenic
1181336031 22:22129721-22129743 TTTATCAATGAGAAATTGTTCGG + Intergenic
1181960144 22:26616849-26616871 CCTACCACTTAGTAGCTGTTTGG - Intronic
949197366 3:1328350-1328372 CCTACCACTAAGAAACCCTTGGG - Intronic
950494727 3:13326947-13326969 CCTACCACTGCCAGATTGTGTGG - Intronic
951045867 3:18037882-18037904 CCTTCCACTGAGGAACTGGTAGG - Intronic
953090609 3:39722294-39722316 CCTACCACTCAGGAAGAGTTGGG + Intergenic
953567540 3:44045677-44045699 CCTGTCACTCAGAACTTGTTTGG + Intergenic
954786749 3:53098972-53098994 CCTACCCCTGAGAACCTGATTGG - Intronic
957939016 3:86981321-86981343 CCAACCATTGAAAAATTGGTAGG - Intronic
961565837 3:127762805-127762827 CTTACCATTGATAAATTGCTTGG - Intronic
962994513 3:140612111-140612133 CCTACCACTCAGGCATTTTTTGG + Intergenic
964239940 3:154580534-154580556 CCTATCACTCAGAAAATTTTAGG - Intergenic
965814122 3:172619259-172619281 ACTACCTCTGTGATATTGTTTGG + Intergenic
967598223 3:191353187-191353209 CCTAACACTGGGAAAATGTCTGG + Intronic
968163219 3:196443964-196443986 CCTAGCACTTAGAGATTTTTAGG + Intergenic
969059574 4:4424359-4424381 CCTGCCACTGTGATACTGTTGGG - Intronic
969155633 4:5207211-5207233 CCTAACACTGTGATATGGTTTGG + Intronic
971816160 4:31492295-31492317 CTTACCACTGTGATATGGTTTGG - Intergenic
978216047 4:106205160-106205182 TCTGCCACTGTGAAATTGGTCGG + Intronic
979087573 4:116432518-116432540 CCTATCACACAGAAATTTTTTGG - Intergenic
981017250 4:139987033-139987055 CCTGCCACTTAGAAAAGGTTTGG + Intronic
984305301 4:177981804-177981826 CCTACCACGGTGAAAATGTGAGG - Intronic
984428479 4:179618341-179618363 CCTACCACTCAGCAAGTGCTGGG + Intergenic
985806663 5:2049775-2049797 TATAACACTAAGAAATTGTTAGG - Intergenic
989022436 5:37024917-37024939 ATTACCACTGAGGAATTGGTTGG - Intronic
990271769 5:54149546-54149568 TCAACCACTGAGAATTTGCTTGG - Intronic
990387855 5:55285770-55285792 CCAATCAATCAGAAATTGTTTGG + Exonic
991925528 5:71701897-71701919 TCTACCACTCAGAAGTTGTGTGG + Intergenic
992579906 5:78162276-78162298 CCGAACACTTAGATATTGTTTGG + Intronic
995553583 5:113304233-113304255 CTTACCACTAAAAAATAGTTGGG + Intronic
1001002043 5:168016663-168016685 CCTCCCACTGAGAAGGTGCTTGG - Intronic
1005170267 6:22976716-22976738 CATAGCATTGAGAGATTGTTTGG - Intergenic
1008502562 6:52198409-52198431 CTTACCAATAAGAATTTGTTTGG - Intergenic
1010800842 6:80174044-80174066 ACTACCACTTAGAAATTGTCAGG - Intronic
1017234091 6:152101423-152101445 CCTTCCACTGTATAATTGTTTGG - Exonic
1020700697 7:11478715-11478737 CCTAACATTGTGAAAATGTTAGG - Intronic
1020807228 7:12805217-12805239 CCTTCCTCTGAGATATTTTTTGG + Intergenic
1021360425 7:19706285-19706307 CCTATCACTAAGACAATGTTAGG + Intronic
1024417880 7:49129120-49129142 ACTACCAATAAGAAATTGTGTGG - Intergenic
1025934112 7:66020469-66020491 CCTACCATTGAGATTTTGATAGG - Intergenic
1027333956 7:77128605-77128627 CCTGCCACACAGAAATTGTAGGG + Intronic
1028414258 7:90563125-90563147 CCTACAATTGAGAAAAGGTTGGG - Intronic
1029781837 7:102742687-102742709 CCTGCCACACAGAAATTGTAGGG - Intergenic
1032296126 7:130639971-130639993 CCTACCACTGAGAAAAGGGACGG - Intronic
1032634228 7:133689096-133689118 CCATTCACTGAGAAATTGCTGGG - Intronic
1039286337 8:36044848-36044870 CCTGCAGCTGAGAACTTGTTTGG + Intergenic
1039363619 8:36906899-36906921 CCTCCCACTGAAAATATGTTTGG - Intronic
1043730968 8:83681113-83681135 CCTAGCACATAGAAATTGTGTGG + Intergenic
1045610938 8:103840502-103840524 TCTCCCACAGAGAGATTGTTGGG + Intronic
1046630948 8:116622632-116622654 CCTACCACTCTGATATGGTTTGG + Intergenic
1047004954 8:120610732-120610754 CCTACTCCTGAGATCTTGTTGGG + Intronic
1047702535 8:127463942-127463964 TCTACCACTAAGAAATTCTGGGG - Intergenic
1050470352 9:5982336-5982358 CCTAGCACTGGGCAATTGTAGGG - Intronic
1051602259 9:18887066-18887088 CCTTCCACAGAGAATTTCTTTGG - Intronic
1052020105 9:23515870-23515892 CCTAACACTTGGAAATTGTATGG + Intergenic
1052029837 9:23615977-23615999 CCCACCAGTGAAAAATTGATGGG + Intergenic
1052158754 9:25228530-25228552 TCTACCACTGATAAATTGTCTGG - Intergenic
1056813998 9:89787311-89787333 CCTCCCAATGAGAATTTGTCAGG - Intergenic
1058812480 9:108654520-108654542 ATTACCACTGAAAATTTGTTTGG + Intergenic
1203654966 Un_KI270752v1:14902-14924 CCTACTCCTGAGAATTTGTAGGG - Intergenic
1186029123 X:5347656-5347678 CCTACCATTGAGACATGCTTTGG - Intergenic
1191036228 X:56028846-56028868 CCTAACACTTACACATTGTTAGG - Intergenic
1191887559 X:65904316-65904338 TCTACCACTTAGCAATTGTGTGG + Intergenic
1192206766 X:69101515-69101537 CCTACCACTGATAAGCTGTGTGG - Intergenic
1195419605 X:104659151-104659173 CCTACCACTGAGAAATTGTTGGG + Intronic
1196785319 X:119416972-119416994 CCTGGCAGTGAGAAATTCTTAGG - Intronic
1199492473 X:148416106-148416128 CCTAGCACAGAGGAACTGTTGGG - Intergenic