ID: 1195430794

View in Genome Browser
Species Human (GRCh38)
Location X:104787090-104787112
Sequence AAACGTTGCCTGGCACAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195430794_1195430798 27 Left 1195430794 X:104787090-104787112 CCACTTTGTGCCAGGCAACGTTT 0: 1
1: 0
2: 2
3: 26
4: 238
Right 1195430798 X:104787140-104787162 AAACAAAGTTCTGCCCCTCTTGG 0: 1
1: 0
2: 4
3: 23
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195430794 Original CRISPR AAACGTTGCCTGGCACAAAG TGG (reversed) Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
901663207 1:10811938-10811960 ACACAGTGCCTGGCACATAGTGG + Intergenic
902096360 1:13949245-13949267 AAACATCTGCTGGCACAAAGTGG + Intergenic
903022547 1:20404290-20404312 AAACAGTGCCTGGCACATAGTGG - Intergenic
903418689 1:23202522-23202544 AAACCTTGCCAGGAACAAAAAGG + Intergenic
905172524 1:36117569-36117591 GAACGGTACCTGGCACACAGTGG - Intronic
905696776 1:39980477-39980499 ACACAATGCCTAGCACAAAGTGG + Intergenic
906381070 1:45332480-45332502 ACCGGTTGCCTGGCACAGAGGGG + Exonic
906884679 1:49631568-49631590 AAATATTTCCTGGCACAAGGTGG - Intronic
907395210 1:54184982-54185004 ACATGGTGCCTGGCACAGAGTGG - Intronic
907447379 1:54517329-54517351 ACACAGTGCTTGGCACAAAGTGG + Intergenic
907491360 1:54810859-54810881 CAACGGTGTCTGGCACAGAGTGG - Intronic
907502082 1:54887936-54887958 CAACACTGCCTGGCACAGAGCGG - Intergenic
908261780 1:62344719-62344741 AAGCTCTGCCTGGCACATAGTGG - Intergenic
911056674 1:93714410-93714432 GAACACTGCCTGGCACATAGTGG + Intronic
914141343 1:144951602-144951624 ACACGATACCTGGCACATAGAGG + Intronic
914418392 1:147505743-147505765 AAAGAATGCCTGGCACATAGCGG - Intergenic
915274294 1:154777318-154777340 AGACGTTGCCTGGCACAGAGTGG + Intronic
915580916 1:156812914-156812936 GAAAGTTGCGTGGCACACAGTGG + Intronic
917143299 1:171859580-171859602 AGACAGTGCCTGGCACACAGTGG - Intronic
918557202 1:185817007-185817029 GAACAGTGCCTGGCACATAGTGG + Intronic
919777400 1:201203187-201203209 AAACAGTGCCTGGCACACAGTGG + Intronic
919905649 1:202076626-202076648 GAATGGTGCCTGGCACAAAGTGG - Intergenic
920442774 1:205992412-205992434 ACACTGTGCCTGGCACATAGTGG + Intronic
921070809 1:211656147-211656169 AAACAGTGCCTGGCTCATAGTGG + Intergenic
921516163 1:216095034-216095056 GAATAATGCCTGGCACAAAGAGG + Intronic
922939055 1:229445468-229445490 AAAATTAGCCAGGCACAAAGTGG - Intronic
923609871 1:235480987-235481009 AAATGTTGCCTGGAAGAAATGGG - Intronic
924130875 1:240906742-240906764 AAACATTTCTTGGCTCAAAGAGG + Intronic
924691295 1:246353802-246353824 ATACAGTGCCTGGCACACAGTGG + Intronic
1064418939 10:15173587-15173609 AAACAGTGCCTGTAACAAAGAGG + Intergenic
1064569167 10:16674501-16674523 AGACATTGCCTGGCACCTAGTGG - Intronic
1066365190 10:34769603-34769625 AAAATTAGCCTGGCACATAGTGG + Intronic
1066462215 10:35621987-35622009 AAACTGTGCCTGTCTCAAAGGGG - Intergenic
1067547775 10:47207187-47207209 AAATGTTGGCAGGCACAATGAGG - Intergenic
1068761466 10:60715317-60715339 ACAAAATGCCTGGCACAAAGAGG + Intronic
1071792983 10:88975687-88975709 AAACAGTGCCTGGCACATATTGG + Intronic
1072905498 10:99449511-99449533 GAACAGTGCCTGGCACATAGTGG + Intergenic
1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG + Intronic
1074480895 10:113819689-113819711 GAACAGTGCCTGGCACATAGTGG - Intergenic
1077664866 11:4098674-4098696 CAACGGTTCCTAGCACAAAGAGG - Intronic
1078665874 11:13324723-13324745 AAACAGAGCCTGGCACACAGTGG + Intronic
1079309697 11:19354161-19354183 GAAAGGTGCCTGGCACAAGGAGG - Intronic
1079501239 11:21103560-21103582 AAACTATGCTTGGCATAAAGTGG + Intronic
1080043335 11:27782708-27782730 AAACAGTGCCTGGCTCATAGTGG - Intergenic
1081738352 11:45420928-45420950 CAACAGTGGCTGGCACAAAGAGG - Intergenic
1083921813 11:65785422-65785444 CAGCTGTGCCTGGCACAAAGTGG - Intergenic
1085045457 11:73350276-73350298 GAACAGTGCCTGGCACATAGTGG - Intronic
1085089583 11:73699228-73699250 AAACGAATGCTGGCACAAAGAGG - Intronic
1085137190 11:74102318-74102340 ACACATTGCCTGGCACATACTGG - Intronic
1085273835 11:75285706-75285728 ACAAGGGGCCTGGCACAAAGGGG + Intronic
1085478107 11:76800350-76800372 GTACGGTGCCTGGCACAAAATGG + Intergenic
1085936676 11:81153983-81154005 AAGTGTTGCTTGGCACACAGAGG + Intergenic
1086191487 11:84084431-84084453 AAAGGTTGCCTGGCTCAGAATGG + Intronic
1088717838 11:112564472-112564494 AAACGTTGTCTGGCTCCCAGAGG + Intergenic
1089056838 11:115592432-115592454 AAACTGTACCTGGCACACAGAGG - Intergenic
1089321719 11:117630993-117631015 GAATGTTGCCTGGCACATAGTGG + Intronic
1090117718 11:123992524-123992546 AAACACTCCCTGGCACAAAGGGG - Intergenic
1090598371 11:128343503-128343525 ACACGATGCTTGGCACAGAGTGG - Intergenic
1096075442 12:48801022-48801044 CATCGTGGCCTGTCACAAAGTGG + Intergenic
1096464328 12:51839895-51839917 AAACATTCCCTGACACACAGTGG + Intergenic
1101010089 12:100440503-100440525 AAAAGGTGCCTGACACATAGTGG + Intergenic
1101740604 12:107497081-107497103 GAACAGTGCCTGGCACATAGTGG + Intronic
1102157821 12:110744463-110744485 GAACAATGCCTGGCACAGAGTGG - Intergenic
1102221426 12:111197455-111197477 GAACAGTGCCTGGCACAGAGGGG + Intronic
1103188466 12:118981161-118981183 AAAGGTGGCCTGGCCCAAAGGGG + Intergenic
1105287364 13:19015694-19015716 AAACTTTGTCTAGCAGAAAGTGG + Intergenic
1106371326 13:29136650-29136672 AGAGGTTGGCTGGCCCAAAGAGG + Intronic
1109985373 13:69976223-69976245 AAATGTTGCCTTGCAGAAATAGG + Intronic
1111387309 13:87543648-87543670 AAACTTTACCTGGCACATGGTGG - Intergenic
1111968634 13:94886895-94886917 GCACATTGCCTGGCACATAGGGG + Intergenic
1113802925 13:113095845-113095867 GAACTGTGCCTGGCACACAGCGG - Intronic
1114102997 14:19394811-19394833 AACCGGTGCCTGGCACACCGTGG - Intergenic
1114636501 14:24190056-24190078 ATTCTTTGCCTGGCACAAAGAGG + Intronic
1116201502 14:41803500-41803522 AAAACTATCCTGGCACAAAGGGG - Intronic
1117199568 14:53374431-53374453 AAACATTCCCTGGCAAAAAGAGG - Intergenic
1120765168 14:88322290-88322312 AAAGGTTTCCTGGCAGCAAGTGG - Intronic
1121208886 14:92191583-92191605 CAACAGTGCCTGGCACATAGTGG - Intergenic
1121263027 14:92580428-92580450 GAACAGTGCCTGGCACAGAGTGG - Intronic
1121843875 14:97156320-97156342 GAACAGTGCCTGGCACAGAGCGG - Intergenic
1122211184 14:100175180-100175202 CAGCCTTGCCTGGCACACAGTGG + Intergenic
1122516786 14:102314523-102314545 AAACAGTGCTTGGCACACAGCGG - Intergenic
1122750910 14:103932269-103932291 GCACGGTGCCTGGCACATAGTGG + Intronic
1126238031 15:46408359-46408381 ATACAATGCCTGGCACATAGTGG + Intergenic
1126412264 15:48384549-48384571 GAACGTCCTCTGGCACAAAGAGG + Intergenic
1128933804 15:71728416-71728438 GATCATTGCCTGGCACATAGTGG + Intronic
1129028578 15:72602755-72602777 GAACGTTTCCTGGGAGAAAGGGG - Exonic
1129238379 15:74237252-74237274 GAACAGTGCCTGGCACATAGTGG + Intronic
1129798027 15:78392723-78392745 AAACTTACCCTGGCAAAAAGAGG + Intergenic
1130539901 15:84814962-84814984 AGACCTTGCCTAGCACAATGGGG - Intergenic
1131649936 15:94387608-94387630 AAGCACTGCCTGGCACCAAGTGG - Intronic
1131863117 15:96675807-96675829 AAACTGTGCCTGACACAGAGTGG - Intergenic
1133811631 16:9165379-9165401 AAACAGTGCCTGGCGCACAGTGG - Intergenic
1134687884 16:16171485-16171507 AGACTTAGCCTGGCACATAGTGG + Intronic
1134796220 16:17039461-17039483 CAACAGTGCCTGGCACAGAGAGG + Intergenic
1136048156 16:27631764-27631786 GAACTGTGCCTGGCACATAGTGG - Intronic
1138265151 16:55655307-55655329 GAACAGTGCCTGGCACACAGCGG + Intergenic
1139321983 16:66122262-66122284 AAACAGTGCCTGGAACAGAGAGG - Intergenic
1139657325 16:68396946-68396968 ACACAGTGCCTGGCACACAGTGG - Intronic
1141227816 16:82135961-82135983 AAACCTGGCCTGCCACAACGTGG - Intergenic
1141468689 16:84223797-84223819 GAACCATGCCTGGCACAAAGTGG - Intronic
1141770947 16:86089361-86089383 ATACATGGCCTGGCACACAGTGG - Intergenic
1143965359 17:10753048-10753070 CACAGTTGCCTGGAACAAAGAGG - Intergenic
1144803030 17:17944198-17944220 TCATGGTGCCTGGCACAAAGTGG + Intronic
1146212437 17:30952981-30953003 ACATGTTGCCTGACACCAAGAGG + Intronic
1146604774 17:34248917-34248939 AAATGTTGCATGCCAAAAAGGGG - Intergenic
1146919398 17:36700223-36700245 AGACATTGCCTTCCACAAAGTGG + Intergenic
1148987681 17:51637852-51637874 ACACTGTGCCTAGCACAAAGAGG - Intronic
1149700784 17:58653786-58653808 AAACCTGGACTGCCACAAAGGGG - Intronic
1152260418 17:79263709-79263731 GAACGGTGCCTGACACACAGGGG + Intronic
1153165906 18:2261987-2262009 GAACATTGCCTGGCACACAAAGG + Intergenic
1154306149 18:13232353-13232375 AAACCATGCCAGGCAAAAAGGGG - Intronic
1155026258 18:21943523-21943545 ATACATTGCCTGACACACAGCGG + Intergenic
1155724726 18:29066358-29066380 AAATGTTGCCTTGTACAAGGTGG - Intergenic
1158466152 18:57691609-57691631 AAAAGGTGCCTGGCACAGAGTGG + Intronic
1160015181 18:75134845-75134867 AAACGTTGCCTGAGGAAAAGGGG - Intergenic
1161436546 19:4267107-4267129 AAACAGTTCCTGGCACAAGGAGG - Intronic
1161881172 19:6954045-6954067 AAACAGTGCCTGGCACATAGCGG + Intergenic
1162017950 19:7855906-7855928 AAAAGTGGCCTGGCCCTAAGGGG + Intronic
1162306895 19:9880304-9880326 GAACAGTGCCTGGCACATAGTGG - Intronic
1162965395 19:14153201-14153223 AAATTGTGCCTGGCACATAGCGG - Intronic
1163014626 19:14446718-14446740 AAACTTTGCATGGGACAAAATGG - Intronic
1163457579 19:17417048-17417070 TAAAGTTGCCTGGAAAAAAGTGG - Intronic
1166222290 19:41373466-41373488 AAACAGTGCCTGGCACAAAGTGG - Intronic
1166857331 19:45789218-45789240 GAACGGTGCCTGGCACAGAACGG + Intronic
1166985215 19:46655745-46655767 GAACAGTGCCTGGCACAAAGTGG + Intronic
1167109219 19:47449049-47449071 AAACAATGCCTGGCACACAACGG - Intronic
1167465313 19:49647621-49647643 AAACATGACCTGGCACAGAGTGG - Intronic
1167747736 19:51362595-51362617 GAACAGTGCCTGGCACACAGTGG - Intronic
925990423 2:9250187-9250209 ACACGCTGCCTGACACAAAGTGG + Intronic
927751139 2:25672374-25672396 GAATGTTGCCTGGCTCACAGCGG - Intronic
928151634 2:28835563-28835585 GAACAGTGCCTGGCACATAGTGG + Intronic
928912849 2:36440320-36440342 AAACATTGCCTGGTACTAACTGG + Intronic
929077878 2:38093349-38093371 AAACAGTGCCTGGCACTTAGGGG - Intronic
929085409 2:38162820-38162842 AAATTTTGCCTGGGACAGAGAGG - Intergenic
929601313 2:43206457-43206479 ACACCTTGCCTGGCACACAGTGG - Intergenic
930832900 2:55764181-55764203 ATACCTTGCCTGGCCAAAAGTGG - Intergenic
931216857 2:60253290-60253312 GAACAGTGCCTGGCACACAGTGG - Intergenic
932065321 2:68551793-68551815 AAGCGTTGCTAGACACAAAGAGG - Intronic
932180069 2:69638934-69638956 ATACAGTGCCTGCCACAAAGAGG + Intronic
936630644 2:114199311-114199333 AAACTGTGTCTGGCACATAGTGG + Intergenic
936682211 2:114786961-114786983 AAACCGTGTCTGGCACAGAGAGG - Intronic
937064371 2:119006188-119006210 AAATGGTGTCTGGCACACAGTGG + Intergenic
937259961 2:120578956-120578978 AAAAGGTGCCTGACATAAAGAGG + Intergenic
939179663 2:138789417-138789439 AAACATTGCCTAGTAAAAAGTGG - Intergenic
940134880 2:150424991-150425013 ACACAGTGCCTGGCACACAGTGG - Intergenic
941255941 2:163231037-163231059 AAATTGTCCCTGGCACAAAGTGG - Intergenic
941657366 2:168158477-168158499 ATATGTTCCCTGGCCCAAAGGGG + Intronic
945702104 2:213184636-213184658 GAACTATGCCAGGCACAAAGTGG - Intergenic
946992004 2:225343733-225343755 AAAAGATGCCAGGCACAAAATGG - Intergenic
948313094 2:237004406-237004428 AAAGGTAGCATGGCAGAAAGCGG + Intergenic
1169556002 20:6750684-6750706 AAACAGTGCCTGGCACATAGTGG - Intergenic
1170333030 20:15236510-15236532 ACACAGTGCCTGGCACCAAGTGG - Intronic
1171089472 20:22270318-22270340 AAATGGTGCCTGGCACACAATGG + Intergenic
1173117092 20:40254863-40254885 AAACGATGCTTGGCAGAAATGGG - Intergenic
1173163802 20:40671899-40671921 ACACAGTGCCTGGCACAGAGGGG - Intergenic
1173419900 20:42891762-42891784 ATACAGTGCCTGGCACACAGTGG - Intronic
1173647699 20:44643852-44643874 CCACGGTGCCTGGCACATAGTGG - Intronic
1173957376 20:47044341-47044363 GAACAATGCCTGGCACACAGTGG - Intronic
1174166140 20:48584798-48584820 AGACCTTGCTTGGCACAGAGTGG + Intergenic
1174200611 20:48804192-48804214 GAACAGTGCCTGGCACATAGTGG - Intronic
1174787863 20:53449428-53449450 CAACGGTGCCTGACACATAGTGG - Intronic
1178516815 21:33254977-33254999 GAACGTTGCCTGGCACATAACGG + Intronic
1180197072 21:46203375-46203397 AAACCTCACCAGGCACAAAGTGG + Intronic
1180478029 22:15729555-15729577 AACCGGTGCCTGGCACACCGTGG + Intergenic
1183260427 22:36791490-36791512 ATACGCTCCCTGGCACAAAGGGG - Intergenic
1183862280 22:40678917-40678939 AACCCTTGCCTGGCACTCAGAGG - Exonic
1184386756 22:44181154-44181176 GAACAATGCTTGGCACAAAGTGG - Exonic
1184451342 22:44584494-44584516 GAACAGTGCCTGGCACCAAGTGG + Intergenic
1184890739 22:47377479-47377501 AAACGGTGCCTGGAACAGAGAGG + Intergenic
950500601 3:13361229-13361251 GAACCATGCCTGGCACATAGCGG + Intronic
951648778 3:24924907-24924929 AGATGATGCCTGGCACATAGAGG + Intergenic
952154664 3:30629687-30629709 AAACATTGGCTGGCACACGGTGG - Intronic
952579823 3:34819970-34819992 AAACATTACCAGGTACAAAGAGG - Intergenic
953131441 3:40143161-40143183 ACACAGTGCCTGGCACATAGTGG + Intronic
956725499 3:72153302-72153324 AAACGGTGCCTGAGACAAATTGG - Intergenic
960696044 3:120397484-120397506 CAACAGTGCCTGGCACAAAATGG + Intronic
962167026 3:133060090-133060112 ACACAGTGCCTGGCACAAAAGGG - Intronic
963128462 3:141836425-141836447 ACACAGTGCCTGGCACAGAGTGG + Intergenic
964714531 3:159708083-159708105 GAACAGTGCCTGACACAAAGTGG + Intronic
966552435 3:181219944-181219966 GAACAGTGCCTGGCACATAGTGG + Intergenic
966951501 3:184822845-184822867 AAATGTTGCCAGGCAAAGAGTGG + Intronic
970422149 4:15915298-15915320 AAACAGTGCTTGGCAGAAAGTGG + Intergenic
971181321 4:24330833-24330855 AAAAGTTGCCTGCCAAAGAGTGG - Intergenic
971291847 4:25349947-25349969 AAACAGTGCCTGGCACACAGTGG - Intronic
971477755 4:27088330-27088352 GAACAGTGCCTGGCACATAGTGG + Intergenic
974112375 4:57540395-57540417 ATACTTTGTCTTGCACAAAGAGG - Intergenic
976541504 4:86282603-86282625 AAATTTTCCCTGGCACCAAGAGG + Intronic
977909406 4:102514841-102514863 AAACATTACCAGGGACAAAGAGG - Intronic
978518026 4:109589781-109589803 GCAGGTTGCCTGGCACAGAGTGG + Intronic
979084111 4:116383807-116383829 AAACGTTGCCTGCAGCAGAGAGG - Intergenic
981040925 4:140220797-140220819 AAAAAGTGCCTGGCACATAGTGG - Intergenic
983854714 4:172629500-172629522 AAAAGTTGCTTGTCACATAGAGG - Intronic
985259083 4:188098147-188098169 ATACGTTGCCTTTCAGAAAGTGG - Intronic
989297840 5:39850668-39850690 AAACGTGGTCTGCCACAAAGTGG - Intergenic
992024461 5:72656964-72656986 AAACAGTGCCTGGCACATGGTGG - Intergenic
992758270 5:79929646-79929668 GAACAGTGCCTGGCACACAGTGG - Intergenic
994389883 5:99179549-99179571 TCACGCCGCCTGGCACAAAGTGG - Intergenic
995412935 5:111878920-111878942 AAACAGTGTCTGGCACATAGTGG - Intronic
996030260 5:118696922-118696944 GAACAGTGCCTGGCACAGAGCGG - Intergenic
997408855 5:133674705-133674727 ATACCATGCCTGGCACACAGTGG + Intergenic
997851523 5:137337046-137337068 GAACAGTGCCTGGCACACAGTGG + Intronic
998478652 5:142442895-142442917 ACACAGTGCCTGGCACATAGAGG + Intergenic
1000048311 5:157540124-157540146 ATGCCATGCCTGGCACAAAGTGG + Intronic
1000251305 5:159498067-159498089 GCTCCTTGCCTGGCACAAAGAGG - Intergenic
1000582757 5:163054192-163054214 AAATGAGGCCTGGGACAAAGAGG + Intergenic
1000842046 5:166232077-166232099 AAACGTTGCCTGTAACAGAGGGG + Intergenic
1001136751 5:169108837-169108859 AAACATTGCCTAGCACAGAGTGG + Intronic
1002434611 5:179222929-179222951 AGGGGTTGCCTGGCAGAAAGTGG - Intronic
1003152101 6:3561450-3561472 TAACTTTGCCTGGAACACAGGGG + Intergenic
1003639154 6:7862140-7862162 AAACCTTGCCTGGCACCCATGGG - Intronic
1005722694 6:28618444-28618466 AAACCTGGCCTGCCACATAGTGG + Intergenic
1006119556 6:31795722-31795744 AAACGCTCCCTGTCACAAAGGGG - Exonic
1009644836 6:66386721-66386743 AAACGCTGCCTGAGACATAGGGG - Intergenic
1015471484 6:133611504-133611526 AAGCATTGCCTGGCATAGAGTGG + Intergenic
1016400360 6:143673415-143673437 AAAATTTGCCTGGCAAATAGAGG - Intronic
1017813728 6:158002180-158002202 GAACCATGCCTGGCACACAGTGG + Intronic
1017919518 6:158859073-158859095 ACACACTGCCTGGCACAAAGTGG + Intergenic
1018001918 6:159587022-159587044 AAACCTTGACTTGCAGAAAGAGG - Intergenic
1018220771 6:161576549-161576571 TAATAGTGCCTGGCACAAAGTGG - Intronic
1018265285 6:162017742-162017764 AAACGTTGCCTGTCACAGCAAGG + Intronic
1019135488 6:169905128-169905150 AAAGGTTGCCTGGCACATGCCGG + Intergenic
1019351511 7:556234-556256 AAACGGTGCCTGGCACGTGGTGG - Intronic
1019501232 7:1365739-1365761 GAACAGTGCCTGGCACACAGGGG - Intergenic
1021428048 7:20525633-20525655 AAAAGATGACTGGCTCAAAGAGG + Intergenic
1021441549 7:20682677-20682699 AGACAATGCCTGGCACACAGTGG + Intronic
1027669069 7:81073680-81073702 GAACCTTGCCTGCCACAGAGAGG + Intergenic
1027889779 7:83957015-83957037 GCATGATGCCTGGCACAAAGAGG - Exonic
1030299253 7:107959054-107959076 GAACGGTGCCTGGCACATAGAGG + Intronic
1032102204 7:128990466-128990488 GAACAGTGCCTGGCACATAGTGG + Intronic
1032247803 7:130227970-130227992 AACTGTTGCCTGGTACACAGGGG + Intergenic
1033046037 7:137962809-137962831 ACACAGTACCTGGCACAAAGTGG + Intronic
1034390817 7:150786244-150786266 AGAAGTTGCCCGGCAGAAAGGGG + Intergenic
1037761312 8:21743591-21743613 ACACAATGCCTGGCCCAAAGTGG + Intronic
1038110249 8:24488742-24488764 ACACAGTACCTGGCACAAAGTGG - Intronic
1041619010 8:59943409-59943431 CAACTCTGCCTGGCACATAGAGG - Intergenic
1044560069 8:93604145-93604167 AAATATTGCTTGGCACAAACTGG - Intergenic
1045046269 8:98282019-98282041 TTACCTTGCCTGGCAGAAAGAGG - Intronic
1048235633 8:132687317-132687339 GAAGAGTGCCTGGCACAAAGTGG - Intronic
1048793418 8:138125834-138125856 ACACGCTGCCTGACACAGAGTGG - Intergenic
1048838312 8:138542350-138542372 AAACAATGCCTGGTACAGAGAGG + Intergenic
1052021082 9:23525915-23525937 AATGGTTGCCTAGCATAAAGAGG + Intergenic
1055558361 9:77498593-77498615 ACATGATGCCTGGCACACAGTGG + Intronic
1057698727 9:97347577-97347599 AAACATTGCATGGTACAAACTGG - Intronic
1057866802 9:98687809-98687831 ACACAGTGCCTGGCACACAGAGG + Intronic
1058372341 9:104284434-104284456 AAACACTGCCTGGCACATAGTGG + Intergenic
1059543890 9:115157236-115157258 ATACTGTGCCTGGCCCAAAGTGG - Intronic
1062109485 9:134774155-134774177 ACAGGATGCCTGGCACATAGAGG - Intronic
1186954985 X:14671839-14671861 AAGTCTTGCCTGGCACATAGAGG + Intronic
1188023673 X:25186313-25186335 AAATGGTGCCTGGCATATAGTGG + Intergenic
1188308003 X:28582477-28582499 GAACCATGCCTGGCACATAGTGG + Intergenic
1189228256 X:39431764-39431786 AATCTTTGCCAGGCCCAAAGAGG + Intergenic
1189337620 X:40179855-40179877 GTACAGTGCCTGGCACAAAGTGG - Intergenic
1190539705 X:51464312-51464334 AAACTTTTCATGGCACAAAAAGG + Intergenic
1191056474 X:56246412-56246434 CAACAGTACCTGGCACAAAGAGG - Intronic
1192085703 X:68095178-68095200 AAACAGTACCTGGCATAAAGTGG + Intronic
1194030560 X:88808360-88808382 AAAGGAAGCCAGGCACAAAGAGG + Intergenic
1195430794 X:104787090-104787112 AAACGTTGCCTGGCACAAAGTGG - Intronic
1196405343 X:115356087-115356109 AAGCATTGCCTGGCCCATAGAGG + Intergenic
1196412442 X:115434242-115434264 AAACAGTGCCTGGCACAGTGTGG - Intergenic
1197126622 X:122954540-122954562 TAATCTTGCCTGGCACAAGGAGG + Intergenic
1198425491 X:136515729-136515751 GAACAGTGCCTGGCACATAGTGG + Intergenic
1199244224 X:145583900-145583922 ATATATTGCCTGGCACTAAGTGG + Intergenic
1199418565 X:147616022-147616044 ATGCTGTGCCTGGCACAAAGTGG + Intergenic
1199784276 X:151090449-151090471 ATACAGTGCCTGGCACAGAGTGG + Intergenic
1200701660 Y:6407748-6407770 AAACGTTTCCTGGTTCACAGAGG - Intergenic
1201032451 Y:9756950-9756972 AAACGTTTCCTGGTTCACAGAGG + Intergenic