ID: 1195432005

View in Genome Browser
Species Human (GRCh38)
Location X:104799386-104799408
Sequence CTGGAGGCCTTGTGAAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195432001_1195432005 7 Left 1195432001 X:104799356-104799378 CCAATGAGCATCAATGTGTATCA 0: 1
1: 0
2: 1
3: 4
4: 111
Right 1195432005 X:104799386-104799408 CTGGAGGCCTTGTGAAAACCTGG 0: 1
1: 0
2: 2
3: 47
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195432005 Original CRISPR CTGGAGGCCTTGTGAAAACC TGG Intronic
900592219 1:3465234-3465256 CTGGAGGCCCTCTGAGAACCAGG - Intronic
901451440 1:9338923-9338945 CTGGAGGACTCTGGAAAACCCGG + Intronic
902139995 1:14345295-14345317 CTGGAGGGCTTGTTCACACCTGG + Intergenic
902791872 1:18774719-18774741 CTGGAAGCTATGTGAAAAGCTGG + Intergenic
902798630 1:18815740-18815762 CTTGAAGCCTTGGGGAAACCAGG + Intergenic
906479233 1:46189407-46189429 CAGGAGGCCTAGTGAGATCCAGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907309226 1:53529837-53529859 CTGAAGGCCTTCTGGCAACCCGG + Exonic
909361370 1:74762891-74762913 CTGTAGGCTCTCTGAAAACCAGG - Intronic
910356114 1:86357690-86357712 TTAGAGGCCATGAGAAAACCAGG + Intronic
911182692 1:94875309-94875331 CTAGTGGACTGGTGAAAACCTGG - Intronic
911887761 1:103326173-103326195 CTTGAGGCCTTGAGCAAACATGG - Intergenic
912445940 1:109736738-109736760 CTGGAGTCCCTGTGAAGACTGGG - Exonic
912640951 1:111346060-111346082 CTGGAGGCCTTGCGTGGACCGGG - Intergenic
914439955 1:147696279-147696301 CTGGAGGCCTTGTGCATTGCTGG - Intergenic
916097674 1:161365554-161365576 TTGGAGGCCTTGAGTAAATCAGG + Exonic
918607407 1:186444983-186445005 CTGGAGGGCTTGTTAAAATATGG - Intronic
919821531 1:201476063-201476085 CTGGAGGGCTTGTTCAAACACGG - Intergenic
920733952 1:208514179-208514201 CTGGAGGCCCTGTTAAAGCATGG - Intergenic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
1062925498 10:1313098-1313120 CTGAAGGCCTGGTGAGAGCCAGG + Intronic
1064862430 10:19842268-19842290 CTGGAGTCATTTTGATAACCTGG + Intronic
1067765782 10:49085091-49085113 CTGGATGTCTTGTTAAACCCCGG + Intronic
1068318829 10:55383032-55383054 CTGGAGGCCAAGTTAGAACCTGG - Intronic
1071082505 10:81829166-81829188 CAGGAGGCCTTGTTAACACAAGG + Intergenic
1071905092 10:90164115-90164137 CTGGAGGCCCTGCCACAACCAGG + Intergenic
1072407411 10:95168449-95168471 CAGGGGGCCCTGAGAAAACCAGG - Intergenic
1073641352 10:105255522-105255544 CTTGGGGCCTTGTGAAACCAAGG - Intronic
1074540057 10:114357417-114357439 CTTGGGGCCTTGTTAAAGCCTGG - Intronic
1075472622 10:122704287-122704309 CTGGAGGTCTTGTGGAAATGCGG + Intergenic
1080640416 11:34155260-34155282 TTGGAGTCCTTGTGCAAACAGGG - Intronic
1084617194 11:70244412-70244434 CTTGAGCCCTTGGGAAAAGCAGG - Intergenic
1085303802 11:75473859-75473881 TTGGAGGCCTGGGGAAACCCTGG - Intronic
1087626441 11:100602510-100602532 GTGGAGGCCATCGGAAAACCTGG + Intergenic
1088195181 11:107265983-107266005 CTGAAGGACTTGTGGACACCTGG - Intergenic
1091281609 11:134384699-134384721 CTGGAGGGCTTGAGAACTCCGGG - Intronic
1091584243 12:1806841-1806863 CTGGAGGCCTAGAGATAAGCAGG + Intronic
1091643544 12:2255617-2255639 CTGGTGGCCTTCAGAAGACCAGG + Intronic
1092236899 12:6816052-6816074 CTGGAGGCCTTCTGGAAAGCTGG - Exonic
1092254518 12:6919011-6919033 CTGGAGCCCTTGGGAATACTGGG + Intronic
1093230812 12:16539644-16539666 CTGGTGGCCTTATGAAAGCAGGG - Intronic
1095273858 12:40255672-40255694 CTGGAGAGCTTGTTAAAACATGG - Intronic
1096117917 12:49066475-49066497 ATGAAGGCCATGGGAAAACCCGG - Exonic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097336798 12:58392906-58392928 CTGGAGGGCTTTTTAAAAGCCGG + Intergenic
1098950951 12:76640001-76640023 CTGGAGACCTTCTGAGAAACAGG - Intergenic
1099505437 12:83470507-83470529 CTGGTGGACTTGGGAACACCTGG + Intergenic
1100557150 12:95706875-95706897 CTGGAGGGCTTGTGAAAACTCGG + Intronic
1101061713 12:100979307-100979329 CTGGAGGGCTTTTAAAAACACGG + Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101434124 12:104650630-104650652 CTGGAGACTTTGTGAACACATGG - Intronic
1104330418 12:127839202-127839224 CTGGCTGCCTTGTGTGAACCAGG - Intergenic
1106180970 13:27369111-27369133 CTGGAGGCCTGCTGAATGCCAGG + Intergenic
1107860871 13:44660018-44660040 CTGGTGGGTCTGTGAAAACCGGG + Intergenic
1108618059 13:52155120-52155142 CTGGAGGGCTTGTTAAAACATGG - Intronic
1113081615 13:106526122-106526144 CTGCAGGGCTTGAGAAAACAGGG - Intronic
1113408311 13:110062220-110062242 CCTGAGGCCTTGGTAAAACCAGG + Intergenic
1114032498 14:18588905-18588927 CCGGGGGCCTTGTGTTAACCTGG - Intergenic
1114076191 14:19162427-19162449 CTGGGGGCCTCGTGTAAACCTGG + Intergenic
1114077280 14:19167931-19167953 CCGGGGGCCTTGTGTTAACCTGG - Intergenic
1114084885 14:19231633-19231655 CCGGGGGCCTTGTGTTAACCTGG + Intergenic
1114085968 14:19237141-19237163 CTGGGGGCCTCGTGTAAACCTGG - Intergenic
1115571697 14:34672735-34672757 CTGGTTACCTTCTGAAAACCAGG - Intergenic
1118972851 14:70652141-70652163 CTAGAAGCCTTTTGAAATCCTGG - Intronic
1119625387 14:76170001-76170023 CAGGAGGGCTTGTTAAAACATGG - Intronic
1121702286 14:95963641-95963663 CTGGGGGTCTTGTGGAAACATGG + Intergenic
1202896485 14_GL000194v1_random:13444-13466 CTGGGGGCCTTGTGTTAACCTGG + Intergenic
1202897512 14_GL000194v1_random:18765-18787 CTTGGGGCCTCGTGTAAACCTGG - Intergenic
1123797030 15:23782530-23782552 CTGGAGTCCCTGTGACAACCAGG - Intergenic
1125022053 15:34995738-34995760 CTGGTGTCCTTATGAAAAGCAGG + Intergenic
1126684471 15:51235294-51235316 CTGCAGGCTTTGTTAAAACACGG + Intronic
1127053762 15:55111554-55111576 CTGGAGGCCTTGTTAAAATGAGG - Intergenic
1127908284 15:63393708-63393730 CTGAAGGGCTTGTCAAAACATGG + Intergenic
1128256079 15:66197866-66197888 CTGGAGGCCTTGTTAAGGCGGGG - Intronic
1129825319 15:78631037-78631059 GTGGAGGCCTGGTGACAGCCAGG - Intronic
1131863885 15:96686173-96686195 TTGAAGGACTTGTGAAGACCTGG + Intergenic
1132194833 15:99906385-99906407 CTGGAGGACTTCTGAAAGACAGG + Intergenic
1132600664 16:771195-771217 CTGGAGGCCTTCTAAGAACAGGG + Intronic
1134839756 16:17392327-17392349 CAGGAAGCCATGTGAAAACTTGG - Intronic
1136375769 16:29864200-29864222 CTAAAGGCCTTGTTTAAACCTGG + Intergenic
1137678865 16:50321203-50321225 TTGGAGGCCTGGAGAAGACCCGG - Intronic
1141035778 16:80624142-80624164 CTTGAGTCCTTGTGAATACCAGG - Intronic
1141699150 16:85634519-85634541 CTGGAGGGAGTGTCAAAACCTGG - Intronic
1144231176 17:13205536-13205558 CTGGAGGCACTGTGAATTCCTGG + Intergenic
1144312227 17:14024141-14024163 CTGGGGGCCTTGTGTTCACCTGG - Intergenic
1144434710 17:15230328-15230350 CTGGAGCCCTTGCAAAAACACGG - Exonic
1144498296 17:15764328-15764350 CTGGGGGCCTTGTGTTCACCTGG - Intergenic
1145935407 17:28711989-28712011 CTGGAGGCAGGGTGAAAATCTGG - Intergenic
1146524963 17:33559109-33559131 GTAGAGGCCTTGTTAACACCTGG - Intronic
1147632528 17:41941318-41941340 CTGGGGGCCTGGAGAAAGCCAGG - Intronic
1148783866 17:50135773-50135795 CCAGAGGCTTTGGGAAAACCTGG - Intronic
1149302391 17:55317392-55317414 CTGGAGACTTTGTGAAAGTCTGG - Intronic
1151179547 17:72317065-72317087 CTAAAGGGCTTGTTAAAACCCGG + Intergenic
1151269700 17:72984631-72984653 CTGGAGGTCTTGCGGAAACACGG - Intronic
1151404608 17:73878288-73878310 CTGGAGGTATTCTGAACACCTGG + Intergenic
1151472186 17:74325449-74325471 CAGGAGGCCCTGGGAAAACTTGG - Intergenic
1153438114 18:5088281-5088303 CTGGAGGCATTATTAAAACCTGG + Intergenic
1155361347 18:25006273-25006295 CTAGAGGCCCTGTGCAAAGCAGG - Intergenic
1155409947 18:25532957-25532979 CTGGAGGACTTGCTAAAACATGG + Intergenic
1156355389 18:36335906-36335928 CATGAGGCTGTGTGAAAACCGGG + Intronic
1157315999 18:46590244-46590266 CAGGAGGGCTTGTTAAAACACGG - Intronic
1158015032 18:52774235-52774257 CTGAAGGGCTTGTTAAAACATGG - Intronic
1159616899 18:70591569-70591591 CTGGAGGACTAGTGAATGCCAGG + Intergenic
1160384920 18:78490472-78490494 CTAGAAGCCATGTGTAAACCTGG - Intergenic
1164697758 19:30259509-30259531 CTAGAGGACTTGTTAAAACATGG - Intronic
1165779679 19:38425238-38425260 CTGGAGGGCTTGTAAAATACAGG - Intronic
1165847146 19:38825547-38825569 TTGGAGGCATTATCAAAACCTGG + Intronic
1166357169 19:42234020-42234042 CTGGAGACCTTGGGGGAACCGGG - Intronic
1167143784 19:47670477-47670499 CTGGGGGCCCTGTGTAGACCTGG + Exonic
925085491 2:1104665-1104687 GTGCTGGCATTGTGAAAACCTGG + Intronic
927995773 2:27484787-27484809 CAGGAGGCCCTGTGAGATCCTGG - Intronic
929173517 2:38955267-38955289 CTGCAGGACTTGTGATATCCTGG + Intronic
931373777 2:61689019-61689041 GTGGAGGCTTAGTGAAGACCTGG - Intergenic
932414007 2:71563030-71563052 TTGGAGGGCTTGTGAAAAGCAGG + Intronic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
935333520 2:101994738-101994760 CTGAAGGCCTTGTGAATATGTGG + Intronic
939722207 2:145667878-145667900 CTGGAGGACCTGGGAAAAACGGG - Intergenic
941693369 2:168525222-168525244 CTGGAGGGCTTGTTAAACCCAGG + Intronic
941739584 2:169019499-169019521 CTGTAGGACTTGTGTATACCTGG - Intronic
942393848 2:175525070-175525092 TTGGAGGACTTGTTAAAACATGG + Intergenic
944960725 2:204869892-204869914 CTGCAGCCATTGTGAAAACAAGG - Intronic
1170174623 20:13454794-13454816 CTGGAGGCCTTGTTTATCCCTGG + Intronic
1170464957 20:16614060-16614082 CTGGGGGGCTTGTTAAAACCCGG + Intergenic
1171770644 20:29320041-29320063 CTCGAGACCCCGTGAAAACCAGG + Intergenic
1173779487 20:45742813-45742835 CTGGAGAACTTGCGCAAACCAGG + Intergenic
1176057690 20:63157420-63157442 CTGGAGGTCTTGTGAAAATGTGG - Intergenic
1176616171 21:9029440-9029462 CTGGGGGCCTTGTGTTAACCTGG + Intergenic
1176617198 21:9034754-9034776 CTTGGGGCCTCGTGTAAACCTGG - Intergenic
1176707948 21:10128917-10128939 CTGGGGGCCTCGTGTAAACCTGG + Intergenic
1176726589 21:10440657-10440679 GTGGAGGCCAAGTGAAAAGCAGG - Intergenic
1180287795 22:10766428-10766450 GTGGAGGCCAAGTGAAAAGCAGG + Intergenic
1180291999 22:10856052-10856074 CTGGGGGCCTCGTGTAAACCTGG + Intergenic
1180293085 22:10861560-10861582 CCGGGGGCCTTGTGTTAACCTGG - Intergenic
1180456609 22:15515962-15515984 CCGGGGGCCTTGTGTTAACCTGG - Intergenic
1180494803 22:15885474-15885496 CTGGGGGCCTCGTGTAAACCTGG + Intergenic
1180495890 22:15890982-15891004 CCGGGGGCCTTGTGTTAACCTGG - Intergenic
1180940824 22:19658687-19658709 CTGGGGGCCTTGTGTCCACCTGG - Intergenic
1181169022 22:20997971-20997993 CTTCAGCCCCTGTGAAAACCAGG - Exonic
1181458828 22:23074321-23074343 CTGGAGGCCCTGAGAAATGCAGG + Intronic
1181536588 22:23549422-23549444 CTGGAGGCCAGGGGAAAACCAGG - Intergenic
1183093092 22:35536735-35536757 CAGGAGGGCTGGTTAAAACCAGG + Intergenic
1183716462 22:39536044-39536066 GCCGAGGCCTTGTGGAAACCGGG - Intergenic
1184727174 22:46353933-46353955 CTGGAGGCCTTCTCAAGCCCTGG - Intronic
1184775460 22:46620794-46620816 GTGGAGGCCTCCTGAGAACCTGG + Intronic
949300752 3:2581161-2581183 TTGGAGGCCTTGTTAAAACAAGG - Intronic
949419768 3:3853413-3853435 CTGGAGGCCTTCTGATAAAAGGG + Intronic
949462032 3:4303761-4303783 CCGGAGGCCTTGTGAGAACCTGG + Intronic
949478111 3:4467772-4467794 CTGGAGAGCTTGTGAAACCCTGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
953375258 3:42422894-42422916 GAGGAGGGCTTGTGAAAACACGG + Intergenic
956312065 3:67892373-67892395 CTGAGGGCCTTCTGAAAGCCAGG + Intergenic
956678806 3:71759129-71759151 CTGTAGGCCTTGGGAAAACAGGG - Intergenic
956998100 3:74851200-74851222 CTGGAGGTCTTGTTAAAACACGG + Intergenic
958843432 3:99236666-99236688 CAGGAAGCCATGTGAAAATCTGG + Intergenic
959945384 3:112120276-112120298 CTGGAGCCCTTGTGGAATCCTGG + Intronic
960059887 3:113310190-113310212 GTGGAGGCCATGTGATAGCCTGG + Intronic
961383389 3:126510218-126510240 CTGGAGGCCTTGTGGGAACATGG - Intronic
964452943 3:156829620-156829642 GTGGAGCCCTAGTGAAAAGCAGG + Intronic
964557869 3:157960650-157960672 CTGGAGTCCTTGTTAACAGCTGG - Intergenic
965044437 3:163557490-163557512 CTGGTGGCCTTAAGAAAAACGGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966699809 3:182835813-182835835 CTAGAGGTCCTGTGAAAGCCAGG + Intronic
966816414 3:183893408-183893430 CTTCAGGCTTTGTGAAATCCTGG - Intergenic
967016431 3:185486457-185486479 CTGCCTGCCTTGTGATAACCGGG + Exonic
967072368 3:185973044-185973066 CAGGAGTCCTTGTTAAAACTAGG - Intergenic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
969605606 4:8200841-8200863 CAGGAGGCCATGTGACCACCAGG - Intronic
971531550 4:27695043-27695065 CTGGAGGCCTTGTGGAGATTTGG + Intergenic
971778437 4:30998626-30998648 CGTGAGGACTTGTGAAAACATGG - Intronic
976152472 4:82105974-82105996 CTGGAGAACTTGTGCAAATCAGG + Intergenic
976638684 4:87313889-87313911 CTTCAGGCCTTGGGAAAAACTGG - Exonic
977466884 4:97393659-97393681 CTGGAGGGCTTGTTAAAACATGG - Intronic
980043709 4:127965897-127965919 CTGGAGGGCTTGTCAGAGCCAGG + Exonic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
984549978 4:181148161-181148183 CTGGGGGCATTGTGAAAATACGG - Intergenic
986613780 5:9596173-9596195 CTGGAGTCCTGGTGTGAACCGGG - Intergenic
986749385 5:10772913-10772935 CAGGAGGGCTTATGAAAACATGG - Intergenic
988555546 5:32232880-32232902 CTGGAGGGCTTCAGAAAGCCTGG - Intronic
988585853 5:32507006-32507028 ATGGAGGGCTTGTTAAAACCAGG + Intergenic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990101413 5:52193807-52193829 CTGGAGGCTTTGTGAAATCTTGG - Intergenic
990621818 5:57568009-57568031 CAGGATGCCTTGTGAGAAGCAGG - Intergenic
992699663 5:79329408-79329430 CTGGAGGAATTGTGAAAGACGGG - Intergenic
993004249 5:82413428-82413450 CAGGAGGCCTTGGAAACACCTGG - Intergenic
993189272 5:84660532-84660554 CTGGAGCCCTAGAGAAAGCCAGG - Intergenic
995417358 5:111925758-111925780 CTGGAGGGCCTATGAAAAACTGG - Intronic
995433236 5:112105704-112105726 CTGGAGGCCCTCTGAGAAGCTGG - Intergenic
997362946 5:133306634-133306656 CAGGGGGCCTTGAGAAAACAGGG - Intronic
999435896 5:151563138-151563160 CTGCATGTCTTGTGAAAACACGG + Intronic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
999714674 5:154350897-154350919 CAGGAGGGCTCGTTAAAACCTGG + Intronic
1000964616 5:167641048-167641070 CTGGAGGGCTTGATAAAACACGG - Intronic
1003945722 6:11073565-11073587 CTGGGGATCTTGTGAAAACACGG + Intergenic
1004671180 6:17798672-17798694 CAGCAGTCCTTGTGAAAGCCAGG + Intronic
1005136883 6:22579331-22579353 GTAGAGGCCTTGTGAAGTCCTGG + Intergenic
1008045285 6:46845343-46845365 GTGGTGGCCTTGGGAAAAGCAGG + Intergenic
1008384734 6:50875840-50875862 CTGGATGCCTTGGAAACACCTGG + Intergenic
1010204088 6:73307811-73307833 CTGGAGGTCTTCTTAAAACACGG + Intronic
1010445068 6:75940259-75940281 CTGGAGGCCAAGGGAAAGCCAGG - Intronic
1011762050 6:90577813-90577835 CTGGAGGGCTTGGTAAAACATGG - Intronic
1014888608 6:126814024-126814046 CTGCAGGCATTGTGGGAACCAGG + Intergenic
1015555150 6:134453542-134453564 CTGGATGGCTTGTTAAAACCAGG + Intergenic
1016761148 6:147738985-147739007 CTGGAGCCTGTGAGAAAACCCGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1016920285 6:149285807-149285829 CTGGAGGACTTGTTAAAACATGG + Intronic
1017359660 6:153552855-153552877 CTGGAAAACTTGTGAAAACTCGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018717392 6:166544035-166544057 CTGGAGGCCAGGTGACAACCTGG - Intronic
1019334478 7:476502-476524 CTGGGGCCCTTGAGAACACCTGG - Intergenic
1019382640 7:732419-732441 CTGCAGGCCTGGCGACAACCAGG - Intronic
1020194075 7:6023634-6023656 GATGAGGTCTTGTGAAAACCTGG + Exonic
1021044540 7:15906563-15906585 CAAGAGGCCTAGTGAGAACCAGG - Intergenic
1021196824 7:17683056-17683078 CTGGAGGGCTGGTTAAAACACGG + Intergenic
1021609728 7:22445448-22445470 CCGGCAGCCTTGTGAGAACCGGG + Intronic
1021968211 7:25942970-25942992 CTGGAGGTCTTGAAAAAACAAGG + Intergenic
1022127426 7:27371943-27371965 CTGGAGGGCTTGTGACACACAGG - Intergenic
1022687999 7:32614599-32614621 TTGGAGGCCTTTTGAATAGCTGG - Intergenic
1023212220 7:37818749-37818771 ATGGAGGCCTTGGGAAAAGAAGG - Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026613043 7:71877950-71877972 CTGGAGGACTTGTTAAAACACGG + Intronic
1026825464 7:73578696-73578718 CTGAAGGCGTTGTAACAACCAGG - Exonic
1026881157 7:73907706-73907728 CTGGAGCCCTTTTGAGGACCAGG - Intergenic
1027882805 7:83863425-83863447 AAGGAGGCCTTCTGCAAACCAGG + Intergenic
1028775135 7:94667120-94667142 CTGGAAGCTTTGTGCTAACCTGG + Exonic
1028853007 7:95557754-95557776 ATGGAGGCCATGTCAAAGCCTGG + Intergenic
1028884041 7:95911662-95911684 CTGGGGGGCTTGTTCAAACCAGG + Intronic
1029310695 7:99660850-99660872 ATGTAGACCTTGGGAAAACCTGG - Intronic
1032251660 7:130262748-130262770 CTGGAGCCTTTGTGAGAGCCTGG - Intergenic
1033220095 7:139522161-139522183 CTTGAGGCCTTGTAAAAAGATGG + Intergenic
1033274541 7:139961452-139961474 CTGGAGGAGGTGGGAAAACCAGG - Intronic
1034603519 7:152287294-152287316 GTGGAGGCCAAGTGAAAAGCAGG + Intronic
1035777902 8:2203589-2203611 CAGGTGGCCTTGTGACCACCTGG + Intergenic
1036694673 8:10966776-10966798 CTGGAGGGTTTGTTAAAACCTGG - Intronic
1036914021 8:12786820-12786842 CTGGAGGCCTTGTTGAAACAAGG - Intergenic
1037823106 8:22145111-22145133 CTGGAGGACAAATGAAAACCTGG + Intergenic
1041303458 8:56436931-56436953 CAGCAGGACTTGTGAAAGCCTGG - Intronic
1042482712 8:69322370-69322392 CTGGAGACCTAGAGAAAAGCTGG + Intergenic
1044913001 8:97081705-97081727 CTGGGGGCCTTCTGAAAACATGG - Intronic
1045551726 8:103179174-103179196 CTGGAGGCATTGAGAGATCCTGG - Intronic
1045562793 8:103282069-103282091 CTGGAGGCCTTCTGACATACAGG - Intergenic
1045754704 8:105528948-105528970 CTGTAGGGCTTCTGAAAACAAGG + Intronic
1046728812 8:117703432-117703454 CTGCAGCCCTTGTCAATACCAGG - Intergenic
1046766712 8:118077226-118077248 CTGGAAGGCTTGAGAATACCTGG - Intronic
1049629213 8:143643244-143643266 CTGGAGGCCCTGGGGAAAACTGG - Intronic
1049687451 8:143944610-143944632 TTGAAAGCCTTGTGAAATCCTGG - Intronic
1050270305 9:3937074-3937096 CTGAAGGCCTTCTGACAACCCGG + Exonic
1050489683 9:6175161-6175183 CTGGAGGCCTTTGGTAAGCCAGG + Intergenic
1050531356 9:6592393-6592415 CTCGAAGCCTTGTGAAACCTGGG - Intronic
1051669065 9:19492487-19492509 CTGGAGGGCTTGTCAAAGCACGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053645960 9:40119816-40119838 CTGGGGGCCTTGTGTTAACCTGG - Intergenic
1053759756 9:41343724-41343746 CTGGGGGCCTTGTGTTAACCTGG + Intergenic
1053760838 9:41349199-41349221 CTGGGGGCCTCGTGTAAACCTGG - Intergenic
1054326971 9:63717713-63717735 CTGGGGGCCTTGTGTTAACCTGG - Intergenic
1054538610 9:66256160-66256182 CTGGGGGCCTTGTGTTAACCTGG + Intergenic
1054764563 9:69032774-69032796 CTGGAGGTCTTGTTAAACCATGG + Intergenic
1054779741 9:69155448-69155470 CTGGAGGGCGTGTTAAAACACGG + Intronic
1054916073 9:70496501-70496523 CTGGAGTCCTTGTCAACACCAGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057514760 9:95711751-95711773 CTGGAGGCCGTGGAAATACCAGG - Intergenic
1057807374 9:98229226-98229248 CTGGAGGGCTTGTTAAAATGCGG + Intronic
1059263715 9:113005849-113005871 CTGGATGCATAGTGAATACCAGG - Intergenic
1059393345 9:114014723-114014745 CTGGAGGGCTTGTTAAAACATGG + Intronic
1059693448 9:116708466-116708488 CTGCAGGCTGTGTGAAGACCTGG - Intronic
1202792693 9_KI270719v1_random:97797-97819 CTGGGGGCCTCGTGTAAACCTGG + Intergenic
1186716065 X:12252950-12252972 CTGGAGGGCTTGGGACCACCAGG + Intronic
1187613367 X:20966969-20966991 ATGGTGTCCTTGTGAAAACTTGG - Intergenic
1189732096 X:44032182-44032204 CTGGAGGGCTTATTAAAACAGGG - Intergenic
1193726171 X:85041706-85041728 CTGGAGGCCTTGGGAATAGAGGG + Intronic
1195432005 X:104799386-104799408 CTGGAGGCCTTGTGAAAACCTGG + Intronic
1198103409 X:133440898-133440920 CTGGAGGCCACGTGACGACCAGG + Intergenic
1198132512 X:133711468-133711490 CTGAAGGGCTTGTTAAAAGCTGG - Intronic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1198532936 X:137563421-137563443 CTGGGGGCTTTGTGAACAGCAGG - Intergenic
1200089772 X:153629010-153629032 CAGGAGGCCGTGTGAGAGCCTGG + Intergenic
1201150588 Y:11093587-11093609 CTGGGGGCCTCGTGTAAACCTGG - Intergenic