ID: 1195426325

View in Genome Browser
Species Human (GRCh38)
Location X:104736016-104736038
Sequence GTGTGCTTCTAGAATAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195426325_1195426330 20 Left 1195426325 X:104736016-104736038 CCTTCATTATTCTAGAAGCACAC 0: 1
1: 0
2: 0
3: 10
4: 174
Right 1195426330 X:104736059-104736081 CACATGTTGTTTTCCTTAAGTGG 0: 1
1: 0
2: 1
3: 21
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195426325 Original CRISPR GTGTGCTTCTAGAATAATGA AGG (reversed) Intronic
901271737 1:7957263-7957285 GTGTGCTTCTAGAACCAAGGAGG - Intronic
901352724 1:8612068-8612090 CTGTGTTTCTACACTAATGATGG - Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
909000489 1:70211813-70211835 ATGTACCTCTAGAATGATGATGG - Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
910115419 1:83726414-83726436 GTGTGCTTGGCTAATAATGATGG - Intergenic
915772600 1:158444127-158444149 ATTTGCTTCTGGAAAAATGAGGG - Intergenic
917482143 1:175421581-175421603 TTGTGGGTCTAGACTAATGAAGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918568896 1:185963610-185963632 TTCTGCTTATAAAATAATGATGG + Intronic
918724872 1:187907817-187907839 GTGAGTTTCAAGAACAATGAAGG - Intergenic
920514073 1:206571535-206571557 GTGTGCTCATAGTCTAATGAGGG + Intronic
922535432 1:226377061-226377083 GTCTGCTTCTAGGAAAAGGAAGG - Intronic
922628124 1:227073755-227073777 GCTTGCTTTTAGAAAAATGATGG - Intronic
1064647737 10:17477134-17477156 ATGAGCTACTAGAACAATGAAGG - Intergenic
1068064278 10:52109301-52109323 GTGTTCTTTTAGAAAAATGCGGG - Intronic
1072686033 10:97537498-97537520 GTTTCCTTCTGCAATAATGAGGG - Intronic
1073983027 10:109176429-109176451 GAGTTATTCTAGAAGAATGAGGG - Intergenic
1074030153 10:109679110-109679132 CTGAGTTTCTAGAATAAAGATGG + Intergenic
1075354490 10:121758614-121758636 GTGTGCTTCTCAGATATTGAGGG + Intronic
1076020514 10:127068857-127068879 GTGTGCTTGAAAAATACTGAAGG - Intronic
1076067179 10:127458251-127458273 CTGTGCTGCTAGAACAATCAAGG + Intergenic
1076594908 10:131619378-131619400 GTGTGCTCCTGGAAGAATAAAGG + Intergenic
1078225348 11:9386596-9386618 GTTTGCTTCTACAAAAATGGGGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080063982 11:27988186-27988208 GTGAGCTTCTAGAATCTAGAAGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083851300 11:65368968-65368990 GTGTCATTATAGAATGATGAAGG + Intergenic
1084277108 11:68058657-68058679 GTGTGCTTTTAAAATAATAAAGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090674479 11:128977179-128977201 TTGAGCTTCTAGAACCATGAGGG + Intronic
1093656874 12:21704752-21704774 GTGTTCTTCTAGAATTGTTATGG + Intronic
1094398379 12:30033676-30033698 GTGTGGTTCTTGGATAGTGAGGG + Intergenic
1094868490 12:34570006-34570028 CTGTTCTTGTAGAATTATGAAGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1100252370 12:92840732-92840754 GTGTGGTACTAGCATAAAGATGG + Intronic
1101180716 12:102214165-102214187 CTGTGCTTCTAGAATAACTGTGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101584741 12:106075625-106075647 CTCTGCTTCTAGTATAACGAAGG - Intronic
1103628060 12:122235614-122235636 GTGTCCTTCTAGGATTCTGATGG + Intronic
1105336448 13:19474604-19474626 GGGTGCTTCTAGCATAGTGATGG + Intronic
1107489863 13:40870918-40870940 GGGTGCTTCTAGCACAGTGATGG + Intergenic
1107736893 13:43408198-43408220 GTGTGCTACCACAGTAATGAGGG + Intronic
1107841979 13:44467286-44467308 GTTTTCTTCTAGAATATTTATGG - Intronic
1109199225 13:59412072-59412094 GTGTGCTGGGAGAATAAAGAAGG + Intergenic
1109671025 13:65607879-65607901 GTGTGATTTTAGCATAAAGAAGG - Intergenic
1110210195 13:72962909-72962931 GTGTGCAACTAGAATAAGGATGG + Intronic
1111127359 13:83929014-83929036 CTGTCTTTCTAAAATAATGATGG + Intergenic
1114856583 14:26453413-26453435 TTGTGAGTCTAGAATAAGGAAGG - Intronic
1116650469 14:47585316-47585338 CTCAGCTTCCAGAATAATGATGG + Intronic
1116650616 14:47587028-47587050 ATGTGCTCCTACAATAATGAAGG + Intronic
1118854504 14:69610950-69610972 GTGTGCTTTTAGTATGCTGAAGG + Intergenic
1119081078 14:71694284-71694306 GACTGCTTCTGGAAGAATGAAGG + Intronic
1119946257 14:78697934-78697956 TTCTGCTTCTAGCCTAATGAAGG - Intronic
1120600232 14:86495208-86495230 TTGTGGTTCTATAAAAATGAAGG + Intergenic
1123634734 15:22292863-22292885 CTGTGTTTCTACACTAATGATGG + Intergenic
1125797452 15:42413394-42413416 GGGAGCTTCTAGAATTACGAAGG - Exonic
1127038839 15:54950770-54950792 CAGTGCTTCTGGCATAATGAGGG - Intergenic
1130730996 15:86492070-86492092 AAGTGCTCCTAGAATAGTGAGGG + Intronic
1131692254 15:94840300-94840322 GTGTGTTTTTAGAATAAACAGGG - Intergenic
1132031080 15:98438890-98438912 TGGTGCTTCTAGAATATTGGTGG - Exonic
1132408638 15:101560582-101560604 TTGTGCTTGTAGAAGAAAGAGGG - Intergenic
1132507066 16:316134-316156 GTGTAATTCTGGAATAAGGAAGG - Intronic
1133986256 16:10670612-10670634 GTGTTATTCTAAAATAATAAAGG - Intronic
1135266806 16:21033778-21033800 GGGTGCTTCTATAATAACAAGGG - Intronic
1136503884 16:30690012-30690034 GTGTGAATATAAAATAATGATGG - Intergenic
1137265045 16:46861892-46861914 GTGTCTTTCCAGAATTATGAAGG - Intergenic
1138437089 16:57008462-57008484 GTGTTCTTTTAGAATAAAAATGG - Intronic
1138757661 16:59508214-59508236 GTGTGTATCTATAATTATGATGG - Intergenic
1140379591 16:74474341-74474363 GTGTTGTTCTAGAGAAATGAGGG + Intronic
1140753498 16:78046920-78046942 AAGTGCTTCTAAAATGATGAAGG - Intronic
1143288061 17:5806011-5806033 GACTGCTTCTAGGACAATGAGGG - Intronic
1143630688 17:8138406-8138428 GCATTCTTCTACAATAATGAAGG + Intergenic
1143990028 17:10950463-10950485 GTGTTCTTTTAAAATCATGAAGG + Intergenic
1146195199 17:30806087-30806109 GTTTTCTTTTAGCATAATGAGGG - Intronic
1152901405 17:82943140-82943162 GTGTGCCTCTACAGTAATGTCGG + Intronic
1153058076 18:967647-967669 GTGTCCTTCAAGAATGATGGAGG - Intergenic
1153856789 18:9157101-9157123 CCGTGCTTCTAGAATTAGGATGG + Intronic
1157482207 18:48062591-48062613 GTCTCCTTCTAGGAAAATGAGGG - Intronic
925003624 2:425654-425676 GTGTTCTTCTACAACAATCAGGG - Intergenic
925936527 2:8767226-8767248 GTGTGTTTTGAGAATAAAGATGG + Intronic
926125986 2:10272205-10272227 GTCTGCTTCTGGAACAAGGAGGG + Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
929049985 2:37828257-37828279 GAGAGATTCCAGAATAATGATGG + Intergenic
930325763 2:49915161-49915183 ATGTGATACTAGAAGAATGAAGG + Intergenic
930591923 2:53337819-53337841 GTGTGATACTAGAATAATTATGG - Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
933214446 2:79612470-79612492 GATTGCCTCTATAATAATGAGGG - Intronic
935936794 2:108194406-108194428 GTGTGCTTCTAATAAAATAATGG - Intergenic
937760313 2:125592916-125592938 GTGTTCTTTTAGACCAATGATGG - Intergenic
939510573 2:143099544-143099566 GGGTACTTCTAAAAGAATGAGGG + Intronic
939856793 2:147367970-147367992 CTGGCCTTCTAGATTAATGACGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944482256 2:200169845-200169867 GTTTGATTCTAACATAATGAAGG + Intergenic
944934026 2:204548675-204548697 TTTTGCTTCTGGAATAGTGATGG + Intronic
946881038 2:224177325-224177347 GTGTGCTTCTAGGAGGATGGGGG - Intergenic
1172040053 20:32037782-32037804 GTGTGGCTATAGAATAAAGAGGG + Intergenic
1172256645 20:33524426-33524448 GTATGGTTTTGGAATAATGAAGG + Intronic
1172635182 20:36405573-36405595 GTGTGCTATTTTAATAATGATGG + Intronic
1174736400 20:52969788-52969810 GTTTTCTTCTAGAATATTTATGG - Intergenic
1176737111 21:10560503-10560525 GGGTGCTTCTAGCAGAGTGATGG - Intronic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1180563109 22:16638025-16638047 GGGTGCTTCTAGCAGAGTGATGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951661664 3:25073149-25073171 GTGTGCGTCTACAATAATTTGGG + Intergenic
951785419 3:26413276-26413298 GTGTGATTCTGGAATAAAGGTGG - Intergenic
951814575 3:26739607-26739629 GTGTGCTTTTAGCATGATGGAGG - Intergenic
952022168 3:29036198-29036220 TTTTGCTTCTATATTAATGAAGG + Intergenic
954542535 3:51403673-51403695 TTGGGCTCCTAGAATATTGAAGG - Intronic
954702837 3:52460304-52460326 GTGTGCTGCTGGGATAATGATGG - Intronic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
961929903 3:130522339-130522361 GTGTGACTCCAGAACAATGAGGG + Intergenic
962568391 3:136687697-136687719 TTGTCTTTCTAGAAAAATGAAGG + Intronic
965969174 3:174532571-174532593 GGGTGCTTATAGAATAGTGAGGG + Intronic
966021281 3:175214650-175214672 TTGTGCTGTTAGAACAATGAAGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
969842602 4:9893419-9893441 GTGAGGTTCAAGAATACTGAGGG + Intronic
974306659 4:60151514-60151536 GTTTTCTTCTAGAATATTTATGG + Intergenic
976279732 4:83315417-83315439 GTTTCCTCCTAGAAAAATGAGGG - Intronic
977182629 4:93896076-93896098 CTGAGCTACTAGAAGAATGAAGG + Intergenic
978214706 4:106185602-106185624 GTGTTGTTCTAGAATCATCATGG - Intronic
979203787 4:118010472-118010494 TTGTGCTTTCAGAATAATAATGG - Intergenic
979326032 4:119380814-119380836 GTTTTCTTCTAGAATTTTGATGG + Intergenic
981644502 4:146983513-146983535 GTGTGCTTCGAAAACAATAAAGG + Intergenic
981964606 4:150584241-150584263 GTTTGCTTCTTAATTAATGAAGG - Exonic
983243892 4:165265480-165265502 GTTTTCTTCTAGAATTTTGATGG + Intronic
983302711 4:165947714-165947736 GGGTGCTTCTAGAAATCTGAAGG + Intronic
984159613 4:176235376-176235398 GTGTGTTTCTAGAAAAAAGTTGG - Intronic
984553528 4:181187452-181187474 TTGTACTTCTAGAAAACTGAAGG + Intergenic
986092131 5:4520043-4520065 GTGTGCTTCTCCAACAATGCTGG + Intergenic
988945646 5:36195141-36195163 CTGTGCTTCTTGAACAGTGAAGG - Exonic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
995308372 5:110681390-110681412 GAGTGCTTATTGAATAATTAGGG - Intronic
996248212 5:121292540-121292562 GTTTCCTTCTAGTATAAGGAGGG + Intergenic
996543354 5:124652346-124652368 GAGTGCTTCTGGAAAAATAAGGG - Intronic
1004314310 6:14572626-14572648 AGGTGTTTCTAGAACAATGAGGG + Intergenic
1008874516 6:56311297-56311319 ATGTGTTCCTAGTATAATGAGGG + Intronic
1011103148 6:83746794-83746816 GTGTGCTGCTGGTATAAAGATGG + Intergenic
1013345417 6:109255525-109255547 GTGATCTTCTAGATTAATTAAGG + Intergenic
1015243857 6:131055431-131055453 GTGTGATTCTTGAATCATGCTGG - Intronic
1021925662 7:25531384-25531406 GTGGGCTGCTAGAGGAATGAAGG - Intergenic
1025564660 7:62418725-62418747 GTAAGCTTCTAGCACAATGAAGG + Intergenic
1028494430 7:91448129-91448151 GTGTGGTAGTAGGATAATGAAGG + Intergenic
1028610856 7:92710084-92710106 GTGTATCTCTAGACTAATGAAGG + Intronic
1028662858 7:93301387-93301409 GTATACTTCCAGAATAATGCAGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1033570633 7:142625104-142625126 GTGTGCTCCTTGACTTATGATGG - Intergenic
1039140725 8:34384876-34384898 GTGTGCTTCTGGCATGAGGAAGG + Intergenic
1040044051 8:42943466-42943488 GTTTGCATTTAAAATAATGAAGG + Intronic
1042034920 8:64522423-64522445 AAGAGCATCTAGAATAATGAAGG + Intergenic
1044069483 8:87739794-87739816 AAGTGTGTCTAGAATAATGAGGG + Intergenic
1045919524 8:107512750-107512772 GTTTGCTTGTATAATAATGAGGG - Intergenic
1047127422 8:121977473-121977495 GTGTGCTCCTTGGCTAATGAGGG - Intergenic
1047705964 8:127499876-127499898 GTGTGCTTTTACAATTATGAGGG - Intergenic
1048548340 8:135407529-135407551 GTGTGCTTCAAGAATCACAAGGG + Intergenic
1049774681 8:144398861-144398883 ATGCTCTTCTAGAATGATGATGG + Exonic
1050210900 9:3254932-3254954 ATGTGCTTCTTGAATTATGTGGG + Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050854643 9:10337238-10337260 GTGTACATATATAATAATGAGGG - Intronic
1051119509 9:13736716-13736738 GTGTCCTTCTAGAGCACTGAAGG + Intergenic
1052882944 9:33616222-33616244 GTGTGCTCCTTGACTTATGATGG - Intergenic
1055502335 9:76913846-76913868 GTGAGGTTCAAGAATGATGAGGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056560876 9:87728015-87728037 GTTTGCCTCTAGAATGAAGAAGG + Exonic
1057044978 9:91878657-91878679 GTGTGCTTCTCAGAGAATGATGG - Intronic
1057664870 9:97037605-97037627 GTTTGCCTCTAGAATGAAGAAGG - Exonic
1186616522 X:11194290-11194312 ATCTGCTGCTGGAATAATGAGGG - Intronic
1190107463 X:47570444-47570466 TTGTGCTTCTGGAATAGTCATGG + Intronic
1191643885 X:63457795-63457817 ATGTCCATCTAGAATGATGAAGG + Intergenic
1192154723 X:68735946-68735968 GTTTTCTTCTAGAATATTTATGG - Intergenic
1192175629 X:68883317-68883339 GTGTCATACAAGAATAATGAGGG - Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1194376457 X:93139662-93139684 GTTTACTTATAAAATAATGATGG + Intergenic
1195426325 X:104736016-104736038 GTGTGCTTCTAGAATAATGAAGG - Intronic
1197357340 X:125451876-125451898 GCCAGCTTCAAGAATAATGATGG + Intergenic
1198883275 X:141305249-141305271 GTATGCTTCGAGAATAAATAAGG - Intergenic
1199411633 X:147530375-147530397 TTGTGATTCTACAATCATGAAGG + Intergenic
1201531243 Y:14991526-14991548 GTGTGGTATTAGGATAATGAAGG - Intergenic
1202595366 Y:26533767-26533789 GGGTGCTTCTAGCAGAGTGATGG - Intergenic