ID: 1195427301

View in Genome Browser
Species Human (GRCh38)
Location X:104748748-104748770
Sequence CTGCTCTCTGAATTCTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195427301 Original CRISPR CTGCTCTCTGAATTCTAAGC TGG (reversed) Intronic
901254430 1:7809567-7809589 TTGTTCTCTGTATTCTAAACTGG + Intronic
904326498 1:29729922-29729944 CTGCTCTCACAATTCTGAGGAGG + Intergenic
905270730 1:36785823-36785845 CTGCTCCCTGCCTTCTGAGCAGG - Intergenic
908847528 1:68339909-68339931 CTGGTCTCTGAATTCAGAGGAGG - Intergenic
910503493 1:87922410-87922432 TTGCTCTCTGAATTTCAAGTAGG - Intergenic
911401030 1:97375330-97375352 CTGCTTTGTGAATTTTAAGTAGG + Intronic
911663843 1:100532652-100532674 CTGCTCTCTGGAGTTTTAGCGGG + Intergenic
913114146 1:115681341-115681363 CTGCTCTCTGAGGACCAAGCAGG + Intronic
913170900 1:116231433-116231455 CTGCTCACTGACTGCGAAGCTGG - Intergenic
914246729 1:145891893-145891915 CTCCTGTCTGCTTTCTAAGCAGG + Exonic
915687772 1:157652422-157652444 TAGCTGTCAGAATTCTAAGCAGG - Intergenic
916742243 1:167656265-167656287 CTCCTCACTGAATTCTAGGGAGG - Intronic
917718863 1:177766021-177766043 CTATTCTCTGACTACTAAGCAGG + Intergenic
919338969 1:196278970-196278992 CTTCTCACTGAATTCTCATCTGG - Intronic
924178423 1:241416694-241416716 TCACTCTCTGAATTCTAAGTTGG + Intergenic
1062839828 10:661610-661632 CTCTTCTCTGGACTCTAAGCAGG + Intronic
1062865043 10:845087-845109 CTGCTTCCTAAATTTTAAGCCGG - Intronic
1063885253 10:10570931-10570953 GTGCGCTCTGAATACTAAGCTGG + Intergenic
1067131699 10:43571094-43571116 CTGCTCTCCCAACTGTAAGCAGG - Intronic
1067461666 10:46462734-46462756 CTCCTCTCTGGATTCTACCCTGG - Intronic
1067625528 10:47921867-47921889 CTCCTCTCTGGATTCTACCCTGG + Intergenic
1068444849 10:57107959-57107981 CTGTGCACAGAATTCTAAGCTGG + Intergenic
1074685337 10:115957083-115957105 ATTCTGTCTGAATTCTCAGCTGG + Intergenic
1075630419 10:123997364-123997386 CTGCTCCCTGAATGCTAGGCTGG + Intergenic
1076288160 10:129321793-129321815 CTGCCCTCCGGATTCTCAGCAGG + Intergenic
1078488249 11:11743796-11743818 CTGCACACTGATTTTTAAGCAGG + Intergenic
1083492298 11:63021953-63021975 CTGCTCTCTGAACCCTTGGCAGG + Intergenic
1086355951 11:85999605-85999627 CTGCTCCCTGAAATCTTAGTAGG - Intronic
1087335246 11:96835945-96835967 TTGCTCTCTGAATTCTTAGGGGG - Intergenic
1087426872 11:97999721-97999743 CTGCTTTCTGACTTCTAAAAGGG - Intergenic
1088547419 11:110973855-110973877 CTGCTCTCTGCCTTCTGAACTGG + Intergenic
1093130367 12:15384501-15384523 CTTCTCTCTGAATTCTCACATGG + Intronic
1094017395 12:25879663-25879685 TTGTTCTCTGAGTTCTAAGGGGG - Intergenic
1095545651 12:43365071-43365093 CTGCTGTCTGACTTCTAAGTAGG - Intronic
1095902885 12:47346587-47346609 CTGCTATCTGCATTCTAAGTTGG - Intergenic
1098911366 12:76212517-76212539 CTGCTCTCTGAATGCTTGTCTGG - Intergenic
1101707889 12:107237601-107237623 CTGCTCTCTGGATCCCATGCTGG - Intergenic
1102101217 12:110280775-110280797 CTGCGCTCTGCATCCTAATCTGG - Intronic
1102854571 12:116281968-116281990 CTGCACTCTAAACTCTAACCTGG + Intergenic
1103532271 12:121610748-121610770 GTCCTCTCTCCATTCTAAGCTGG - Intergenic
1106473047 13:30075280-30075302 CAGATCTCAGAATTCAAAGCTGG + Intergenic
1109208135 13:59504621-59504643 CTGCTCTCTGCTTTATATGCAGG - Intergenic
1110124379 13:71924388-71924410 CTTCTCTCTTAATTCAAGGCTGG - Intergenic
1110266179 13:73540435-73540457 CCGCTAGCTGAATTTTAAGCTGG + Intergenic
1111320062 13:86615337-86615359 CTTCTTTCTGAATTATAAACAGG - Intergenic
1112151684 13:96771568-96771590 CTGCTTTCTCCATTCTGAGCTGG - Intronic
1112398766 13:99057770-99057792 CTGATCTCTGTGTTGTAAGCTGG - Intronic
1112814502 13:103256056-103256078 CTGCTATCTCAATTCTAGGAAGG - Intergenic
1113067146 13:106383979-106384001 CTGCTCACTGTGTTCTCAGCTGG - Intergenic
1113199839 13:107855014-107855036 CTGCTCTCTAGATGCTGAGCAGG - Intronic
1113631565 13:111891052-111891074 GAGCTCTCTGAATTCCAAGTAGG - Intergenic
1119912892 14:78367127-78367149 CTGTTCTCTGAATACTAACTAGG + Intronic
1121254409 14:92520583-92520605 CTGTTCTCTGAAAGATAAGCTGG + Intronic
1121426575 14:93856509-93856531 CAGCTCTCTGAATTGGAAACTGG + Intergenic
1127738848 15:61876635-61876657 CTGCAAGCAGAATTCTAAGCCGG - Intronic
1128873628 15:71184008-71184030 CTGCCCCCTGCATTCTAAGGTGG + Intronic
1130385702 15:83409730-83409752 CTACTTTCTGAATTCTAGGCTGG - Intergenic
1132518989 16:378832-378854 CTGCCCTCTGCGTTCCAAGCGGG + Intronic
1133410238 16:5562294-5562316 CAGCTGTCTGACTTCTAAGTAGG - Intergenic
1133783814 16:8960057-8960079 CTGCCCTCTGAATACTCAGATGG - Intronic
1135798871 16:25474172-25474194 CGGCTCTCTGGCTTCTGAGCAGG + Intergenic
1136106477 16:28033986-28034008 CTGGTCTCTGATCTCTAAGATGG - Intronic
1140656836 16:77149782-77149804 GTGCACTCTGAAGTCTAAGGGGG - Intergenic
1141945543 16:87306745-87306767 CTGCTCTCTTAATTCTGTGCTGG + Intronic
1143258508 17:5581914-5581936 CTGCTCTCTGGGTGCTAGGCTGG + Exonic
1143360411 17:6364722-6364744 CTTCTCTCACCATTCTAAGCAGG - Intergenic
1145063337 17:19745689-19745711 CAGCTCTCTGAATCCTTGGCGGG - Intronic
1147559980 17:41502806-41502828 CTGCACTCTGAAATGCAAGCAGG + Exonic
1148754088 17:49963441-49963463 CTGGTCTCTGAATCCTGATCAGG - Intergenic
1150532151 17:65995204-65995226 TTCCTCTCGGAATTCTAACCTGG + Intronic
1150756018 17:67914647-67914669 CTGCTCTTTGTATTCTAAAATGG + Intronic
1153519954 18:5942159-5942181 CTGCTCTGTGAATGCCAAGATGG - Intergenic
1153956888 18:10104029-10104051 CTGCTGGCTGCATCCTAAGCAGG - Intergenic
1154348058 18:13560318-13560340 CTTTTCTCTGACTTCTGAGCAGG + Intronic
1157401016 18:47387625-47387647 ATGCTCTCTGAATTCAAAATTGG - Intergenic
1160140243 18:76314811-76314833 ATGAACTCTGAATTCAAAGCAGG + Intergenic
1164438193 19:28250729-28250751 ATTCTCTTTAAATTCTAAGCAGG - Intergenic
1165259171 19:34598012-34598034 CTGCTTTCTGGCTTCTAAGTGGG + Intronic
1165567675 19:36745460-36745482 CTGGTCTCTGAACTCTGGGCAGG - Exonic
1165894517 19:39133620-39133642 CTGCTGTCTGCATTCCAGGCAGG + Intronic
927005577 2:18844501-18844523 CTGTTCTCAGAATAATAAGCAGG - Intergenic
927492127 2:23527508-23527530 CTGCTCACAGCTTTCTAAGCAGG - Intronic
927904333 2:26846718-26846740 CTGCTCTCTGCTTACCAAGCAGG + Intergenic
928542542 2:32296614-32296636 CTGCTCTCTGTATACTAACAGGG + Intronic
929375227 2:41278508-41278530 CTACTCTATGAATTCTAGGAGGG - Intergenic
929901309 2:46005970-46005992 CTGGTCTCTGAACTCTTACCTGG - Intronic
931185490 2:59947063-59947085 CTGAACTCAGAATTCTAAACAGG + Intergenic
931222758 2:60303069-60303091 CTGCTGTCTACATTCTTAGCAGG - Intergenic
933199741 2:79435303-79435325 CTGCACTCTGAACATTAAGCAGG - Intronic
935035344 2:99366403-99366425 ATGATCTCTGCATTCTCAGCTGG + Intronic
935050389 2:99520383-99520405 CTGCTTTCTGCATTCAAAGCAGG + Intergenic
937520705 2:122710231-122710253 CTGATCTCTGAACTCTTGGCAGG + Intergenic
939007777 2:136809231-136809253 CTGCTCACTGTCTTCTAAGGGGG - Intronic
940846627 2:158649426-158649448 CTACTCTCTGAATTTTACCCAGG + Intronic
945121500 2:206462102-206462124 CTGGTCTGGGAATTCTAAACAGG + Intronic
946903626 2:224395570-224395592 CTGCTGTCTCAATTCTTAGTGGG - Intronic
947309803 2:228788877-228788899 CTGGTCTCTGACTCCTGAGCAGG + Intergenic
948999241 2:241602905-241602927 CTGCTGCCTGCATTCGAAGCAGG - Intronic
1170350783 20:15438715-15438737 CTGCTCTTTAAATTCCAAACTGG - Intronic
1171458657 20:25286340-25286362 CTGCTCTCTGGAGTCTCTGCCGG + Intronic
1173480155 20:43392505-43392527 CTGCTCCCAGAATTCCAAACAGG + Intergenic
1173752958 20:45491131-45491153 CTGCTTTCTGAATTGGAACCAGG + Intergenic
1175702526 20:61150540-61150562 CTGCTCTCTGCTTTCCAAACGGG + Intergenic
1179608647 21:42534561-42534583 CTGCACCCTGCATTCTAAGAGGG - Intronic
1182520420 22:30881674-30881696 CTGTTCTCAGAATGCTGAGCTGG - Intronic
1183882185 22:40842704-40842726 ATGCTCACTGAATCCCAAGCAGG + Intronic
1185219411 22:49622041-49622063 CTGCTCTGAGCCTTCTAAGCTGG + Intronic
956957226 3:74355196-74355218 ATGCTCCCTGAATCCTAACCTGG + Intronic
957302285 3:78407845-78407867 CTGATCTCAGAACTCTCAGCAGG + Intergenic
959082600 3:101817738-101817760 CAGCTCTCTAAATTGTAAGCAGG - Intronic
960357833 3:116675458-116675480 CTGCACTCTGCATTCTTATCTGG + Intronic
960623859 3:119661358-119661380 TGGCTTTTTGAATTCTAAGCTGG + Intronic
961912021 3:130327448-130327470 CTGCTCTATGAATTTTCATCTGG + Intergenic
962243602 3:133772396-133772418 CTCCTATCTTAATTCTATGCAGG - Intronic
969960681 4:10941888-10941910 CTGCTCTCTGACTTATTAGTGGG + Intergenic
972876140 4:43362980-43363002 CTGCATACTGAATTCTAACCTGG + Intergenic
972924517 4:43986721-43986743 TTGCTCTCTGTATTCCAGGCTGG + Intergenic
974815210 4:66995386-66995408 CTTCTCTCTGTATTCTCATCTGG + Intergenic
976591013 4:86849983-86850005 CCCCTCTGTGCATTCTAAGCAGG + Intergenic
976929660 4:90550084-90550106 CTGCTTTCCAAATTCTAAGATGG - Intronic
977989486 4:103423481-103423503 CAGCTTTCTGAATTCTAAAGTGG + Intergenic
979797270 4:124861850-124861872 CAGGTCACTGAATTCTCAGCTGG + Intergenic
980284454 4:130764118-130764140 ATGATTTCTGAATTCTCAGCTGG - Intergenic
981225286 4:142287223-142287245 CTACTTTCTGAATTATAACCAGG + Intronic
983357203 4:166678599-166678621 CTGCTCTTTGAATTGTAATTAGG - Intergenic
990828322 5:59927624-59927646 CTGCTTTCTGAATTCAGTGCAGG + Intronic
994617022 5:102116983-102117005 CTGCTTTCTGAAGGCTTAGCGGG - Intergenic
994695240 5:103065946-103065968 CTAGCCTCTGAATTCTCAGCAGG - Intergenic
997539733 5:134651784-134651806 CTACTCTCTGTATTATTAGCAGG - Intronic
998580517 5:143370021-143370043 CTCTTCTATGAATTCTTAGCTGG - Intronic
998858521 5:146419829-146419851 CTGCTCTCAGAAGTCTACTCTGG - Intergenic
999277627 5:150342087-150342109 CATCTCTCTGAATTCTAATAAGG - Intergenic
1000530000 5:162407842-162407864 CTGCTCTCTGAGTTCACAGCCGG + Intergenic
1000989480 5:167897306-167897328 CAAGTCTCTGAATTCTGAGCAGG - Intronic
1001409730 5:171502243-171502265 CTGCTCTGTAAATTCAAAGCAGG + Intergenic
1002440898 5:179263967-179263989 CTCCTCTCAGAATTCTCTGCAGG - Intronic
1002811293 6:632312-632334 ATGCTCTTTGAATTCTAACCTGG - Intronic
1003224756 6:4193199-4193221 CTGCTCACTGAAGTCTCAGCAGG + Intergenic
1003455280 6:6276203-6276225 CTGCTCTCTGACTTCGAGGTAGG + Intronic
1005590406 6:27319275-27319297 CTGCTCTGAGAATTCCAAGGAGG + Intergenic
1006677288 6:35773644-35773666 CTGCTCACTGAAGTCTGAGGTGG + Intergenic
1010268893 6:73898739-73898761 ATGCTCTCAGCATTCCAAGCAGG - Intergenic
1013189138 6:107787074-107787096 CAGCTCTCTGAATTCTGTCCAGG - Intronic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1013426355 6:110016328-110016350 CTTCCCTCTGAACTCAAAGCAGG - Intergenic
1014525551 6:122497407-122497429 CTGCTCTTTGCCTTCTAAGTAGG - Intronic
1017586203 6:155926956-155926978 CTGGGCTCTCAATTCTAATCTGG + Intergenic
1022588765 7:31641368-31641390 CTGCTCCTTGTATTCTAAGGAGG + Intronic
1022621682 7:31990545-31990567 CCACACTCTCAATTCTAAGCTGG + Intronic
1022885650 7:34640665-34640687 CTCCTCTCTGAGTTCGAGGCAGG - Intergenic
1023991298 7:45130296-45130318 CTCCTCTCTGAAGTCGAAGTAGG - Intergenic
1024359013 7:48448146-48448168 CTGCTCTCTGATTTCTATTTTGG - Intronic
1026680788 7:72465034-72465056 CTGGACTCTGAAGTCTGAGCTGG - Intergenic
1027889343 7:83950803-83950825 CTCCTGTCTGAGTTCTAAGAAGG - Intergenic
1030799447 7:113831286-113831308 ATACTCTCTAAATTCTATGCAGG + Intergenic
1031335481 7:120525514-120525536 GTGCCCTCAGAATTGTAAGCAGG - Intronic
1032489690 7:132314901-132314923 TTCCTCTCAGATTTCTAAGCAGG + Intronic
1032540789 7:132701319-132701341 ATGCTCTTTGAAATCTAAGTGGG + Intronic
1035763810 8:2089106-2089128 TTGCTATCTGAATTTTCAGCAGG + Intronic
1037548297 8:19945028-19945050 CTTCTTTCTCAATTCTAAGGTGG + Intronic
1038911038 8:31964844-31964866 CTGCTCTCTTACTTATCAGCTGG - Intronic
1040935571 8:52778463-52778485 CTGCTTTCTGAATACCCAGCAGG - Intergenic
1041171611 8:55148133-55148155 CTGATATCTGAATTTTAAGATGG + Intronic
1044063406 8:87667492-87667514 CTGCTCTCAGAACTGTCAGCTGG + Intergenic
1046019136 8:108642881-108642903 CTGCGCTCTGAATGATAATCTGG + Intronic
1046633714 8:116647952-116647974 ATGTTTTCTCAATTCTAAGCTGG + Intronic
1047338540 8:123958290-123958312 CTGCTCTCTGTCTTCTATGGGGG + Intronic
1047784639 8:128142047-128142069 CAGCTCTCTGACTTCAAAGCTGG + Intergenic
1048565502 8:135592637-135592659 CTACCCTCTGAGTTCTTAGCTGG + Intronic
1048987090 8:139740532-139740554 CTGCTCTCTGACCTCTTAGGAGG - Intronic
1052294043 9:26877745-26877767 GTGCTCACTGAGTTCTAGGCAGG - Intronic
1061351156 9:130065933-130065955 CTGCTTTGTGAATTCTGAGTAGG + Intronic
1186165906 X:6825602-6825624 CTCCTCTCTCCATTCCAAGCTGG - Intergenic
1187176216 X:16898334-16898356 CTTCTCTCTGATCTCCAAGCTGG - Intergenic
1187830018 X:23371531-23371553 ATACTATCTCAATTCTAAGCAGG - Intronic
1195427301 X:104748748-104748770 CTGCTCTCTGAATTCTAAGCTGG - Intronic
1199480216 X:148289981-148290003 CTGCTCTGGGAAGTCAAAGCAGG + Intergenic
1200081920 X:153581477-153581499 CTGCTCTCTGGACTCTGGGCAGG - Exonic