ID: 1195431434

View in Genome Browser
Species Human (GRCh38)
Location X:104793903-104793925
Sequence ATCCCCATGTTGTTGATTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195431434_1195431438 25 Left 1195431434 X:104793903-104793925 CCACTAATCAACAACATGGGGAT 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1195431438 X:104793951-104793973 CAGTACTGAAAAATATTTCAGGG 0: 1
1: 0
2: 4
3: 37
4: 412
1195431434_1195431437 24 Left 1195431434 X:104793903-104793925 CCACTAATCAACAACATGGGGAT 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1195431437 X:104793950-104793972 TCAGTACTGAAAAATATTTCAGG 0: 1
1: 1
2: 4
3: 48
4: 365
1195431434_1195431436 -1 Left 1195431434 X:104793903-104793925 CCACTAATCAACAACATGGGGAT 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1195431436 X:104793925-104793947 TTTGTCTTGGAGCTGCTACTTGG 0: 1
1: 0
2: 1
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195431434 Original CRISPR ATCCCCATGTTGTTGATTAG TGG (reversed) Intronic
901766770 1:11505088-11505110 ATGCCGATGTTGTTGACTGGAGG - Intronic
906168410 1:43705034-43705056 ATCCCCATGTTCTCCTTTAGGGG - Exonic
906510394 1:46407354-46407376 ATCCCCATGTTAAGGATTGGTGG + Intronic
909206702 1:72767688-72767710 ATCCCCATCTTGTGGAGCAGAGG + Intergenic
916003750 1:160640657-160640679 ATCCCCATGTTGCTCAGTAAAGG + Intronic
917824732 1:178806655-178806677 ATCCTCCTGTTTTTGCTTAGTGG + Intronic
923452674 1:234134658-234134680 ATCCCCTTGTTCTTGAGTGGGGG - Intronic
924590168 1:245396161-245396183 GATCCCATGTTTTTGATTAGTGG - Intronic
1062779786 10:191988-192010 AACCCCATGCTGTTGTTTTGAGG - Intronic
1065593197 10:27286573-27286595 ATGCTCATGTTTTTGATTATAGG - Intergenic
1065657174 10:27963703-27963725 ATGCTCATGTTTTTGATTACAGG + Intronic
1066635690 10:37496748-37496770 ATCCCCATGTGTTGGATGAGGGG + Intergenic
1067451039 10:46382048-46382070 ATCCCCACCTTGTTGATTACAGG - Intronic
1067586204 10:47477703-47477725 ATCCCCACCTTGTTGATTACAGG + Intronic
1069681104 10:70285984-70286006 ATCCCTATTTTGTAGATGAGAGG - Intergenic
1071174462 10:82908517-82908539 ATTATCATGTTGTTCATTAGTGG + Intronic
1071390026 10:85164126-85164148 TTCCCTATGTTATTAATTAGAGG - Intergenic
1072697700 10:97616199-97616221 GTGCCCCTGTTGTTGATTCGAGG - Exonic
1077147506 11:1052636-1052658 ATCCCCATCTTGCTGATAAGCGG - Intergenic
1078093629 11:8283417-8283439 ATCTCCATGCTGTCAATTAGAGG - Intergenic
1079745605 11:24125084-24125106 CTCCTCATATTGTTGATTAATGG - Intergenic
1081025851 11:38014224-38014246 ATATCCATATTTTTGATTAGGGG + Intergenic
1085720099 11:78904987-78905009 ATGCCCATGTGGTTAATAAGTGG - Intronic
1086504152 11:87485706-87485728 TTCACCATGTTGTTCACTAGAGG - Intergenic
1086736453 11:90312092-90312114 ATCCCCATGTGCTTGATAAGAGG - Intergenic
1097441572 12:59614578-59614600 ATCTACATGTTGATGATTAATGG + Intronic
1099310098 12:81008772-81008794 ATCACTATGATGTTGATTAATGG + Intronic
1100014430 12:89991797-89991819 ATCTTCATGTTGTTGGTTATCGG - Intergenic
1117009961 14:51460768-51460790 ATCCTGAAGATGTTGATTAGTGG + Intergenic
1117732823 14:58740955-58740977 ATCCACATGATGTAGAATAGGGG - Intergenic
1117969128 14:61235042-61235064 ATCCCCATGTGCTTGCTTAAGGG - Intronic
1118691724 14:68346413-68346435 ATTCCCAGGTTGTTGTTTAGTGG - Intronic
1121066068 14:90966266-90966288 ATCATCATGTTGTTGAGTACAGG + Intronic
1124698623 15:31890681-31890703 CTCCTCATTTTGTTGCTTAGTGG + Intergenic
1125166598 15:36713267-36713289 ATTTCCATGTTCTTGATCAGTGG - Intronic
1127672216 15:61205976-61205998 AACCCCATGTTGCAGATTAGAGG - Intronic
1133624795 16:7561144-7561166 ATTCCCATGTTGGTTCTTAGAGG - Intronic
1136015890 16:27400859-27400881 ATTCCCCTGTGGTTGATTTGAGG - Intergenic
1138824281 16:60300172-60300194 ATACCTATGTTGTAGATTAGGGG + Intergenic
1139104286 16:63807825-63807847 CTCCCCATTTTGTTGTGTAGTGG - Intergenic
1149090325 17:52770302-52770324 TTCCTCATGTTGTTTATTTGAGG - Intergenic
1153725607 18:7951387-7951409 CTACCCATGTTATTGATTAGTGG + Intronic
1155164243 18:23219687-23219709 ATCCCCATTTTATAGATGAGGGG - Intronic
1155401122 18:25440803-25440825 ATATCCATGGAGTTGATTAGGGG + Intergenic
1158179542 18:54698470-54698492 TTCCCCAGGATGTTGATTTGGGG + Intergenic
1158592358 18:58788536-58788558 ATCCCCATTTTATAGATGAGGGG - Intergenic
1161321841 19:3645058-3645080 ATTCCCACGGTGTTGATGAGAGG + Intronic
927629285 2:24757920-24757942 ATCCCCTTGTTCATGATCAGTGG + Intronic
928535974 2:32241921-32241943 ATGCCTAGGTTGTTGATTTGAGG - Intronic
930643833 2:53882525-53882547 ATCCCCATTTTACTGATGAGAGG + Intronic
933587881 2:84199969-84199991 ATTGCCCTGTTGTTGTTTAGGGG + Intergenic
935102475 2:100010034-100010056 ATCCCCATGTCGCTGATTTGGGG - Intronic
940839537 2:158563585-158563607 ATTCCCATTTTGATGATTATTGG + Intronic
945420133 2:209625531-209625553 ATCCCCATTTTAGAGATTAGGGG + Intronic
1170218204 20:13914606-13914628 ATCCCCATTTCATAGATTAGAGG - Intronic
1170264477 20:14449725-14449747 ATCCTCATTTTATTGGTTAGAGG + Intronic
1173977523 20:47198150-47198172 ATCCCCATGGAGTTGGGTAGGGG - Intergenic
1179214094 21:39350897-39350919 ACCCCCATGCTGATGAGTAGTGG - Intergenic
1181092266 22:20481985-20482007 ACTCCCATGCTGTTGAGTAGTGG - Intronic
1181305025 22:21911321-21911343 ATACCCATGTGGTTTTTTAGGGG + Intergenic
1184753690 22:46503704-46503726 ATCTCCGTCTTGTTCATTAGTGG - Intronic
949168010 3:963787-963809 GTCCCCATGTGATTGATTGGGGG + Intergenic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
953458259 3:43061123-43061145 CTCCCCATGTTGTTGCTGTGAGG - Intergenic
954038548 3:47867039-47867061 ATCACCATGCTGGTGTTTAGGGG + Intronic
955940073 3:64139064-64139086 ATCCTCATGTTGTTGTTTTCTGG + Intronic
955950922 3:64241224-64241246 ATCCAGATGTTGTTGTTAAGAGG - Intronic
957396423 3:79644887-79644909 ATCCTCTTGTTGTTGATTTCTGG - Intronic
957930950 3:86877059-86877081 ATCCTCATGTTGTTTCTTAAAGG + Intergenic
959532917 3:107454074-107454096 TTCCCCATGCTGCTGATTTGAGG - Intergenic
959665726 3:108918543-108918565 ATCCCCATGTTATTGACCTGGGG + Intronic
959976043 3:112460995-112461017 ATTCCCATGTTACTGATTTGAGG + Intergenic
962381433 3:134901445-134901467 ATCCCCATGGTGTTGTTTCCTGG + Intronic
964790945 3:160452858-160452880 ATCCCCATGGTGTCGAGCAGCGG + Intronic
966931612 3:184679087-184679109 CTCCCCACTTTGTGGATTAGGGG - Intronic
967726079 3:192863677-192863699 ATCCCCAAGGTGATGATTATTGG + Intronic
968051853 3:195659896-195659918 TTCCCCATGTTTTTTCTTAGAGG + Intergenic
972650098 4:41008753-41008775 ATCCCCATTTTATAGATGAGAGG + Intronic
974571684 4:63659004-63659026 ATCACCATTTTGTTGATTACAGG - Intergenic
975950448 4:79763752-79763774 TTCCCCATGTTTTTGAACAGAGG + Intergenic
977313442 4:95414732-95414754 ATCCACATGATGTTAATGAGAGG + Intronic
978484142 4:109230820-109230842 ATCTGCAAGGTGTTGATTAGAGG + Intronic
991233917 5:64370985-64371007 ATCCCAATGTTTTTGGATAGTGG - Exonic
992833294 5:80616193-80616215 TTCCGCAGGTTGTTGATTTGTGG - Intergenic
993541356 5:89156543-89156565 ATCCTCAAGGTATTGATTAGGGG - Intergenic
998609770 5:143675251-143675273 TTTCCCATGTTGTTGAGTATGGG - Intergenic
998998563 5:147894375-147894397 ATGCCAATGTTGTTCAGTAGAGG + Intronic
999914760 5:156245690-156245712 ATCCCCATGGTGTTATTTAATGG - Intronic
1006707383 6:36032539-36032561 AGGCCCTTGCTGTTGATTAGAGG + Intronic
1007790033 6:44303517-44303539 ATCCCCAGGTTCTAGAATAGTGG + Intronic
1008341972 6:50377448-50377470 ATTCCCATCTTGCTGATTACTGG + Intergenic
1009715979 6:67395894-67395916 TTCAGCATGTTGTTAATTAGAGG - Intergenic
1010434099 6:75810605-75810627 ATCCCCATTCAGTTGGTTAGGGG + Intronic
1011664968 6:89624566-89624588 TTCTCCAGCTTGTTGATTAGAGG - Exonic
1011901580 6:92304471-92304493 ATCCCCATGTGGTGGAGGAGGGG + Intergenic
1015435457 6:133181522-133181544 ATCCCCATATTGTTTAATATTGG - Intergenic
1018512921 6:164545292-164545314 ATCCCTCTGGTGTTGATGAGGGG - Intergenic
1028928619 7:96388251-96388273 ATCCACAAGGTGTTGATTAATGG - Intergenic
1029035987 7:97522373-97522395 ATCACCATGCTGTACATTAGAGG + Intergenic
1033838005 7:145338886-145338908 ATCTCCATGTTCTTAATAAGAGG + Intergenic
1038169174 8:25113243-25113265 CTCCCAATGTGGTTGATTAATGG - Intergenic
1041165387 8:55087212-55087234 ATCCCCATTTTCTTGATTCAGGG + Intergenic
1050291818 9:4163004-4163026 ATCCTCATGTGGATGATGAGAGG - Intronic
1052635804 9:31102528-31102550 ATCCCCATGATTTTGATTTCAGG - Intergenic
1060037875 9:120273530-120273552 ATCCACATTCTGTTGATTTGGGG + Intergenic
1186649044 X:11539533-11539555 ATGCCCATGTGGATGGTTAGCGG - Intronic
1193267116 X:79484753-79484775 ATCCACATTTTGTTGATTTTAGG - Intergenic
1195431434 X:104793903-104793925 ATCCCCATGTTGTTGATTAGTGG - Intronic
1201192484 Y:11457465-11457487 CTCCCCAAGTTGTTGAAGAGTGG - Intergenic