ID: 1195431288

View in Genome Browser
Species Human (GRCh38)
Location X:104792331-104792353
Sequence CTAGACAGTGAAGCGATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195431288_1195431295 30 Left 1195431288 X:104792331-104792353 CCCCAGATCGCTTCACTGTCTAG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1195431295 X:104792384-104792406 ACAAGTCCCTCAATATACTCTGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195431288 Original CRISPR CTAGACAGTGAAGCGATCTG GGG (reversed) Intronic
901669448 1:10847078-10847100 AGAGACGGTGCAGCGATCTGAGG - Intergenic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
907581617 1:55577486-55577508 CTAGAGTATGAAGCAATCTGTGG - Intergenic
909146236 1:71936568-71936590 CTAGACAGAGATGCTATATGTGG + Intronic
912695408 1:111838002-111838024 CTCGACAGTGACGCGTTATGTGG - Intronic
913119742 1:115728955-115728977 GTAGACAGTGAAGAGATCCCTGG - Intronic
915214537 1:154331054-154331076 CAGGACAGGGAAGAGATCTGGGG - Exonic
918187264 1:182139264-182139286 CTTTCCAGTGAAGCAATCTGGGG - Intergenic
918923794 1:190752261-190752283 CTAGACAGAAGAGCAATCTGTGG + Intergenic
922010128 1:221575165-221575187 CTAGACAGGGAAGCTATTGGTGG - Intergenic
1065094663 10:22268688-22268710 CTAGACTGTGGAGCGATGTGTGG + Intergenic
1067435488 10:46273501-46273523 CAAGACAGTGTCGCCATCTGTGG + Intergenic
1072050762 10:91700903-91700925 CAAGACAAGGAAGAGATCTGCGG - Intergenic
1074562972 10:114550739-114550761 GTAGACAGTGAAAAGATCAGTGG - Intronic
1076560907 10:131362911-131362933 CAAGACAGAGAAGCCATCTGGGG - Intergenic
1080576079 11:33600433-33600455 ATGGACAGTGAAGCCATATGGGG + Intronic
1080783684 11:35454740-35454762 CTAGGCAGTGAAAAGATCTTGGG + Intronic
1080864401 11:36180544-36180566 CCAGACAGTGAAGCCTTATGAGG + Intronic
1101034718 12:100694096-100694118 CTTAACAATGAAGAGATCTGTGG - Intergenic
1105680585 13:22723334-22723356 CTAGACAGTGAACCTAGCTCAGG + Intergenic
1110296022 13:73866916-73866938 CTAGACAATGCAGAGATCTTGGG - Intronic
1114591764 14:23872047-23872069 ATAGACAGTGAAAAGATCAGTGG + Intergenic
1116918764 14:50550226-50550248 CTAGAGAGGGAAGCCATGTGTGG + Intronic
1120443671 14:84567016-84567038 CTAGAAAGGAAAACGATCTGAGG - Intergenic
1121055670 14:90850097-90850119 CTAGTCTGGGAAGGGATCTGTGG + Exonic
1132299037 15:100765247-100765269 CAAGGCAGTGGAGAGATCTGGGG - Intergenic
1148053274 17:44779602-44779624 CTGGCCAGGGAAGGGATCTGCGG - Intronic
1152346615 17:79756438-79756460 CTAGAGAGTGCTGGGATCTGTGG + Intergenic
1153022245 18:640145-640167 CTAGACCTTGAAGTGATCTTTGG + Intronic
1164733292 19:30521750-30521772 CTAGCCAGAGAAGCCAGCTGGGG + Intronic
925075911 2:1015251-1015273 CTAGACATTGAATCCATTTGAGG - Intronic
925524123 2:4780913-4780935 ATAGACAATGAAGCCAGCTGTGG - Intergenic
925648604 2:6064500-6064522 CTGCACAGTGAAGATATCTGAGG - Intergenic
927099633 2:19778150-19778172 CTAGATGGGGAAGAGATCTGAGG - Intergenic
927759399 2:25738892-25738914 CAAGATACTGAAGCTATCTGTGG - Intronic
931797482 2:65724907-65724929 CAAGCCAGTGAAGCAAGCTGAGG - Intergenic
931969762 2:67573158-67573180 TTAGTCAGTGAATCGATCTGAGG - Intergenic
942145744 2:173024530-173024552 CTAGAAAGTGAACTGATTTGGGG + Intronic
943649920 2:190446349-190446371 GCAGGCAGTGAAGAGATCTGGGG - Intronic
1169188021 20:3635546-3635568 CTAGACAAAGAAGCTGTCTGGGG + Intronic
1172043326 20:32061565-32061587 CTAGACAGTGATGGGAGTTGGGG + Intronic
1174488320 20:50874910-50874932 CGAGACAGTGCAGGGAGCTGGGG + Intronic
1179166159 21:38936860-38936882 CGAGACAGAGAAACGATGTGGGG - Intergenic
1182599182 22:31446662-31446684 CTGGACAGTGGAGAGTTCTGAGG + Intronic
1182694515 22:32187715-32187737 CATGACAGTGCAGAGATCTGAGG + Intergenic
1184465301 22:44665433-44665455 GTAGGCAGTGAATGGATCTGGGG + Intergenic
950897670 3:16468167-16468189 CTAGAGAGTGAAGTGTGCTGAGG - Intronic
961312293 3:126010717-126010739 CTTGTCAGTGAAGCCATGTGGGG + Intronic
961619119 3:128209409-128209431 GAAGACAGTGAAGAGATGTGGGG + Intronic
967341547 3:188404552-188404574 TGAGACAGTGAAACTATCTGAGG + Intronic
967808966 3:193739318-193739340 AGAGACAGTGAAAAGATCTGTGG - Intergenic
968729024 4:2261200-2261222 CTAGACAGAGAAGCGAGTGGAGG - Intronic
969563452 4:7963834-7963856 CTAGACAGTGCAGCACCCTGAGG - Intergenic
973927022 4:55749020-55749042 GAAGACAGTGAAGCAGTCTGTGG + Intergenic
976076486 4:81305031-81305053 CTAGAGACTGAAGCCAGCTGGGG - Intergenic
977601665 4:98939893-98939915 CTAGACAGTGAAATCATCTCAGG + Intergenic
978404591 4:108365675-108365697 CTAGACAGAGAAGGGCTCCGTGG - Intergenic
986076835 5:4346720-4346742 CCATGCAGTGAAGTGATCTGGGG + Intergenic
986470441 5:8068431-8068453 TTAGACAGTGAAGAGATAGGGGG + Intergenic
998310155 5:141122263-141122285 CTAGACCGGGAAGAGCTCTGTGG + Exonic
998317771 5:141200042-141200064 CTAGACAGGGAGGAGCTCTGCGG + Exonic
998318720 5:141209175-141209197 CTAGACAGGGAGGAGCTCTGTGG + Exonic
998337715 5:141388152-141388174 CTAGACAGGGAGGAGATATGCGG + Exonic
998338825 5:141398395-141398417 CTAGACAGGGAGGAGATATGCGG + Exonic
1000688723 5:164287710-164287732 CCAGACTGTGAAGCCATCTTAGG - Intergenic
1003256591 6:4480509-4480531 CTTGACAGTCAAGAGAGCTGGGG + Intergenic
1004292056 6:14376446-14376468 ATAGACCGTGAAGCCTTCTGAGG - Intergenic
1005357251 6:24996436-24996458 TTAAACAGAGAAGTGATCTGAGG - Intronic
1006454298 6:34123150-34123172 CTTGCCAGTGAAGCAACCTGTGG - Intronic
1007702741 6:43774052-43774074 CTCGACAGTGAAGCATTCTGGGG + Intronic
1011944022 6:92879354-92879376 CTAGAAAAAGAGGCGATCTGAGG + Intergenic
1018103684 6:160463898-160463920 CTAGACACTGAAGTGCTCAGTGG + Intergenic
1018476928 6:164151579-164151601 AGAAACAGTGAAGCGTTCTGGGG + Intergenic
1022041540 7:26586512-26586534 CTAAACAGTGTAGAGTTCTGGGG + Intergenic
1023742249 7:43291017-43291039 CTAAACAGTAAAGGGAACTGAGG - Intronic
1032142632 7:129347093-129347115 GGAGACAGTGAAACGATCAGTGG + Intronic
1032763224 7:134964593-134964615 CTAGGCAGAGAAGCGCTGTGTGG + Intronic
1035179597 7:157079636-157079658 TTAACCAGTGAAGCCATCTGGGG - Intergenic
1040186377 8:44642858-44642880 CTAGACAGAGAAGCATTCTGAGG + Intergenic
1043549823 8:81358198-81358220 CTAGACAGTCCAGAGATCTGTGG - Intergenic
1044718855 8:95126329-95126351 CAAGACAGTGAAAAGATCAGTGG - Intergenic
1047055779 8:121163715-121163737 CTGGACAGAGAAGGGAACTGAGG - Intergenic
1048274299 8:133054404-133054426 CTACACAGTGATGCGATTTGGGG + Intronic
1050068421 9:1785618-1785640 CTAGACAGAGAAGAGGTCTCAGG - Intergenic
1059280160 9:113126081-113126103 CTGGACAGTGAAGATCTCTGAGG + Intergenic
1060878816 9:127103352-127103374 CTTGTCAGTGAAGCAATGTGGGG + Intronic
1187986274 X:24815298-24815320 CTAGACAGAGAAGGTCTCTGTGG - Intronic
1195431288 X:104792331-104792353 CTAGACAGTGAAGCGATCTGGGG - Intronic
1196940022 X:120766391-120766413 CTAGAGAGTGAAGCAATGTCAGG + Intergenic
1197038669 X:121908204-121908226 CTAGAAAGAGAAGAGAACTGGGG + Intergenic
1198370348 X:135983672-135983694 CTGGTCAGGGAAGCAATCTGTGG + Intergenic
1199105942 X:143867962-143867984 CTAGACAGATCAGAGATCTGAGG - Intergenic