ID: 1195420266

View in Genome Browser
Species Human (GRCh38)
Location X:104667622-104667644
Sequence GTGATTAAGAGCAGGACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195420266_1195420269 2 Left 1195420266 X:104667622-104667644 CCCAGAGTCCTGCTCTTAATCAC 0: 1
1: 1
2: 1
3: 25
4: 169
Right 1195420269 X:104667647-104667669 GTCCATGTTGTGCCTTTGTGTGG 0: 1
1: 0
2: 0
3: 19
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195420266 Original CRISPR GTGATTAAGAGCAGGACTCT GGG (reversed) Intronic
900317896 1:2068544-2068566 GTGATTAAGGCCAGGTCTCAAGG - Intronic
901359730 1:8686775-8686797 GTGATGAAGACAAGTACTCTAGG + Intronic
902337026 1:15759491-15759513 GTCATTAAGAGCAGGAATCTGGG - Intronic
906321124 1:44817198-44817220 GTGATTAAGAGCGTGTCTCCTGG + Intergenic
906975598 1:50568881-50568903 GGGAATAAGGGCAGGACTCCTGG + Intronic
907220852 1:52905981-52906003 GTGATTAGGAGCAGCCTTCTTGG - Intronic
909345056 1:74575107-74575129 GTGAGTAAGATCAGGACTTCAGG - Intronic
911543971 1:99193472-99193494 GTGATTAAGAGCAGAGATGTTGG - Intergenic
912544831 1:110443170-110443192 GAGATGAAGAGCAGACCTCTGGG + Intergenic
913540376 1:119814382-119814404 GTGATTAAGTGCAAGAATCTGGG + Intergenic
914880773 1:151545008-151545030 GTGGTCAAGAGCATGGCTCTGGG + Intronic
918434749 1:184499995-184500017 GAGAGTCAGAGAAGGACTCTTGG + Intronic
918936328 1:190926946-190926968 ATGATTAAAATAAGGACTCTAGG - Intergenic
920890624 1:209981823-209981845 GAGACTAAGAGCAGGCCTCTCGG - Intronic
922563158 1:226583661-226583683 GTGACAGAGAGGAGGACTCTAGG - Intronic
923883570 1:238130404-238130426 GTGCCTGGGAGCAGGACTCTGGG + Intergenic
924322024 1:242860035-242860057 GTGATTAAGATAAGGACCTTGGG + Intergenic
924541074 1:244981233-244981255 GTGACTAGGATCAGAACTCTGGG + Intronic
1067697940 10:48548896-48548918 CTGAGGAAGAGCAGGGCTCTGGG + Intronic
1067908258 10:50317057-50317079 GTGTTTAAGAGCAGCATTTTTGG - Intronic
1068553450 10:58431901-58431923 GGGCTTAAGAGCAGCTCTCTAGG + Intergenic
1068704540 10:60059380-60059402 GAGCTTGAGCGCAGGACTCTAGG + Exonic
1071390778 10:85173203-85173225 GTGATTAAGAGCAGCCCTGTTGG + Intergenic
1071691979 10:87830053-87830075 GGGAGTAACAGCAGGACACTGGG + Intronic
1075396377 10:122130625-122130647 GAGATTAAGAGCATGACTCCTGG + Intronic
1080869567 11:36225575-36225597 GTGATGTAGAGCAGAACGCTGGG + Intronic
1083165429 11:60882531-60882553 CAGACTAAGAGCAGGTCTCTCGG + Intergenic
1085657497 11:78330345-78330367 GTGACAAACAGCAGGTCTCTGGG + Intronic
1088120712 11:106365577-106365599 GAGATTAAGAACAGGAAACTTGG + Intergenic
1088804371 11:113338708-113338730 GTGATTATGAGAAAGACACTGGG - Intronic
1093709595 12:22314799-22314821 GTGATTAGGAGCATGAATCTGGG - Intronic
1094003812 12:25725843-25725865 ATGATTAAGAGCACAAGTCTAGG - Intergenic
1096101641 12:48973543-48973565 GAGAGAAGGAGCAGGACTCTGGG - Intergenic
1100813819 12:98366373-98366395 GTGATTAAGAGCATGGATTTTGG + Intergenic
1101806630 12:108069775-108069797 AGCATGAAGAGCAGGACTCTAGG - Intergenic
1101832203 12:108267527-108267549 GTGGTTAAGAGCTGGAGTCTGGG - Intergenic
1102488564 12:113274829-113274851 GTGGTTAGGAACAGGGCTCTGGG - Intronic
1106168131 13:27266913-27266935 GTGAACAAGAGGAGGACCCTTGG + Intergenic
1106528963 13:30569669-30569691 GTGATTAAGAGCAGGGGCTTTGG - Intronic
1106630847 13:31471261-31471283 GTGATTAATAGCAAGAGCCTGGG + Intergenic
1106678678 13:31987733-31987755 GTGATTAACAGCAGCAATGTGGG + Intergenic
1107825021 13:44321015-44321037 CTAATTAAGAGCAGAACTGTAGG - Intergenic
1109499884 13:63220170-63220192 ATGATTAAGATCATGATTCTTGG - Intergenic
1112184957 13:97118787-97118809 GTGATTTACAAAAGGACTCTTGG - Intergenic
1113609579 13:111634088-111634110 GTGATTATGTGCCGGACGCTGGG - Intronic
1113920068 13:113902394-113902416 GTGTTTAGGAGCAAGACACTAGG - Intergenic
1114618105 14:24079085-24079107 GTGATTAAGAGTAGTGCTTTAGG - Intergenic
1118477558 14:66132533-66132555 TTGAATAAGAGCAGGAACCTAGG - Intergenic
1118768292 14:68924828-68924850 GTGCAGAAGAACAGGACTCTGGG + Intronic
1120393300 14:83935844-83935866 TTGCTTAAGACCAGGAGTCTGGG + Intergenic
1124349682 15:28945899-28945921 GTGATGAGGAGGAGGACTCTGGG + Intronic
1124923675 15:34049817-34049839 GAGACTAACAGCAGGCCTCTTGG + Intronic
1128010501 15:64291012-64291034 GTGATTAAAAATAGGAGTCTTGG - Intronic
1128451669 15:67809409-67809431 GTGGCTAAGAGCAGGGCTCTGGG - Intergenic
1128863130 15:71091720-71091742 GTGATTATGAGCAGGAGTTTTGG - Intergenic
1131357177 15:91755982-91756004 GTGATGAGTAGCAGGAGTCTGGG - Intergenic
1131430356 15:92383106-92383128 GGCATTAAGAGAAAGACTCTCGG + Intergenic
1133805480 16:9123453-9123475 GTGGTGAAGAGAAGGACTTTGGG + Intergenic
1134308659 16:13056571-13056593 GTAATAAATAGCATGACTCTGGG + Intronic
1137515718 16:49141994-49142016 GTCATTAAAAGAAGGAGTCTTGG - Intergenic
1138137063 16:54532309-54532331 GTGGTTAAGATCTGAACTCTTGG + Intergenic
1138982515 16:62287287-62287309 GTGATTAAGATAAGGAGTTTGGG + Intergenic
1140888333 16:79263807-79263829 CAGCTTAAGAGCAGAACTCTTGG - Intergenic
1141672397 16:85499129-85499151 CTGAGTATGAGTAGGACTCTAGG + Intergenic
1144117225 17:12109194-12109216 GCGGTTAAGAGCAGGGTTCTGGG - Intronic
1146948941 17:36892519-36892541 GGGTTGAAAAGCAGGACTCTGGG + Intergenic
1147317948 17:39629769-39629791 CTGGTTCAGGGCAGGACTCTAGG - Intronic
1147968773 17:44208431-44208453 GTGGTTTAGAGAAGGACTCTGGG - Intronic
1153691600 18:7600073-7600095 GAGGTTAGGAGCAGGACTCTGGG + Intronic
1156451701 18:37270144-37270166 GTAATCAGGAGCAGGCCTCTTGG + Intronic
1159261563 18:66019965-66019987 TTGACCAAGAGCAGGAATCTAGG - Intergenic
1161017046 19:1988223-1988245 GGGATTAAGAGCCTGGCTCTTGG - Intronic
1161777257 19:6270338-6270360 GTGATTTAGACCCGGGCTCTGGG - Intronic
1163602648 19:18258137-18258159 GTGACTAACGGCAGGATTCTGGG + Intronic
1164710824 19:30356025-30356047 GTGCTTAAGAGTGGCACTCTGGG - Intronic
1166555672 19:43698231-43698253 GGGCATAAGAACAGGACTCTAGG + Intergenic
1167132761 19:47598205-47598227 GTGATTAAGAGTATGAATTTTGG + Intergenic
1167390579 19:49192047-49192069 GTGATTAAAAGCAGGGGCCTTGG - Intronic
1168495298 19:56842778-56842800 GAGATTAAGAGCAAGTTTCTTGG - Intergenic
926385106 2:12328223-12328245 GTGATGAAGAGCAGGAGCTTTGG - Intergenic
929802700 2:45117783-45117805 GAGATTTAAAGCAGGACCCTGGG - Intergenic
932118840 2:69079314-69079336 ATGATTAATAGCAGGACTGGGGG + Intronic
932487715 2:72094553-72094575 TTGATTAAGACCAGGAAGCTTGG - Intergenic
932915896 2:75857415-75857437 GTGATTATAACCAGGACTATTGG + Intergenic
935232147 2:101108379-101108401 CTGAATAAGACCTGGACTCTGGG + Intronic
935354288 2:102184174-102184196 GTGATTAAGCCCAGGACTGCAGG + Intergenic
936941862 2:117891703-117891725 GCGATTAAGAGCGGGAGCCTTGG - Intergenic
938338851 2:130522524-130522546 GTGATTAAGCACAGGCCTCCTGG - Intronic
938350987 2:130598226-130598248 GTGATTAAGCACAGGCCTCCTGG + Intronic
939889741 2:147722454-147722476 GTGGTTAAGAGCAGGAACTTTGG - Intergenic
941003406 2:160223604-160223626 GTGATTAAAAGCAGGGCTCCAGG - Intronic
941216191 2:162712407-162712429 GGGTTTCAGAGTAGGACTCTTGG - Intronic
945013264 2:205487212-205487234 GTGATTAGGAGCTCGACCCTCGG - Intronic
947025605 2:225734589-225734611 GTGAGCCAGAGAAGGACTCTTGG + Intergenic
947379469 2:229531236-229531258 TTGATTGAGAGCAGCACTCCTGG - Intronic
948419504 2:237847816-237847838 GAGATTAACAGCAGATCTCTTGG - Intergenic
1170053940 20:12178185-12178207 GTATATGAGAGCAGGACTCTGGG - Intergenic
1171342720 20:24443317-24443339 GGGAAGATGAGCAGGACTCTTGG + Intergenic
1173566261 20:44040533-44040555 GTGATTATGGGCAAGTCTCTTGG + Intronic
1173786296 20:45795213-45795235 GTGATTATGAGCAGGGCTTTGGG - Intronic
1174861551 20:54096211-54096233 GGGATTTAGAGTGGGACTCTGGG + Intergenic
1174935123 20:54859151-54859173 GCGATTAAGAGCAGAAGTTTTGG - Intergenic
1176413849 21:6463642-6463664 GTGATCAAAAGCAGGACTTACGG + Intergenic
1178018238 21:28377183-28377205 GTGGTTAACAGCAGCACTTTGGG + Intergenic
1179689347 21:43071964-43071986 GTGATCAAAAGCAGGACTTACGG + Exonic
1180889945 22:19279968-19279990 GTGATTAAGGTCAGAGCTCTGGG - Intronic
1183006115 22:34903907-34903929 GTGGTGAAGAGCAGGGCTCGAGG - Intergenic
1183738596 22:39657541-39657563 GGGGTTAAGGGCAGGAGTCTTGG + Intronic
1185263307 22:49883438-49883460 GTGTTTAGTAGCAGGACTCTTGG + Exonic
952083922 3:29794823-29794845 GTGATAAAGAGCAGGACACAGGG + Intronic
955114579 3:55984680-55984702 GAGAATAAGAGCAGTTCTCTGGG + Intronic
956111945 3:65878765-65878787 GTGATCAGGAGCAGGGCCCTGGG - Intronic
956668221 3:71661879-71661901 GTGGTTAAGAGGAGGAGCCTGGG + Intergenic
961658925 3:128458114-128458136 GTGATCCAGAGCAGGGCTCTGGG + Intergenic
963469316 3:145718491-145718513 GTGAATAAGAGTAGGGGTCTGGG + Intergenic
964708709 3:159648304-159648326 ATGATTGAGAGCATGACCCTGGG + Intronic
965932621 3:174064411-174064433 GTGATCAAGAGCAGGAATTCTGG + Intronic
966430723 3:179829395-179829417 GTGATTAAGAGCAGGAATCTTGG + Intronic
967045063 3:185728778-185728800 GTGGTTAAGAGCATGACTCGGGG - Intronic
967261018 3:187642384-187642406 GTGATTAAGGGTTGGACTCTGGG + Intergenic
970193238 4:13534190-13534212 GTGATAAGGGTCAGGACTCTGGG + Intergenic
970473449 4:16399592-16399614 GTGATTAAGATAATGACTCCTGG + Intergenic
972848337 4:43017410-43017432 CTGATTAACAGAAAGACTCTGGG + Intronic
972903334 4:43712605-43712627 TTGATTAAGAGCAGGTGACTTGG + Intergenic
973087070 4:46078197-46078219 GTGATTAATTGCAGTACTTTAGG - Intronic
973340666 4:49000147-49000169 GTGATTCAGAGTGGTACTCTAGG + Intronic
974252020 4:59397412-59397434 GAGATCAAGAGCAGAATTCTCGG - Intergenic
974481434 4:62448627-62448649 CTAATTAAGGGCAGGATTCTGGG + Intergenic
975148037 4:70991907-70991929 GTGATTAATAGCAAGATCCTAGG - Intronic
977760699 4:100733246-100733268 GGGGTTCAGAGCAGGAGTCTAGG - Intronic
978922708 4:114203549-114203571 TTGATTAAGAATATGACTCTGGG - Intergenic
980173159 4:129313463-129313485 CTGATGAAGAACAGGATTCTGGG - Intergenic
981365122 4:143893669-143893691 GAGACTAAGAGCAGATCTCTCGG - Intronic
982531346 4:156548082-156548104 GTGATTCAGAGCAGGAGGATAGG + Intergenic
982536454 4:156612810-156612832 GTGGTTAAGAGGAGGATTCCTGG + Intergenic
983946879 4:173596222-173596244 GAGGTTAAGAGCTGGACTTTAGG - Intergenic
984238032 4:177185207-177185229 GAGTTGCAGAGCAGGACTCTGGG - Intergenic
986043142 5:4012306-4012328 GTGAGGAGGAGCAGGACTCCAGG + Intergenic
992680516 5:79148320-79148342 GTGATTAAGAGCAGCAGACCAGG - Intronic
997324226 5:133006410-133006432 ATGATTAAGACCATGAATCTGGG + Intronic
998016828 5:138738953-138738975 GTGGTTAAGAGCATGGTTCTGGG + Intronic
998464406 5:142331820-142331842 GTGATTAAGCGCACAAGTCTTGG + Intergenic
998656563 5:144187708-144187730 TTGATTAACAGCAAGACTCTGGG - Intronic
999128715 5:149266320-149266342 GTGGTGAAGAGCATGACTTTAGG - Intergenic
999137541 5:149332557-149332579 TTGGTTAAGAGATGGACTCTGGG - Intronic
999140730 5:149359734-149359756 GTCATCCAGAGCAGGACACTTGG + Intronic
999943879 5:156574215-156574237 GTGATTAAGAGCATGGCTTTAGG - Intronic
1005416387 6:25604600-25604622 GTGTTTACGGTCAGGACTCTGGG - Intronic
1009736252 6:67679831-67679853 ATGATTAAGAGCAGGAACCAAGG + Intergenic
1010788622 6:80036003-80036025 GTGATCAAGATCAGGGCTATAGG + Intronic
1013506919 6:110809926-110809948 GTGATTAAGAGAAGGCTTCAAGG + Intronic
1014316909 6:119879004-119879026 GTGTTTAAGAGAAGGAATCATGG - Intergenic
1017657503 6:156644002-156644024 GTTTATAAGAGCAGGATTCTTGG - Intergenic
1018437903 6:163779596-163779618 GTGGTTAGGAGCAGCACTGTGGG - Intergenic
1022794282 7:33719619-33719641 GTGACAGAGAGCAGGAGTCTGGG + Intergenic
1023792578 7:43764897-43764919 GTGATCAAGAGCAGGACACGGGG - Intronic
1026105734 7:67419346-67419368 GTCATTAGGAGAAGGACCCTGGG + Intergenic
1027179060 7:75925051-75925073 GTAATTGAGAAAAGGACTCTGGG + Intronic
1029982463 7:104891618-104891640 GTGATTCAGAGAATGGCTCTTGG - Intronic
1030008060 7:105137873-105137895 GTGGTCAAGTGCAAGACTCTAGG + Intronic
1031729814 7:125285556-125285578 GTGGTAAAGAGCAGGACTATTGG - Intergenic
1032949764 7:136894023-136894045 GTGAATAATACTAGGACTCTAGG - Intronic
1035546342 8:484663-484685 GCGTTTAAGAGCGGGACTCTTGG + Intergenic
1036130633 8:6106322-6106344 TCTGTTAAGAGCAGGACTCTTGG - Intergenic
1037489848 8:19387660-19387682 GTGGTTAAGAGCATGTCCCTGGG + Intronic
1037988694 8:23305548-23305570 GAAATAGAGAGCAGGACTCTGGG + Intronic
1038041740 8:23728898-23728920 GTAATGAAGAGCAGTCCTCTTGG + Intergenic
1038295798 8:26290539-26290561 GTGCTTAAGAGCTGGGCTCAGGG - Intergenic
1039592401 8:38760377-38760399 GTGATTAAGAGCAGAAATTGTGG + Intronic
1039613048 8:38934217-38934239 CTGCTTGAGACCAGGACTCTGGG - Intronic
1039694940 8:39900784-39900806 GGGACTAGGAGAAGGACTCTTGG - Intergenic
1041871197 8:62636178-62636200 GTTATTAAGAGCTGGAAACTTGG - Intronic
1047518114 8:125572778-125572800 GTGGTTAAGAGCATGGCTGTTGG + Intergenic
1048156558 8:131960813-131960835 GTGATTAAGAGTTGTACTCTGGG + Intronic
1048802959 8:138211024-138211046 GTGATTAGGAGCATGGCTCTGGG - Intronic
1050455941 9:5834075-5834097 GTGGGCAAGAGCAGGACTATAGG - Intergenic
1054729081 9:68682488-68682510 GGAGTTGAGAGCAGGACTCTGGG + Intergenic
1054734212 9:68734004-68734026 GTGATTAAGAGCTTGAATTTGGG + Intronic
1055030319 9:71767639-71767661 GCTATTAACAGCAGCACTCTGGG + Intronic
1055952255 9:81740599-81740621 GTGCCAAAGAGAAGGACTCTGGG + Intergenic
1057835416 9:98440689-98440711 GTGATGGAGAGAAGGACACTTGG - Intronic
1057881219 9:98794321-98794343 GTGGTTTTGAGCAGGATTCTGGG + Intronic
1059845427 9:118270199-118270221 GTGAAAAAGAGCAGGACTAGGGG - Intergenic
1060000684 9:119955839-119955861 GTGATTAAGATCATGGATCTGGG - Intergenic
1060622957 9:125084129-125084151 GTTAATATGAACAGGACTCTTGG + Intronic
1060684712 9:125598576-125598598 GTGATTAAGAGCACAAGTCGGGG + Intronic
1060849024 9:126860154-126860176 GTGGTTAGCAGCAGGGCTCTGGG - Intergenic
1061043091 9:128150892-128150914 GTGGCTTAGAGCAGGGCTCTTGG + Intronic
1061914141 9:133740329-133740351 GTGATCTAGAGCAGGACTGAAGG - Intergenic
1185822816 X:3220880-3220902 GTGATTAAGCGAAGGACCTTGGG - Intergenic
1188552161 X:31376303-31376325 GGGATTGAGATCAGGAGTCTGGG + Intronic
1193150299 X:78117973-78117995 GTGATAAGGAGCTGGCCTCTAGG + Intronic
1193753075 X:85371556-85371578 GTGATTAAGAGCATGAGTTCTGG - Intronic
1195420266 X:104667622-104667644 GTGATTAAGAGCAGGACTCTGGG - Intronic
1196417979 X:115493320-115493342 GTGAGTAAGGGCAGGAGTTTGGG - Intergenic
1196420822 X:115519359-115519381 GTGATTTAGAAAAAGACTCTTGG - Intergenic
1199682417 X:150235939-150235961 GTGACTATGAGGAGCACTCTGGG + Intergenic