ID: 1195432311

View in Genome Browser
Species Human (GRCh38)
Location X:104803082-104803104
Sequence CTGCTGTTGGGGAGGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 739
Summary {0: 1, 1: 1, 2: 1, 3: 82, 4: 654}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195432311 Original CRISPR CTGCTGTTGGGGAGGAAGAA AGG Intronic
901069178 1:6508792-6508814 CTGCTATTGGGGATGAAGTGTGG - Intronic
901110562 1:6790258-6790280 CTCCTGCTGAGGAGGAAAAAAGG - Intronic
901174064 1:7285747-7285769 CTGCTTTTGGGGTGAAAGTAGGG + Intronic
901242083 1:7701321-7701343 CTGTTGCAGAGGAGGAAGAAGGG - Intronic
903026811 1:20435247-20435269 CTGAGGTTGGAGAGCAAGAATGG + Intergenic
904031465 1:27536092-27536114 CTGGTGTGGGGGAGGACGGATGG - Intronic
904489460 1:30849532-30849554 CTGCTGTTCGAGAGGCAGGAAGG - Intergenic
905497481 1:38403950-38403972 CTGCTTTTGTGGAGGTAGCAGGG - Intergenic
905514824 1:38554784-38554806 CTGCTGGTGGGGATGTAAAATGG + Intergenic
905524055 1:38623433-38623455 CTGAGGTGGGAGAGGAAGAACGG - Intergenic
906100429 1:43256948-43256970 CAGCTGGTGAGGAGGAAGTATGG + Intronic
906609312 1:47190854-47190876 CTGCTGTGGGGGACAAAGGACGG + Intronic
906969931 1:50501737-50501759 CTGCTGTTGGGAACGTAAAATGG + Intronic
907023625 1:51094152-51094174 CTGCTGTAGGGGATGAGGAAGGG - Intergenic
907114913 1:51959980-51960002 ATGGGGTTGGGGAGGCAGAAAGG + Intronic
907308201 1:53525276-53525298 CTGCAGATGGGGAGGAGGAGAGG + Intronic
907405846 1:54252946-54252968 CTGCTGTGGGGGAGGCTGAGTGG + Intronic
908201505 1:61800726-61800748 CTGTTGTGGGGTGGGAAGAAGGG - Intronic
908312652 1:62900852-62900874 ATGCTGAAGGGGTGGAAGAAGGG + Intergenic
908785335 1:67729755-67729777 CTGCCACTGGGGAGGGAGAATGG - Intronic
909094654 1:71271774-71271796 CTCCTGAGGGGAAGGAAGAAAGG - Intergenic
909392395 1:75132483-75132505 CTGGGCTTGGGGAAGAAGAATGG - Intronic
910804058 1:91173135-91173157 CTGCAGTAGAGCAGGAAGAAGGG - Intergenic
912712569 1:111960485-111960507 CTGCTGTGGGGAAGGGAGGAAGG - Intronic
912910267 1:113751813-113751835 CTGCTGTTGGGCATGGAAAATGG - Intronic
912978960 1:114353423-114353445 CAGCTGTGGGGGAGGAGGGAGGG + Intergenic
913223600 1:116679431-116679453 CTGCGGTGGGTGAGGATGAAAGG - Intergenic
913319302 1:117577287-117577309 TTGCTGTTGGGAAGGAGGAAGGG - Intergenic
913377627 1:118171255-118171277 TTACTGTTAAGGAGGAAGAATGG + Intronic
913377658 1:118171835-118171857 TTACTGTTAAGGAGGAAGAATGG + Intronic
913425872 1:118728859-118728881 CTGCTGGTGGGAAAGTAGAATGG + Intergenic
914778164 1:150757785-150757807 TTGCTTTTGGGGAGACAGAAAGG + Intronic
914889328 1:151608849-151608871 TTGCTGCTGGGGAGGGAGACTGG - Intergenic
914973913 1:152339977-152339999 CTGCTGATGGAAAGGGAGAATGG + Intergenic
915144344 1:153786512-153786534 CTGCTGGTGGGAATGTAGAATGG - Intergenic
916101656 1:161398354-161398376 CTGCTGTTGGGAATGTAAAATGG - Intergenic
916107423 1:161441766-161441788 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916109008 1:161449184-161449206 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916110595 1:161456565-161456587 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916112181 1:161463975-161463997 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916113768 1:161471356-161471378 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916544963 1:165795315-165795337 CTGCCTTTGGGGAGGAACAATGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917851590 1:179069211-179069233 GTGGTGTTGGGGAGGCAGAGAGG - Intronic
918013649 1:180611213-180611235 CTGCTGTTGCTGGGGAAGAAAGG - Intergenic
919991041 1:202709020-202709042 CAGCAGTAGGGGAGGGAGAAGGG + Intronic
920084960 1:203408685-203408707 CTGATGTGGGGAGGGAAGAAGGG + Intergenic
920750053 1:208665560-208665582 CTCTTGCTGGGGATGAAGAAAGG + Intergenic
921114523 1:212075879-212075901 CAGGTGTTGGGGAGGAAGAGGGG - Intronic
922244615 1:223783392-223783414 CTGCTGTTGGTGAGGAAGTAAGG - Intronic
922313457 1:224418968-224418990 GTGCAGTTGGGGAGGTATAAGGG - Intronic
922413873 1:225401669-225401691 AAGCTTTTGGGGAGGAAGGAAGG - Exonic
922769135 1:228172735-228172757 CTGCTGGTGGGGAGGCAAAACGG - Intronic
923649838 1:235864178-235864200 CTGCAGTAGGGGAGGGAGACTGG - Intronic
924277248 1:242401203-242401225 CTGCTGATGGGGACCAATAATGG - Intronic
924329089 1:242924451-242924473 CTGCTGCTGGTGAGGGAGGAAGG + Intergenic
1062972862 10:1661891-1661913 CTGCTGCTGGGGAGGGAAAGGGG + Intronic
1063006217 10:1973001-1973023 CTGCTGTGGGGGAAGAATAATGG + Intergenic
1063021437 10:2132909-2132931 CTGCTGATGAGAAGGAAAAATGG + Intergenic
1063502026 10:6563842-6563864 GTGCAGTTGGGGAGGGAGGAAGG + Intronic
1063659424 10:8023708-8023730 ATGCAGTTGGTGAGGAAGTATGG - Intergenic
1063932468 10:11043106-11043128 CTGCTGGTGGGAAGGTAAAATGG - Intronic
1064376571 10:14801869-14801891 CTGCACCTGGGAAGGAAGAAGGG + Intergenic
1064711402 10:18130099-18130121 CTGCTGTTGGGAATGTAAAATGG - Intergenic
1064806027 10:19134194-19134216 ATGGTGCTGGGGAGCAAGAAAGG - Intronic
1065688347 10:28308081-28308103 CTCCTGTTGCAGGGGAAGAAGGG + Intronic
1066697980 10:38095212-38095234 CAGCTGTTGTGGGGTAAGAAGGG + Intronic
1066750571 10:38652168-38652190 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1066966479 10:42270944-42270966 CTGCTTTTGGTGAAGAAAAAAGG - Intergenic
1067221553 10:44347668-44347690 GTGCTGTTAGGGAGGGGGAATGG + Intergenic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067464953 10:46490906-46490928 CTGGTGGTGGGGAGGAAAGATGG - Intergenic
1067622236 10:47893695-47893717 CTGGTGGTGGGGAGGAAAGATGG + Intergenic
1067790676 10:49285056-49285078 CTGCTGGTGGGGATGAAAAATGG + Intergenic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1068229267 10:54149927-54149949 GTGGAGTTGGGGAGGAAGAGGGG + Intronic
1068444926 10:57108700-57108722 CTGCTGCTGGGAAGGAACAGGGG - Intergenic
1069024851 10:63528513-63528535 CTGCTGTTGAGGAGGGACAAGGG - Intronic
1069920403 10:71812457-71812479 CTGCAGTTGGGGAGGGAAAAGGG - Intronic
1070218884 10:74419189-74419211 CTGTTGTTGGGGAGGAAGAATGG - Intronic
1070350109 10:75583663-75583685 CTGATGGTGGGCAGGAGGAAAGG - Intronic
1070688261 10:78505941-78505963 CTGCTTGTGGGGATGTAGAATGG + Intergenic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1071086944 10:81875674-81875696 CTGGGCTTGGAGAGGAAGAAGGG - Exonic
1072197961 10:93132829-93132851 CTGCTCTTGGGTAGGGAGGAGGG + Intergenic
1072320401 10:94244158-94244180 CTGCTGTTTGAAAGCAAGAATGG + Intronic
1072380729 10:94867120-94867142 CTGCCGTTGGGTGGGAAGCAAGG - Intergenic
1072407450 10:95168542-95168564 CTGCAGTTGGGGAGGGGGAGGGG + Intergenic
1072652875 10:97309370-97309392 CAGCTGCTGGGGAGGCTGAAGGG - Intergenic
1073064162 10:100748624-100748646 CTGCTGTAGGCCAGGGAGAATGG + Intronic
1073208676 10:101781751-101781773 CTGCTTTTTGGCAGGAAGGATGG + Exonic
1073539253 10:104305071-104305093 CTGCAGTTGGGGAGGGAGATTGG + Intergenic
1073727740 10:106253833-106253855 GTGCTGTTGGGGAAGATAAAAGG - Intergenic
1073944195 10:108731252-108731274 CTCCTGTCGGGAAGCAAGAAGGG + Intergenic
1074476131 10:113776118-113776140 CTCCTCTAAGGGAGGAAGAAGGG + Intronic
1074910968 10:117908486-117908508 CTGCTTATGGGGAGGGAGGAAGG - Intergenic
1075262468 10:120975195-120975217 CTGCGGGTGGGAAGGTAGAATGG + Intergenic
1076047022 10:127302254-127302276 CACCTGTTGGGGAGGTAGGAAGG + Intronic
1076452236 10:130564856-130564878 CAGCTGTTGGGGAGGGAAACGGG - Intergenic
1077238808 11:1499795-1499817 CTGCTGGTGGGGATGCAAAATGG + Intronic
1078134439 11:8640509-8640531 CTGCTGTGGGGGAGGGGGAAGGG + Exonic
1078181154 11:9012278-9012300 CTGCTGGTGGAGATGCAGAATGG - Intergenic
1078638002 11:13069679-13069701 CAGGGGGTGGGGAGGAAGAAAGG + Intergenic
1078908370 11:15708305-15708327 CTGCTGCTGCAGAGGAAGTAAGG - Intergenic
1079041350 11:17063233-17063255 CTGCTGGTGGGGAGGAAATGAGG - Intergenic
1079118518 11:17657220-17657242 CTGCTGTTGGGAATGTAAAATGG + Intergenic
1080220883 11:29902060-29902082 TTGCTGTTGGGTGGGAAGATGGG - Intergenic
1080793442 11:35541372-35541394 GTGGTGTTGGGGAGGAACCAAGG - Intergenic
1081137738 11:39459938-39459960 CTGCTGTTGTGGAGAACCAATGG - Intergenic
1081751094 11:45511851-45511873 CTGCTGCTGGGGAGGCAGCCAGG - Intergenic
1081807469 11:45898396-45898418 CTGCTGTCGGGGACTAAGACAGG + Intronic
1081830327 11:46105593-46105615 ATGGTGTTTGGGAAGAAGAAGGG - Intronic
1082683230 11:56205617-56205639 CAGCAGGTGGGGAGGATGAAAGG - Intergenic
1083542938 11:63527165-63527187 CTGCTGTGGGGTGGGGAGAAGGG + Intergenic
1083854842 11:65387842-65387864 AGGCTGTTTGGGAGAAAGAAAGG - Intronic
1084112300 11:67022325-67022347 CTGGGGTGGGGGAGGAAGAGGGG - Intronic
1084324718 11:68393415-68393437 CTGCCGGTGGGGATGCAGAACGG - Intronic
1084364738 11:68690239-68690261 CTGGTGGTGGGGAGGAGGGATGG + Intronic
1085084842 11:73660334-73660356 CAGGGGTTGGGGAGGAAGGAAGG - Intronic
1085277068 11:75307141-75307163 CTGCTGTGGGGCAGGGAGGAAGG - Intronic
1085393013 11:76192044-76192066 CAGCTGAGGGGCAGGAAGAAAGG + Intronic
1086096255 11:83052783-83052805 CCTTTGTTGGGGAGGGAGAAGGG + Intronic
1087997587 11:104829421-104829443 CTACTGGTGGGAAGGAAGAGAGG + Intergenic
1088059165 11:105624709-105624731 ATGTTTTTGGGGAGGAAAAAAGG - Intronic
1088397126 11:109381472-109381494 GTGGTGTTGGGGAGCAAGAAAGG + Intergenic
1089283037 11:117387649-117387671 GTTCTGTTGGTAAGGAAGAAAGG + Intronic
1089344712 11:117783817-117783839 ATGCGGTTGGGGTGGAGGAAGGG - Intronic
1089679093 11:120109574-120109596 CTCCTATTAGGGAGGAAGGAGGG - Intergenic
1089982843 11:122786776-122786798 CTGCTTTTGGTGAGTGAGAAAGG + Intronic
1090005520 11:122998943-122998965 CTGCTGTTGTGGTGGGAGCAGGG - Intergenic
1090221065 11:125026413-125026435 CTTCTGTTGGGGAATGAGAAAGG + Intronic
1090466098 11:126935259-126935281 CTGCTGCTGGGAAGGCAAAATGG + Intronic
1090522155 11:127490774-127490796 CAGATGTTGGGGAGGAGGAGGGG - Intergenic
1090571865 11:128056029-128056051 CTGCTGTTGGGGATGCTGAATGG - Intergenic
1090841084 11:130487850-130487872 CTGGAGTTGGGCAGGCAGAATGG - Intergenic
1090980500 11:131716467-131716489 CTGCTGGTGGGAATGAAAAATGG - Intronic
1091294080 11:134460278-134460300 CTGGGGGTGGGGAGGAACAAAGG + Intergenic
1091303534 11:134523144-134523166 CTGCTGCTGGGGAGGTGGGAAGG - Intergenic
1091490684 12:929972-929994 CTGCTGTGGGTGAGGAGGTAAGG - Intronic
1091977983 12:4842063-4842085 CTGCTGATGAGGAGGAGGAGTGG + Intronic
1092109177 12:5946689-5946711 CTGCTGGAGGGAAAGAAGAAAGG - Intergenic
1092147260 12:6223221-6223243 CTGGGGTTGGGGTGGAAGGAGGG + Intronic
1092587246 12:9912107-9912129 CTGCTGATGGGGTAGAAGAAGGG + Intronic
1093136179 12:15454174-15454196 CTGTTGTTGGGAATGAAAAATGG - Intronic
1093538084 12:20247207-20247229 CTGCTGCTGGGGAAAGAGAAAGG - Intergenic
1093654237 12:21676634-21676656 TTGCTTCTGGGGAGGAAGAAAGG + Intronic
1094766117 12:33596553-33596575 CTGCGGTTGGGGAGGAGAAAGGG + Intergenic
1096039920 12:48506075-48506097 CTGCTGGTGGGGATGCAAAATGG + Intergenic
1096807308 12:54148655-54148677 ATACTGTTGGGGAGGGAGAATGG - Intergenic
1096884458 12:54702290-54702312 TTGCTGCTGGGGTGGAAGAGGGG + Intergenic
1097068307 12:56336881-56336903 CAGGAGTTGGGTAGGAAGAAGGG - Intronic
1097244825 12:57601817-57601839 CTTCTCATGGGGAGGAAGAGAGG - Exonic
1097383280 12:58920400-58920422 CTGCTGTTTGGGGGCATGAAAGG - Exonic
1099941605 12:89195633-89195655 GTGTTGTGGGGGAGGAGGAAGGG - Intergenic
1101248873 12:102911703-102911725 CTGTGGGTGGGGAGGAAGATGGG - Intronic
1101807324 12:108075764-108075786 CTGCTGTTGGGAAAGAGGACAGG + Intergenic
1101917713 12:108908861-108908883 CTGCTGTAGGGCTGGAAGGAAGG - Intergenic
1102244696 12:111347940-111347962 CTCCTGTTGGGGATGAAGTGAGG - Exonic
1102249641 12:111377666-111377688 CTGCTGATGGGAAGGTAGAATGG + Intergenic
1102970457 12:117162068-117162090 CAGCTCTTGGGGAGGAGGAAAGG + Intronic
1103549430 12:121726089-121726111 TTGCTGTGGGTTAGGAAGAAGGG + Intronic
1103875630 12:124125035-124125057 GTGCTTTTGGGGAGGGAGACAGG + Intronic
1104853223 12:131888742-131888764 CTGCTGTTGGGAAGGTAACATGG + Intergenic
1104905556 12:132211823-132211845 CTGCTGTTGGGGACCAAGTTTGG - Intronic
1105444520 13:20441136-20441158 GTGCTGTAGGGGAGGAGGTAGGG + Intronic
1106082242 13:26510194-26510216 GTGGGGTTGGGGAAGAAGAAGGG + Intergenic
1106241574 13:27917737-27917759 CGGCTGTGGGGGAGGAGGAGGGG - Intergenic
1107389715 13:39951447-39951469 CAGCTGTGGGGGAGGAGGGAGGG + Intergenic
1107445205 13:40464441-40464463 CTGCTGCTGGGAATGGAGAATGG - Intergenic
1108226251 13:48292860-48292882 CTGCTGATGGGAATCAAGAAAGG + Intergenic
1109578534 13:64294640-64294662 GTGCTGTTGGGAAGGTAGAATGG + Intergenic
1109742280 13:66569768-66569790 ATGCTGGTGAGGAGGAAGACAGG + Intronic
1110361285 13:74628622-74628644 ATGCAGTTGTGGAGGCAGAATGG + Intergenic
1110499696 13:76212868-76212890 CTGTTTTTGTGGATGAAGAATGG - Intergenic
1111492514 13:89000337-89000359 CTGAGGGTTGGGAGGAAGAAGGG - Intergenic
1111682008 13:91454711-91454733 CTACTGTTAGGGAAGAAGAAAGG - Intronic
1111693280 13:91592329-91592351 CTGTTGTGAGGGAGGAAGAGAGG + Intronic
1112244752 13:97721877-97721899 CTGCTGGTGGGGACGTAAAATGG + Intergenic
1112641068 13:101275653-101275675 CTGTAGCTGGGGAGGAAGAAGGG + Intronic
1113043362 13:106127914-106127936 TATCTGTTGGGGAGGAAGAAAGG - Intergenic
1114858850 14:26490441-26490463 CTGTTGTTGGGGATGTAAAATGG - Intronic
1116003669 14:39270061-39270083 CTGCTGGTGGGGATGTAAAATGG - Intronic
1117025567 14:51616547-51616569 CTGCTGCTGAGGAGGAAAAAAGG - Intronic
1117202681 14:53408441-53408463 CTGCTGTGGGGGAGGGAGGCAGG - Intergenic
1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1118364716 14:65084887-65084909 CAGCTTTTGGGGAGAAAAAAAGG + Intronic
1119220291 14:72900972-72900994 CTGGTGTTAGTGAGGGAGAAGGG - Intergenic
1120508117 14:85378582-85378604 GTGCTGTGGGCGAGGAGGAATGG - Intergenic
1121209836 14:92199963-92199985 CTGCTGGGGGAGAGGAAGAAGGG - Intergenic
1121331733 14:93053870-93053892 CTGATGTTTGGGAGGTAGACGGG + Intronic
1122048071 14:99037456-99037478 TTTCTGTTTGGGAGGACGAAAGG + Intergenic
1122432815 14:101666655-101666677 ATTCTGTTTGGGAGGAGGAATGG - Intergenic
1124070735 15:26390940-26390962 CTGCGGTTGGGAAGGAATATTGG - Intergenic
1124705894 15:31963775-31963797 CTGATGTTGGGGAGGAGGATTGG + Intergenic
1125721506 15:41847317-41847339 CTGCTGCAGGGCAGGCAGAAGGG - Exonic
1126249842 15:46554607-46554629 CTGCTTTTTGGGAGGTAGCAAGG + Intergenic
1126343607 15:47670036-47670058 CTCCAGTTGGAGAAGAAGAAAGG - Intronic
1126678545 15:51182773-51182795 CTTTTGTTGGTGAGGAAGAAAGG + Intergenic
1126863548 15:52912557-52912579 CTGGTGTTGGGGAGGTGGAATGG + Intergenic
1126898354 15:53284776-53284798 CTGCCTTTGGGGAGAAAGAAGGG - Intergenic
1127012281 15:54643678-54643700 CTGCTGCTGGGGATGGAGAAGGG - Intergenic
1127163070 15:56211918-56211940 CTGCTGGTGGGGATGCAAAATGG + Intronic
1127303143 15:57677229-57677251 GTTGTTTTGGGGAGGAAGAAGGG - Intronic
1127409461 15:58691385-58691407 CTGCTTTTGTGGAGCAAGAGTGG - Intronic
1127608475 15:60614290-60614312 CTGCTGGGGAGGAGGAAGGAAGG + Intronic
1129264307 15:74385810-74385832 CTTCTGTGGGGGAGGGGGAAGGG - Intergenic
1129386693 15:75200452-75200474 CTGCTAGTGGGGTGGAAGGAGGG - Intronic
1130099710 15:80883671-80883693 CTGCTCTAGGGGTGGGAGAAGGG + Intronic
1130112786 15:80979789-80979811 CTGCTGCTGGGGAGGTAAAGAGG + Intronic
1130247850 15:82269597-82269619 GTGGACTTGGGGAGGAAGAAAGG + Intronic
1130543404 15:84838308-84838330 CTGCAGTTGAGGAAGTAGAATGG + Intronic
1131255513 15:90859497-90859519 GTCCTGGTGGGGAGGAGGAAGGG + Intergenic
1131772753 15:95758041-95758063 CTGTTGGTGGGTAGGGAGAAAGG + Intergenic
1131920381 15:97320912-97320934 ATGCTGTTGGGAATGAACAATGG + Intergenic
1132355633 15:101169473-101169495 CTGCTGTGGAGGCAGAAGAAAGG + Intergenic
1132704143 16:1235178-1235200 CTGCTGATGAGAAGGCAGAATGG - Intergenic
1132707376 16:1251246-1251268 CTGCTGATGAGAAGGCAGAATGG + Intergenic
1132870143 16:2112239-2112261 GGGCTGTTGGGGAGGAAGGGGGG + Intronic
1133735757 16:8614367-8614389 CAGGAGATGGGGAGGAAGAAGGG + Intergenic
1133960056 16:10485622-10485644 AGGCTGTTGGGGAGGAAGGATGG - Intergenic
1134051516 16:11141013-11141035 CTGCTGTTGAGGAGGGAGCCAGG + Intronic
1134163773 16:11914948-11914970 CAGGAGTTGGGGAGGACGAATGG - Intronic
1134329243 16:13235368-13235390 TTGCTGTTGGTGATGAAGTATGG - Exonic
1134522404 16:14924717-14924739 GGGCTGTTGGGGAGGAAGCGGGG - Intronic
1134710074 16:16323368-16323390 GGGCTGTTGGGGAGGAAGCGGGG - Intergenic
1134717285 16:16363368-16363390 GGGCTGTTGGGGAGGAAGGGGGG - Intergenic
1134849371 16:17468544-17468566 CTGCGGTTGGGGAGGTAGGTGGG - Intronic
1134949529 16:18345277-18345299 GGGCTGTTGGGGAGGAAGCGGGG + Intergenic
1134957467 16:18388791-18388813 GGGCTGTTGGGGAGGAAGGGGGG + Intergenic
1135046544 16:19160643-19160665 ATCATGTTAGGGAGGAAGAAGGG - Intronic
1135380750 16:21994394-21994416 CAGGAGTTGGGGAGGCAGAATGG - Intronic
1135676393 16:24418430-24418452 ATTCTGTTGGGGAGCAATAAAGG - Intergenic
1136747952 16:32608618-32608640 CAGCTGTGGTGGAGGATGAATGG - Intergenic
1137624352 16:49898257-49898279 CTGCTTTTGTGGAGCAAGAAGGG - Intergenic
1138446365 16:57066649-57066671 CTGGTGTTGGGGAGGGGGCAGGG + Intronic
1139220359 16:65175583-65175605 GAGCTGTTAGTGAGGAAGAATGG - Intergenic
1139265835 16:65637440-65637462 CAGCTGATGAGGAGGAAGATGGG - Intergenic
1139370274 16:66463242-66463264 CTGCTGGTGGGAATGTAGAATGG - Intronic
1139446202 16:67000288-67000310 GAGCTGTTTGGGAGGCAGAAGGG + Intronic
1139567414 16:67787423-67787445 CTGCTGGTGGGGATGTAAAATGG + Intronic
1139932634 16:70541042-70541064 CTGCTGTTGGGAATGTAAAATGG - Intronic
1140067089 16:71620801-71620823 CTGCAGGGAGGGAGGAAGAAAGG - Intergenic
1141263381 16:82474037-82474059 GTGCAGGTGGGAAGGAAGAAAGG - Intergenic
1141458722 16:84163279-84163301 CTGCTGATGGGGATGTAAAATGG - Intronic
1142255950 16:89014048-89014070 CTGCATTTGGGGAGGAAAAGGGG + Intergenic
1203050089 16_KI270728v1_random:867825-867847 CAGCTGTGGTGGAGGATGAATGG - Intergenic
1142620460 17:1162408-1162430 CTCCTGCTGGGGTGGAAGAGAGG - Intronic
1142934937 17:3321183-3321205 CTGTTGTTGGTGTGTAAGAATGG + Intergenic
1143114776 17:4576326-4576348 CTGCTTTGGAGGAGGAAGATGGG + Intergenic
1143165491 17:4895358-4895380 CTGCTGGTGGGCACGGAGAACGG + Exonic
1143378505 17:6481027-6481049 CAGCTGGTGGGGAGAAAGGAGGG - Intronic
1143436600 17:6932840-6932862 TTGCTGGTGGGGATGAAAAATGG + Intronic
1143583193 17:7838288-7838310 CTGCTGGTGGGGAGGGAGGGAGG + Intergenic
1144252548 17:13433099-13433121 CTGCTGTTGGTAAGGTACAATGG - Intergenic
1144311352 17:14016924-14016946 CCCCTGGAGGGGAGGAAGAAAGG + Intergenic
1144638830 17:16926688-16926710 CTGCCCTGGGGGAGGCAGAAGGG - Intergenic
1144729133 17:17516765-17516787 CAGCTGCTGGGAAGGAAGGAGGG - Intronic
1145048210 17:19636033-19636055 CTGCTGGTGGCAATGAAGAATGG - Intergenic
1146821519 17:35986603-35986625 ATGGTGATGAGGAGGAAGAAGGG + Exonic
1146978673 17:37139023-37139045 CTGGGGTTGGGGGAGAAGAAAGG + Intronic
1147326337 17:39671532-39671554 CTGATTTTGGGGAGGAGGAAGGG - Exonic
1147565383 17:41533209-41533231 CAGCTGGAAGGGAGGAAGAAAGG + Intergenic
1147597321 17:41725323-41725345 CTGGTGGGAGGGAGGAAGAATGG + Intronic
1147921401 17:43919340-43919362 CTGCTGCTACGGGGGAAGAAAGG - Intergenic
1148785871 17:50145969-50145991 CTGCAGTTGTGGAGGGAGAGCGG - Intronic
1148841335 17:50499497-50499519 CTGCTGGTGGGGATGCAAAATGG + Intergenic
1149084588 17:52699913-52699935 CTCCTGTTGGTGAGGAATGAGGG - Intergenic
1149430593 17:56593585-56593607 TTGTTGTTTGGGGGGAAGAAGGG + Intergenic
1149654029 17:58300997-58301019 CTGGGGTTGTGGAGGAAGATGGG - Intergenic
1149655645 17:58308466-58308488 CTGCTGGTGGGCAGCAAGCAGGG + Intronic
1150007670 17:61479683-61479705 CTGGGGTTGGGGAGGAGGGAAGG + Intronic
1150046402 17:61917620-61917642 CTACCAGTGGGGAGGAAGAAAGG + Intronic
1150833527 17:68543715-68543737 CTGCTGTCTGGAAGGAAGGAAGG + Exonic
1151385951 17:73755432-73755454 CTGCTGTTCAGGAGGAAGGGTGG + Intergenic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1151817830 17:76479850-76479872 TTCCTCTTGGGGAGGAAGGAGGG + Exonic
1152129909 17:78469952-78469974 CTTCTGTTTGGGAAGATGAAAGG + Intronic
1152335916 17:79700234-79700256 CTGCGGTGGGGGAGGAAGTCCGG - Intergenic
1153071860 18:1115583-1115605 CTGCTGTGGTGGAGGTAGCAGGG + Intergenic
1153429343 18:4999080-4999102 CTGCTGCTGGGGATGAAGGAGGG - Intergenic
1153479810 18:5535856-5535878 CTGTTGTTGAGGACGAAGGAAGG + Intronic
1153516642 18:5909703-5909725 CTGAAGCTGGGGAGGAAGCAAGG + Intergenic
1154031003 18:10754343-10754365 CCCCTGTTGGAGAGGAAGAGGGG + Intronic
1154373115 18:13784096-13784118 CTGCTGATGGGAATGTAGAATGG + Intergenic
1155001801 18:21694968-21694990 GTTCTGTTGCTGAGGAAGAAGGG - Intronic
1155212147 18:23611348-23611370 CTGGTGGAGGCGAGGAAGAAAGG - Intronic
1156082938 18:33361844-33361866 CTGTTGGTGGGAAGGTAGAATGG + Intronic
1156154377 18:34284024-34284046 CTACTGATGGAGAAGAAGAAAGG - Intergenic
1157390194 18:47295379-47295401 CTGCCTCTGGGGAGGAAGAAAGG - Intergenic
1157602072 18:48899812-48899834 CTGCTGGTGGGGATGTAAAATGG + Intergenic
1158064796 18:53393852-53393874 CTTCTGTCAGGGAGGATGAAGGG - Intronic
1158312206 18:56170971-56170993 CTGGGGTTGGGGAGGGGGAAAGG + Intergenic
1158937030 18:62373953-62373975 CCGCTGCTGGAGGGGAAGAAAGG - Intronic
1160040097 18:75337420-75337442 CTTCTGTTAGGAAGGAAAAAGGG + Intergenic
1160058968 18:75512210-75512232 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1160393948 18:78558577-78558599 CTGCACTTGGGGAGGAGGGAGGG - Intergenic
1160582895 18:79897783-79897805 CTGTTGCTGGGGAGGAAGAGGGG - Intronic
1160762690 19:793568-793590 CTGCTCATGGGGAGGAGGGACGG + Intergenic
1161055915 19:2190563-2190585 CAGCTGGTGGGGAGGAAGGCGGG + Intronic
1161621040 19:5297184-5297206 CTGCCCTTGGGGAGGAACACGGG + Intronic
1162537829 19:11274224-11274246 CTGCTGGTGGGGATGCAAAATGG + Intergenic
1162566521 19:11447975-11447997 CGGCCCTTGGGGAGGCAGAAGGG - Intronic
1162761700 19:12892294-12892316 CTGTTGGGGGGGAAGAAGAAAGG - Intronic
1163409966 19:17148029-17148051 CTGCTGGTGGGAAGGTAAAATGG - Intronic
1163471751 19:17501218-17501240 CTGCTGGTGGGGAGGATGAGAGG + Intronic
1163648127 19:18501831-18501853 CTGCGGGTGGGCAGGAAGGAGGG + Intronic
1165083184 19:33322971-33322993 CTGCTGGTGGGGATGTAAAATGG + Intergenic
1165162098 19:33822646-33822668 CTGGTTTTGGGGATGAAGGAAGG - Intergenic
1166148098 19:40850876-40850898 CTTCTGTTGTGGAGGATGCAGGG + Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166152236 19:40882661-40882683 CTTCTGTTGCGGAGGATGCAGGG + Exonic
1166171121 19:41028172-41028194 CTTCTGTTGTGGAGGATGCAGGG + Intergenic
1166177929 19:41088001-41088023 CTTCTGTTGTGGAGGATGCAGGG - Intergenic
1166770632 19:45279987-45280009 GTGCTGTTGGGAAGGGAGGATGG + Intronic
1167761691 19:51453931-51453953 CTATTCTTGGGGAGGAAAAATGG + Intronic
1168101913 19:54145890-54145912 GTGCTGTGGGGGCAGAAGAAGGG - Exonic
1168333094 19:55580810-55580832 CGGCCGTGGGGAAGGAAGAAAGG - Exonic
1168565030 19:57415558-57415580 ATGCTGTTAGGGAGAAGGAAGGG + Intronic
1168662258 19:58176517-58176539 AAGCTGGTGGGGAGCAAGAAAGG - Intergenic
925683861 2:6451646-6451668 CTAATGATGAGGAGGAAGAATGG + Intergenic
925785604 2:7429418-7429440 GTGCTATTGAGGAGGGAGAATGG - Intergenic
926117252 2:10221341-10221363 CCACTGCAGGGGAGGAAGAAGGG + Intergenic
926733024 2:16051447-16051469 CTCCTGGTGGGGAGTAGGAAAGG + Intergenic
926797095 2:16627991-16628013 CTGGTGCTGGGGATGCAGAAAGG - Intronic
926960855 2:18357032-18357054 CTTCTTTTGGGGAAGAAGCAGGG + Intronic
927935262 2:27072364-27072386 CGGATGTGGGGGAGGGAGAAGGG + Intergenic
929282955 2:40102617-40102639 CAGCTGTCTGTGAGGAAGAAAGG + Intronic
929456332 2:42068808-42068830 CTGTGGTTGTGGAGAAAGAAGGG + Intergenic
929809539 2:45178133-45178155 CTGCTGATGGGAATGAAAAATGG + Intergenic
930439803 2:51391279-51391301 CTGCTGCTGGGAAGGGAGGAGGG + Intergenic
930674878 2:54189806-54189828 CTGTTGGTGGGGATGAAGATTGG - Intronic
931150196 2:59564703-59564725 CTGCTCATGGAGAGGAAGCAAGG - Intergenic
931746150 2:65293576-65293598 CTGCTGTCAGGCAGGGAGAAGGG + Intergenic
932464380 2:71906894-71906916 GGGCTGTTGGGGAGTGAGAAAGG + Intergenic
932547224 2:72725747-72725769 CTGCTGTTGGGAAGATAAAAAGG + Intronic
932646151 2:73504877-73504899 CTGTTGTGGGGTAGGAAGCAAGG - Intronic
933037425 2:77417757-77417779 CTGTTGTTGGGGGGGAAGGGGGG + Intronic
933162730 2:79044315-79044337 CTGCTGTTGGGGTGGGGGATGGG - Intergenic
933294499 2:80473681-80473703 CTGTTGTTGGGGAGCAATAATGG - Intronic
933606725 2:84391300-84391322 CTCCTGTTGGGGAGTTGGAAAGG - Intergenic
933972851 2:87484110-87484132 CTGATGTGGGGAAGGGAGAAGGG - Intergenic
934313571 2:91894325-91894347 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
934555899 2:95286862-95286884 CTGCTGTTGGTGGGGACGTATGG + Intronic
935141392 2:100355966-100355988 CTTCTGATGGGGAGGGGGAAGGG - Intergenic
935335447 2:102011335-102011357 CTGTTGTTGGGAATGAAAAATGG - Intronic
935971179 2:108532418-108532440 CTCCTCTAGGGGAGGAAAAAAGG + Intergenic
936320870 2:111466103-111466125 CTGATGTGGGGAAGGGAGAAGGG + Intergenic
936471666 2:112804211-112804233 CTGCTGGTGGGGATGTAAAATGG + Intergenic
937218064 2:120325163-120325185 CAGCTGTTGTGCAGGGAGAAGGG + Intergenic
937922205 2:127138417-127138439 CTGCTGTTGGGCAGTGGGAAAGG - Intergenic
937990783 2:127661113-127661135 CTCCTGCAGGGGAGGAAGAGAGG + Intronic
938052182 2:128184514-128184536 CTTTTGTTAGGGAGGAAGGATGG - Intronic
938612244 2:132959731-132959753 CTTCTGGTGGGGTGGCAGAAAGG + Intronic
938684784 2:133727680-133727702 CTGCTGCTGTGGAGTAAGAGAGG - Intergenic
941387356 2:164869644-164869666 CTTCTGTTCAGGAGGAAGACTGG + Intergenic
941622089 2:167789773-167789795 GGGCTGTGGGGGAGGAGGAAAGG - Intergenic
942336702 2:174895408-174895430 CTGCTATGGGGTAGGAGGAAGGG + Intronic
942593040 2:177566541-177566563 ATGGTGTTGGGGAGAAAGTAAGG - Intergenic
943543620 2:189247344-189247366 CTTCTTTTGGGGAGAAAGGATGG - Intergenic
943556900 2:189416555-189416577 CTGTTGTGGGGTAGGAGGAAGGG + Intergenic
944252754 2:197593931-197593953 TTGCTTTGGGGGAAGAAGAAAGG + Intronic
944681494 2:202081453-202081475 CTGCTGGTGGGAATGTAGAATGG - Intronic
944908766 2:204288639-204288661 CTGCCTTTGGGGATGAAGAAAGG + Intergenic
945257318 2:207813427-207813449 GTGGAGCTGGGGAGGAAGAAGGG + Intergenic
945450737 2:209992215-209992237 CAGCCGCTGGGGAGGAAGAGGGG + Exonic
945499775 2:210557527-210557549 ATGCTGGGGGGCAGGAAGAAGGG - Intronic
945958174 2:216105620-216105642 CTTTTGTTGTGGAGGAGGAAGGG + Intergenic
946530996 2:220570294-220570316 TGGCTGTTGGGGAGGAAATAAGG - Intergenic
947339593 2:229123621-229123643 CTGCTGGTGGGAAGGTAAAATGG - Intronic
947499862 2:230664147-230664169 ATGCTGTTAGTAAGGAAGAAGGG + Intergenic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
948576779 2:238956896-238956918 CTGCTCTGGTGGAGGAAGCAGGG - Intergenic
948586568 2:239023715-239023737 CAGCTGTTGGAGTGGAGGAAAGG - Intergenic
948900064 2:240951875-240951897 CTGCTGATGGGATGGAAGGATGG - Intronic
949040356 2:241845235-241845257 CGGCTGTTGGCGAGGCAGCAGGG - Intergenic
1168789169 20:564376-564398 ATGCTGCTGTGGAGGAAGGAGGG + Intergenic
1168796834 20:615962-615984 TTTCTGTTAGTGAGGAAGAAGGG + Intergenic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1168910857 20:1445567-1445589 CTGGTATTTAGGAGGAAGAACGG + Intronic
1170741097 20:19057198-19057220 CTGCTGTGGTGGAGGTAGCAGGG - Intergenic
1171152745 20:22842204-22842226 CAGCTGATGGGCAGGGAGAAGGG + Intergenic
1171354974 20:24536912-24536934 GTGCTTTTGGGCAGTAAGAAGGG - Intronic
1171438529 20:25142532-25142554 CTGCTTCTGGGGAGGTAGGAAGG - Intergenic
1171970692 20:31563191-31563213 CTGCTGCTGGGGAGTAACACAGG - Intronic
1172015365 20:31869921-31869943 CTGGGGCTGGGGAGGCAGAAAGG + Intronic
1172073060 20:32272774-32272796 TTGCTCTTGGGGAGGTAGGAAGG + Intergenic
1172080640 20:32338153-32338175 TTGCTGTTGGGCTGGAGGAATGG + Intergenic
1172610960 20:36252204-36252226 GTGATGCTGGGGAGAAAGAAAGG - Intronic
1172802075 20:37582777-37582799 TTGCGGTGGGGGAGAAAGAACGG + Intergenic
1172882323 20:38210097-38210119 CTGCTGTGGTGGAAGAAGATGGG - Intergenic
1173283656 20:41651443-41651465 CTTCTGCTGGGGTTGAAGAAAGG - Intergenic
1173317116 20:41955021-41955043 AGGCTGAAGGGGAGGAAGAAGGG - Intergenic
1173705289 20:45105769-45105791 CTGCTATTGGTAAGGAAGAAGGG + Intergenic
1173732741 20:45339853-45339875 AGACTGTTGGGGAGAAAGAAGGG + Intronic
1173744335 20:45425079-45425101 CTGGTGTTGAGGTGGAGGAAAGG - Intronic
1174296035 20:49545834-49545856 CTGCTGTTTGGGAAGTAGGATGG + Intronic
1174296039 20:49545858-49545880 CTGCTGTTTGGGAAGTAGGATGG + Intronic
1174373795 20:50112482-50112504 CTGCTTTTGGGGAGAATGAAGGG - Intronic
1174525452 20:51167038-51167060 CTGCTGATGGGAATGTAGAATGG - Intergenic
1174561470 20:51433579-51433601 CTGGTGCTGGGCAGGGAGAAAGG - Intronic
1174934348 20:54851585-54851607 CAGCTGAGGGGCAGGAAGAATGG - Intergenic
1175360822 20:58411129-58411151 CTGCTGGTGGGAATGAAAAACGG - Intronic
1175626269 20:60490590-60490612 CTGCAGCTGGAGGGGAAGAAGGG - Intergenic
1175659426 20:60799317-60799339 CTGCTGATGGGGATGCAAAATGG + Intergenic
1175927441 20:62477831-62477853 CTGCTGTGGGCGAAGAGGAAAGG - Intergenic
1177221545 21:18200052-18200074 TTGCTGATGGGGATGAAAAATGG - Intronic
1177374229 21:20248369-20248391 CTGCTGCTGGAGATTAAGAAAGG + Intergenic
1179071422 21:38074909-38074931 ATGCTGGTGGGAATGAAGAAAGG + Intronic
1179186086 21:39086275-39086297 CTGCTGTTTAGCAGGGAGAAGGG + Intergenic
1179467201 21:41583736-41583758 CTGCTGTGGGGCAGGAGGCAGGG + Intergenic
1180540311 22:16440229-16440251 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1180719023 22:17893171-17893193 CTGATGCTGGGGATGAAGAAGGG - Intronic
1181638296 22:24184371-24184393 CAGCTGTGTGGGAGGAGGAAGGG + Intronic
1181993212 22:26854089-26854111 CCTCTGGTGGTGAGGAAGAAAGG - Intergenic
1182345078 22:29657151-29657173 TTGCCTTTGGGGAGGAAGAAAGG - Intronic
1182448231 22:30402298-30402320 CTGCTGTTGGGGGAGAAGCATGG + Intronic
1182668002 22:31973043-31973065 CTGATGCAGGGGAGGAAGAATGG + Intergenic
1182827363 22:33277314-33277336 CAGCCGATGTGGAGGAAGAAGGG + Intronic
1183671864 22:39277905-39277927 CTGCAGTTGGGGGGGTAGGAGGG - Intergenic
1183686699 22:39365128-39365150 CTGCTGTGGGGAAGGGAGACAGG - Intronic
1183730420 22:39615393-39615415 GGGCTGTAGGGGAGGAAGCAAGG + Intronic
1184094909 22:42311236-42311258 CTGCAGTCAGGGAGGCAGAAGGG + Intronic
1184260412 22:43312248-43312270 CTGCTTTTGGGGAAGAAGAGAGG + Intronic
1184381060 22:44145219-44145241 CTGCCTTTATGGAGGAAGAAAGG + Intronic
1184880156 22:47299541-47299563 CTGGTCTTGGGGTGGGAGAAGGG - Intergenic
949605549 3:5649208-5649230 CTGCTGGTGGGAAAGTAGAATGG + Intergenic
949724585 3:7028932-7028954 CTGCTGTTGGGAATGTAAAATGG + Intronic
949958988 3:9296239-9296261 TTGCTGTTGGGGATGTAAAATGG - Intronic
950133550 3:10564430-10564452 CCACTGTTGGGGAGGAGGATGGG - Intronic
950195466 3:11006316-11006338 CTGCTGTCGGGGAAGCAGAGCGG + Intronic
950684428 3:14606280-14606302 CTGCAGTAGGGGAGGAATGAAGG + Intergenic
950695781 3:14700112-14700134 CTGCTGCTGGGGATGGGGAAGGG + Intronic
950765148 3:15267910-15267932 CTCCAGCTGGGGTGGAAGAAGGG + Intronic
950863943 3:16174269-16174291 CTGCTCTTGTGGGAGAAGAAGGG + Intergenic
951659292 3:25044852-25044874 CTGCTGTCTGGGGGAAAGAATGG - Intergenic
952389413 3:32866822-32866844 CTGCTGTTGGAGAGGAGTAATGG + Intronic
952917029 3:38254415-38254437 TGGATGTTGGGGAGGAAGAGAGG + Exonic
953146551 3:40281371-40281393 CTGCTGTTTTGGAGGAACAAAGG - Intergenic
953150556 3:40320435-40320457 CTGGAGTAGGGGAAGAAGAAGGG + Intergenic
953201277 3:40780565-40780587 TGGATGTTTGGGAGGAAGAAGGG + Intergenic
953752054 3:45616487-45616509 ATTCTGTGGGTGAGGAAGAAGGG - Intronic
953997772 3:47533719-47533741 TTGCTGGTGGGGATGTAGAATGG - Intergenic
954598188 3:51845569-51845591 CTGCTGGTGGGGTGGAGAAAAGG + Intergenic
954687015 3:52376595-52376617 CTGGTGTTGGCGGGGAAGAGGGG - Intronic
954746813 3:52792074-52792096 CTGATTTTGGGGAGGGAGGATGG + Intergenic
955103939 3:55877958-55877980 CTGCTCTTGGATTGGAAGAAAGG + Intronic
955872310 3:63452000-63452022 CTGGTCTGGGGGAGGAAGAAAGG - Intronic
955976914 3:64488756-64488778 CTGCTTTTACAGAGGAAGAAAGG - Intergenic
956008350 3:64804520-64804542 CTGCTGTTAAGCAGGAAGCAGGG - Intergenic
956409540 3:68965364-68965386 CAGCTGGTGAGGTGGAAGAATGG + Intergenic
956839339 3:73122679-73122701 CTGCTGTTGGGAATGTAAAATGG + Intergenic
959049606 3:101512622-101512644 CTGCTGCTGGGGAGGAAAGGTGG - Intronic
959887579 3:111520316-111520338 CTGGTGTTAGGGAGCAAGATAGG - Intronic
959916689 3:111824352-111824374 ATTCTGTTGGAAAGGAAGAAAGG - Intronic
960072139 3:113442404-113442426 CTGCTGTTGGGAATGTAAAATGG + Intergenic
960096098 3:113691281-113691303 CTGGTGGTTGGGAGGAAGAATGG - Intronic
960452935 3:117832435-117832457 CAGCTGGTGGAGAGGAAGGATGG - Intergenic
961116284 3:124332784-124332806 CTGCTTTTCAGGAGAAAGAAAGG + Intronic
961510199 3:127396150-127396172 CTGCTCTTGTGGAGGATGAAGGG + Intergenic
961530741 3:127538585-127538607 GAGCTGCTGGGGAGGAAGTATGG + Intergenic
961835773 3:129657798-129657820 CTGCTGTTGGGAATGGAAAATGG + Intronic
962087363 3:132205814-132205836 CTGCTGTTTGGGAGGAAAGTTGG - Intronic
962825260 3:139095336-139095358 ATGCTGTTGGGTTGGATGAAGGG + Intronic
963987177 3:151609832-151609854 CTGCTGGTGGGGAGAGAGAGAGG + Intergenic
964176722 3:153832491-153832513 CTGCTTCTGGGGAGGCACAAGGG + Intergenic
965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG + Intronic
966226221 3:177600945-177600967 GTGTTGTTGGGGTGGAAGGAGGG + Intergenic
966863772 3:184244984-184245006 ATGCTGTCTGGGAGGAAGACAGG + Intronic
967092506 3:186147221-186147243 TTGCTGTTGGGGTAGAAGCATGG + Exonic
967161173 3:186739668-186739690 CTGCTGTGGGGGAGCAACATTGG + Intronic
967277585 3:187791565-187791587 CTGCAGTTGTGGAGGAACAGTGG + Intergenic
968091610 3:195901517-195901539 CAGCTGCTGAGGAGGAAGAGAGG + Intronic
968948106 4:3676081-3676103 CTCCAGCTGGGGAGGAAGCATGG + Intergenic
970043907 4:11828146-11828168 ATGTTGTTGGGAAGGAAGGAAGG - Intergenic
970200403 4:13599229-13599251 CTGCTGCTCAGCAGGAAGAAAGG + Exonic
970303022 4:14701807-14701829 CAAATGTTGAGGAGGAAGAAAGG + Intergenic
970924045 4:21429583-21429605 CTGTTGTTGGGAAGGCAAAATGG - Intronic
971190751 4:24427063-24427085 AACCTGTTGGGGAGGAAGCAAGG + Intergenic
971419784 4:26464865-26464887 CTGCTGTTGGAGAAGAAGGGAGG - Intergenic
973956003 4:56063943-56063965 TTGCTGTTGGGAAGGTAAAATGG - Intergenic
974177853 4:58346566-58346588 CTGCTTTTGGGAAGGAAGATGGG + Intergenic
974337479 4:60569380-60569402 ATTCTGTTGGGGAGAAAGTAAGG - Intergenic
974786184 4:66621998-66622020 TTGCATTTGGGGAGGCAGAAAGG + Intergenic
975321663 4:73015416-73015438 CTGGTGTTCTGGAGGAAGAGTGG - Intergenic
976151030 4:82092002-82092024 CTGGGGTTGGGAAGGAAAAATGG + Intergenic
976184548 4:82430779-82430801 CTGCTGTTGGGGAGGGCGGAGGG - Exonic
976397692 4:84573957-84573979 CTGCTGATGTGGAGGAAGAGTGG - Intergenic
976551322 4:86398755-86398777 CTACTGTCAGGGAGGAAGAGAGG - Intronic
977945773 4:102912376-102912398 CTGCTTTTGGTGAAGAAAAAAGG + Intronic
978218532 4:106239243-106239265 CTCATGTTGGGGAGGAGGAGTGG + Intronic
979269669 4:118745006-118745028 CAGCAGTTGGCAAGGAAGAATGG + Exonic
979749542 4:124261227-124261249 CTGCTGGTGGGGATGAAAAGTGG + Intergenic
980193789 4:129560941-129560963 GTTCTGTTGGGAAGGAAGCAGGG + Intergenic
981694940 4:147550634-147550656 CAGCTGTGGGGGAGGAAGCTTGG - Intergenic
982007639 4:151078636-151078658 CTGCTGTTGGGAATGTAAAATGG - Intergenic
982032648 4:151315999-151316021 TTGCAGTTGGGGAGGGAGAGTGG + Intronic
984582736 4:181529202-181529224 GTACTGCTGGGGAGGAATAAGGG - Intergenic
984970212 4:185181802-185181824 CTGCAGTTTGCCAGGAAGAAAGG + Intronic
985034037 4:185820535-185820557 CTGCAGTTGGGGAAGGAGTAGGG + Intronic
986719689 5:10552205-10552227 CTACCTTTTGGGAGGAAGAAGGG - Intergenic
986721823 5:10565230-10565252 CTCCTGCAGGGGAGGAGGAATGG - Intronic
986730127 5:10629163-10629185 CTGCTGGTGTGGAGAATGAATGG + Intronic
986870205 5:12036612-12036634 CTGCTGTTGGGGAGGCACGGTGG + Intergenic
987398413 5:17448343-17448365 CTTCTGTCGGGGAGGATAAAAGG - Intergenic
987441353 5:17960972-17960994 CAGCTGTTGGGGAAGGAGATTGG + Intergenic
987592692 5:19951747-19951769 ATGCAGGTGGGGAGGAGGAAAGG + Intronic
987692390 5:21283534-21283556 CCCCTGTTGGGAAGCAAGAAGGG - Intergenic
987994529 5:25258660-25258682 CTGGTGTTAGGGAGGGAGAAAGG + Intergenic
988082855 5:26434555-26434577 CAGTTGTTTGGGAGAAAGAAAGG + Intergenic
988296239 5:29366222-29366244 CTGCTGGTGGGGATGTAGATTGG - Intergenic
988413825 5:30920108-30920130 CTGGTGTTGGGAAGCAAGAAGGG + Intergenic
988815302 5:34828584-34828606 CTGATGGGGGGAAGGAAGAATGG + Intronic
988822071 5:34896958-34896980 GTTCTCTGGGGGAGGAAGAAAGG + Intronic
989147401 5:38262233-38262255 CTGTGGTGGGGCAGGAAGAAGGG + Intronic
989489287 5:42032002-42032024 CAGCTGTTTGGGAGAAAGTAAGG - Intergenic
990673494 5:58158978-58159000 CTGCTGTTGGGAATGCAAAATGG - Intergenic
990970557 5:61501231-61501253 CTGCTGTGGGGGTGGAAAAGAGG + Intronic
991207834 5:64069777-64069799 GTTCTGTTGGTAAGGAAGAAAGG + Intergenic
991405423 5:66296486-66296508 CAGGAGTTGGGGAGGAAGGAAGG - Intergenic
991747968 5:69766516-69766538 CCCCTGTTGGGAAGCAAGAAGGG + Intergenic
991799544 5:70346364-70346386 CCCCTGTTGGGAAGCAAGAAGGG + Intergenic
991829053 5:70663674-70663696 CCCCTGTTGGGAAGCAAGAAGGG - Intergenic
991891903 5:71345793-71345815 CCCCTGTTGGGAAGCAAGAAGGG + Intergenic
992180032 5:74186819-74186841 ATGCTTTCGGGGAGGAACAAAGG - Intergenic
992765372 5:79993789-79993811 GTGCTGTTGGGAAAGATGAAAGG + Intronic
992944719 5:81798751-81798773 ATGTTGCTGGGGAGGAAGGAGGG + Intergenic
994708777 5:103240271-103240293 CTGCTGGTGGGGATGTAAAATGG + Intergenic
995554493 5:113313495-113313517 CGGTGGTTGGGGAGGAAGGAGGG + Intronic
996008379 5:118451232-118451254 ATGGGGGTGGGGAGGAAGAATGG + Intergenic
996264356 5:121517979-121518001 CTTTTGATTGGGAGGAAGAAAGG - Intergenic
996326347 5:122278835-122278857 TTGCTGTTGGGAATGAAAAATGG + Intergenic
996541131 5:124630882-124630904 ATTCTGTTGGGGAGAACGAAGGG - Intergenic
997246208 5:132351597-132351619 CTGCTGTTGGTAAGGGAGTAGGG - Intergenic
997582548 5:135026934-135026956 CTGCAGTGGGGGAGGAAGGAGGG - Intergenic
997612340 5:135223991-135224013 CAGCTGTTGGGGTGAAAGAAAGG - Intronic
997669768 5:135661184-135661206 CTGCTGTTCTGGAGGCAGACAGG - Intergenic
998094468 5:139389497-139389519 CTGCTGTTAGGCAGGCAGATGGG + Intronic
1000305678 5:159992283-159992305 CTGCTGATGGGGATGTAAAATGG + Intergenic
1000984480 5:167851742-167851764 CTCTTGTTTGGGAGGAAGATGGG + Intronic
1001187222 5:169586070-169586092 CAGCAGTTGGAGAGGAAGTAGGG - Intronic
1001634927 5:173202998-173203020 CTGCTGGAGAGGAGGGAGAAGGG - Intergenic
1001989173 5:176101974-176101996 CAGCTGTGGTGGAGGATGAATGG - Intronic
1001989842 5:176107298-176107320 CAGCTGTGGTGGAGGATGAATGG - Intronic
1001998320 5:176179903-176179925 CAGCTGTAGTGGAGGATGAATGG + Intergenic
1002092656 5:176814117-176814139 CTGCTGCAGGTGAGGGAGAAAGG - Intronic
1002213020 5:177609523-177609545 CTGCTCCTGGGGAGGAAGAGAGG - Exonic
1002227029 5:177730840-177730862 CAGCTGTGGTGGAGGATGAATGG + Intronic
1002227697 5:177736164-177736186 CAGCTGTGGTGGAGGATGAATGG + Intronic
1002266449 5:178037589-178037611 CAGCTGTGGTGGAGGATGAATGG - Intronic
1002267119 5:178042934-178042956 CAGCTGTGGTGGAGGATGAATGG - Intronic
1002536141 5:179876741-179876763 CAGCTGCTGGGGAGGAAGTATGG + Intronic
1002558497 5:180063025-180063047 CTGGGGGTGGGGAGGAGGAAGGG + Intronic
1003242783 6:4358952-4358974 CTGCGGTGGGGGAGAGAGAAGGG + Intergenic
1003699799 6:8449170-8449192 CTGCTGTTGGGAATGTAAAATGG - Intergenic
1004461338 6:15839788-15839810 CTGCTGGTGGGGAGGCAAAATGG - Intergenic
1005557120 6:26997794-26997816 CTGCTTCTGGGGAGGCTGAAGGG - Intergenic
1005691465 6:28311090-28311112 CTGCTGTTGTGGAGGTGGCAGGG + Intergenic
1005809620 6:29506056-29506078 CTGAGGGTGGGGATGAAGAAGGG - Intergenic
1006906678 6:37537641-37537663 ATGGTGGTGGGGAGGAAGCATGG + Intergenic
1006973152 6:38067997-38068019 CTGCTGCTAGGGAGGATTAATGG + Intronic
1007291519 6:40790890-40790912 CTGCTGTTGTGGAGGGTAAATGG - Intergenic
1007339886 6:41184564-41184586 CTGCCGTGGGGTAGGGAGAAGGG + Intergenic
1007490606 6:42218655-42218677 TTGGTGTGGGGAAGGAAGAAAGG - Intergenic
1007585728 6:42988100-42988122 TTGGAGGTGGGGAGGAAGAAAGG - Intronic
1007758486 6:44116827-44116849 CTGGGGTTGGAGAGGGAGAATGG + Intronic
1008134490 6:47758039-47758061 CTCCAGTTGGGGAGGCTGAAAGG + Intergenic
1008277709 6:49560362-49560384 ATTCTGTTGGAGTGGAAGAAGGG + Intronic
1008711334 6:54230694-54230716 ATCCTGGTGGGGAAGAAGAAAGG - Exonic
1008900279 6:56606320-56606342 TGGCAGTTGGAGAGGAAGAAAGG - Intronic
1009682778 6:66920732-66920754 CTTCCACTGGGGAGGAAGAAAGG - Intergenic
1010561257 6:77353456-77353478 CTGTTGCTGGGGATGAAGGAGGG + Intergenic
1010619052 6:78051680-78051702 CTGCTGATGGGAAGGCAAAATGG - Intergenic
1010717441 6:79245852-79245874 CTGGCTTTGAGGAGGAAGAAAGG + Intergenic
1012913001 6:105137690-105137712 CTCCTGCTGCGGAGGAAGAGGGG + Intergenic
1013488392 6:110619791-110619813 TGGCAGTTGGGGAGGAAGACTGG - Intronic
1013588566 6:111601111-111601133 CAGCTATTGGGAGGGAAGAAAGG + Intronic
1013743604 6:113318769-113318791 CTGGGGCTGGGGAGGAAGGAAGG - Intergenic
1014032002 6:116716768-116716790 ATGCTGTTAGGAAGGTAGAAAGG + Intronic
1014809426 6:125869317-125869339 ATGCTGGTGGGGGGGAAGACTGG - Intronic
1015646239 6:135391814-135391836 TTGCAGTTGGGGAGAAAGATTGG + Intronic
1016549440 6:145260728-145260750 CTGCTATTTGAGAGGAGGAATGG - Intergenic
1016822598 6:148360672-148360694 ATGCTGTGGGGCAGAAAGAATGG + Intronic
1017290347 6:152728260-152728282 CTACAGTTGGGCAGGAAGAATGG + Intergenic
1017737870 6:157380746-157380768 CAGCTGGGGAGGAGGAAGAAGGG + Intergenic
1017740952 6:157406183-157406205 CTGCAGTTGGGGAGGGAGTGGGG + Intronic
1017846378 6:158262061-158262083 ATTCTGTTGGTGAGGAAGAAAGG + Intronic
1018000814 6:159577033-159577055 ATGCTGTAGTGGAGGAAGAGAGG - Intergenic
1018044282 6:159952227-159952249 CTGCTGTTGGGGAGGATGCCTGG - Intergenic
1019388236 7:770674-770696 GAGCTGTTGGGGAGGGAGATGGG - Intronic
1019938464 7:4271327-4271349 CTGCTGTCGGGCAGGAGAAATGG - Intergenic
1020272498 7:6605652-6605674 CTGCTGTTGGGGAAGGACAGGGG + Intronic
1020399152 7:7755294-7755316 GTGCTATTGGGAAGGAAAAATGG - Intronic
1021419842 7:20433436-20433458 CTTCTGTTGGGAAAAAAGAATGG + Intergenic
1021524861 7:21575690-21575712 ATGCCTTTGGGGAGGAAAAATGG - Intronic
1021543598 7:21788563-21788585 CTGCTGGTGGGGAGAGAGGAAGG - Intronic
1022251029 7:28608579-28608601 GTGCTGGTGGGGAGGGAGATTGG - Intronic
1022339757 7:29456917-29456939 CTGCAGATGGGGAAGATGAAGGG - Intronic
1022427988 7:30285655-30285677 CTGCTGTTCGGGATGCTGAAGGG - Exonic
1022535088 7:31093564-31093586 CTGATGCTGGGGAGGAAGGTTGG + Intronic
1022739195 7:33105361-33105383 CTGCTTTGGGGAAGAAAGAAGGG - Intronic
1023018843 7:35991796-35991818 CTGCTGGTGGGAATGTAGAATGG + Intergenic
1024425432 7:49220090-49220112 CTGAGGCTAGGGAGGAAGAAGGG + Intergenic
1024587416 7:50854001-50854023 CTCCTGGTGGGGAGGAAGCCTGG - Intergenic
1024869343 7:53943782-53943804 CTGCTGATGGGAAGGCAAAATGG - Intergenic
1025748194 7:64265596-64265618 CTTCTATTGGGGATGAAGAAGGG + Intronic
1026223367 7:68419585-68419607 CTTCTGTTGGCAAGGAAGAAAGG - Intergenic
1026759445 7:73115466-73115488 CAGCTGTGGGGAAGGAAGGAAGG - Intergenic
1027087965 7:75278007-75278029 CAGCTGTGGGGAAGGAAGGAAGG + Intergenic
1028074504 7:86494905-86494927 CTGCAGGTGATGAGGAAGAATGG - Intergenic
1028116233 7:87001139-87001161 CAGCTGATTGTGAGGAAGAAAGG + Intronic
1029162634 7:98563461-98563483 CTGCTGTAGGGGAGGAGCATGGG + Intergenic
1029307662 7:99632434-99632456 CTTCAGTGGGGGAGGAAGACGGG - Intergenic
1029394076 7:100295140-100295162 CAGCTGTGGGGAAGGAAGGAAGG + Intergenic
1029433094 7:100544875-100544897 TTGCTGCTGAGGAGGAACAAAGG + Intronic
1029856027 7:103517797-103517819 CTCCTATTAGGAAGGAAGAAAGG - Intronic
1030316396 7:108119174-108119196 CTGCTGGTGGGAATGAAGAATGG + Intronic
1032447806 7:131999749-131999771 CACCTGTCGGGGAGGGAGAAAGG - Intergenic
1032605737 7:133349766-133349788 CTGCTGTTGGGAATGTAAAATGG - Intronic
1033017105 7:137682556-137682578 CTGTGGATTGGGAGGAAGAAGGG - Intronic
1034077394 7:148245424-148245446 CTGATGTGGAGGAGGATGAAGGG + Intronic
1034905031 7:154936663-154936685 CTGCTGTTGGGAATGTAAAATGG - Intronic
1035037184 7:155902943-155902965 CTGGTGTTGGGTGGCAAGAAGGG + Intergenic
1035225034 7:157428156-157428178 CTGCAGTTGAGGAGGGAGGAGGG + Intergenic
1035460356 7:159034845-159034867 CGGCTTGTGGGGAGGAGGAATGG + Intronic
1035542314 8:450914-450936 GGGCTGGTGGGGAGGAGGAATGG - Intronic
1035914833 8:3607822-3607844 CTGGTGTTGGTGTGGCAGAAAGG + Intronic
1035991178 8:4491763-4491785 CTGCTGGTGGGAACGCAGAATGG + Intronic
1036099795 8:5767121-5767143 CTGCTGCTGGGGATGCAAAATGG - Intergenic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1037170658 8:15887544-15887566 CTGGGGGAGGGGAGGAAGAAGGG - Intergenic
1037322927 8:17660630-17660652 CTGCTGATGGGAATGTAGAATGG - Intronic
1037617579 8:20533511-20533533 CTGCTGTGATGGGGGAAGAAGGG - Intergenic
1037745128 8:21637350-21637372 CTGCTGTAGGGTAGGAGGAATGG - Intergenic
1038059117 8:23892650-23892672 CTGCTGTGGATGTGGAAGAAAGG + Intergenic
1038678981 8:29649289-29649311 TTGCTGGTGGTGAGGAAGATGGG - Intergenic
1038765913 8:30427478-30427500 TTCCTGTAGTGGAGGAAGAATGG - Intronic
1039708565 8:40032681-40032703 GTGCTGTTAGGAAGGAAGAAAGG - Intergenic
1039797573 8:40928204-40928226 CTTCTGTAGGGGAGGAGGTAGGG + Intergenic
1040470431 8:47731750-47731772 CTGGGGGTAGGGAGGAAGAAAGG + Intronic
1041036448 8:53796068-53796090 CTGCTGTGCGGCAAGAAGAAAGG + Intronic
1041102663 8:54412308-54412330 CTGCAGGTGAGGAGGAAGCATGG - Intergenic
1041523901 8:58784669-58784691 CTGCTGTTGGACAGAAGGAATGG + Intergenic
1041532655 8:58888876-58888898 CAGCTGTTAGGGAGGAGGTATGG - Intronic
1041724964 8:61009762-61009784 CTGCCGATGGGGTGGGAGAAAGG + Intergenic
1042278447 8:67029228-67029250 CAGCTGTTTGGGGGGAAGAAAGG - Intronic
1043156541 8:76788185-76788207 TTCCTGTTGGGCAGGAAGTAAGG - Intronic
1043834059 8:85026216-85026238 CTAAGATTGGGGAGGAAGAAAGG - Intergenic
1045232582 8:100318825-100318847 GTGCTGTTGGAAACGAAGAAAGG + Intronic
1045707064 8:104936646-104936668 CTGCCATTGGGGAAGAAGAAAGG + Intronic
1045820550 8:106332047-106332069 CTGAGGATGGGGAGGAAGAAGGG - Intronic
1046326968 8:112661863-112661885 GTGATGTTGGGGAGTAGGAATGG - Intronic
1047819767 8:128506019-128506041 CTGCTGTTGGGAATGTAAAATGG - Intergenic
1048325874 8:133438363-133438385 CTGCTTTTGGGGAGAATGTAGGG - Intergenic
1048583461 8:135750204-135750226 CTGCTGGTGTGGGGGAAGCAGGG + Intergenic
1048602265 8:135930964-135930986 CTGGTGTTGGGCAACAAGAATGG + Intergenic
1048818311 8:138355007-138355029 CTGCTGTAGGGTGGGAGGAAGGG - Intronic
1048994934 8:139788422-139788444 CGGCTGCTGGGGAGGGAGAGCGG + Intronic
1049165782 8:141125033-141125055 CTGTTGTTGGGGATGTAAAATGG - Intronic
1049815528 8:144597423-144597445 CTGCAGCTGGGGAGGAACACAGG + Intronic
1050120646 9:2303751-2303773 GTGATGGTGGGGAGGAATAAAGG + Intergenic
1050474419 9:6025113-6025135 CTGCTGTTAGGAATGAAAAATGG - Intergenic
1050835119 9:10067765-10067787 GTGCTGTTGGGGTGGGAGATAGG - Intronic
1051482043 9:17571867-17571889 ATGCGGTAGGGAAGGAAGAAAGG - Intergenic
1051738243 9:20225384-20225406 CTACTTTTGGGGAGGAGGAAGGG + Intergenic
1052598076 9:30587284-30587306 CAGATGTTGAGGAGGATGAATGG - Intergenic
1052616779 9:30851887-30851909 CTGCTGATGGGGTGGAAAAGAGG - Intergenic
1052632975 9:31064525-31064547 CTGGTGTTAGGGAGGATGGATGG + Intergenic
1053164386 9:35834370-35834392 ATGCTATTGGTGAGGAAGACTGG + Intronic
1053231609 9:36415156-36415178 TTGGTGTTGTTGAGGAAGAAGGG - Intronic
1053380401 9:37644632-37644654 CTATTGTTGGGGAGGAAAGATGG - Intronic
1053386556 9:37695727-37695749 CTGCTGATGGGGTGGATGCAGGG - Intronic
1053477198 9:38391075-38391097 GTGCTGTGGGGGAGGCAGGAGGG + Intergenic
1055126979 9:72730304-72730326 CTGGTTTTGGGGAAGAACAAGGG + Intronic
1055137966 9:72844637-72844659 CTGCTGTGGTGGAGGTAGCAGGG - Intergenic
1055141641 9:72883216-72883238 CTGCTTTGGGGGAGAAAGAAGGG - Intergenic
1055577008 9:77670606-77670628 CTGCAGTTGGGGAGAGAGATTGG + Intergenic
1055828940 9:80358320-80358342 CTGCAGGTGGGGAGGTAGCAGGG + Intergenic
1055906153 9:81295335-81295357 CTTCTGTCGGGGAGGGAGAAAGG + Intergenic
1055983159 9:82026269-82026291 CTGCTGGTGGGAATGAAAAATGG - Intergenic
1056286246 9:85090661-85090683 CAGCTGTGAGGGAGGAAGAATGG + Intergenic
1056306596 9:85296680-85296702 CTTGTGGTGGGGAGGAAGGAAGG - Intergenic
1057090677 9:92255305-92255327 CTGCTGTTGGGCAGGAGCAGCGG - Intronic
1057250823 9:93500259-93500281 CAGATGATGGGGAGGAAGCAAGG - Intronic
1057269166 9:93637881-93637903 CTGCTGGTGGGAAGGTAAAACGG - Intronic
1057354638 9:94323273-94323295 AGACTGTTGGGGAGGAAGACGGG + Intronic
1057455781 9:95208781-95208803 CTGCTGATGGGGATGAAAAATGG + Intronic
1057525844 9:95800159-95800181 CTGCTGTTGGGAATGTAAAATGG + Intergenic
1057637459 9:96783209-96783231 CTGCTGGTGGGAAGGTAAAATGG - Intergenic
1057653119 9:96934362-96934384 AGACTGTTGGGGAGGAAGACGGG - Intronic
1058506348 9:105669896-105669918 CTGGAGTTGGGGAGGAAGGAGGG + Intergenic
1058684660 9:107469489-107469511 CTACTGTTGGGCAGAGAGAATGG + Intergenic
1059071895 9:111146707-111146729 CTGGAAATGGGGAGGAAGAAAGG - Intergenic
1059196618 9:112376653-112376675 CTGATGTTGGAGGGCAAGAAGGG + Intergenic
1059508581 9:114822681-114822703 CTGCTAATGGGGAGAGAGAAGGG + Intergenic
1059853539 9:118369532-118369554 CTGCTGTTGGGAATGTAAAATGG + Intergenic
1059921140 9:119161207-119161229 CTGATGATGGGGAGAAATAAGGG - Intronic
1060101863 9:120847639-120847661 CTGCTGTTAGGAAGGAAGTCTGG + Intergenic
1060698953 9:125734098-125734120 CTGCTGGTGGGAATGAAAAATGG + Intergenic
1060742305 9:126107343-126107365 CTCCTGTTCAGGATGAAGAAAGG - Intergenic
1060861540 9:126958863-126958885 TTGCTGGTGGGAAGGCAGAATGG - Intronic
1060944490 9:127561916-127561938 CTTCTGTGCTGGAGGAAGAAGGG - Intronic
1061527761 9:131181427-131181449 TTGCTGTTGGGAATGAAAAATGG - Intronic
1061544200 9:131294472-131294494 GTGCTGCTCGGGAGGGAGAAGGG - Intronic
1062193845 9:135262622-135262644 CGGCTGTTGAGGAGCTAGAACGG + Intergenic
1062432294 9:136531611-136531633 CTGCTGGGCGGGAGGAAGGAAGG - Intronic
1186652998 X:11581323-11581345 CTGCTGGTGGGGATGTAAAATGG + Intronic
1187284576 X:17892494-17892516 CTACTGGTGGGGATGAAAAATGG + Intergenic
1187586151 X:20663954-20663976 CTGCTGGTGGGGATGTAAAATGG + Intergenic
1187752148 X:22478576-22478598 CTGCTCTGGGGGAGGTAGCAGGG + Intergenic
1187812184 X:23191377-23191399 CTGGGGTCGGGGAGAAAGAAGGG - Intergenic
1188094936 X:26009705-26009727 CTGCTGTTGGGGAGCCAGATGGG + Intergenic
1189554764 X:42130533-42130555 CTGCTGTTGAGGAGTTGGAAAGG - Intergenic
1189580041 X:42396421-42396443 CTGGTGTTGGGGTGGAAGATGGG - Intergenic
1190398493 X:50008664-50008686 CTACAGTTGAGGAAGAAGAATGG + Intronic
1190547068 X:51538647-51538669 TTGCTGGTGGGAAGGAAAAATGG - Intergenic
1190551832 X:51590798-51590820 TTGCTGGTGGGAAGGAAAAATGG + Intergenic
1192090432 X:68149687-68149709 TTGCTGTTGGGAATGTAGAATGG + Intronic
1192203851 X:69083283-69083305 GAGGGGTTGGGGAGGAAGAAGGG + Intergenic
1192265232 X:69533104-69533126 CTGCTGGAGGGGTGGAAGACAGG + Intergenic
1192860937 X:75069683-75069705 GTGGGGTTGGGGAGGGAGAAGGG + Intronic
1194284333 X:91990911-91990933 ACTCTGGTGGGGAGGAAGAAGGG + Intronic
1194536258 X:95108532-95108554 CTGATGATGAGGAGGAAGGAGGG - Intergenic
1194615818 X:96102614-96102636 CTGCTGTTGGAGATGTAAAATGG + Intergenic
1194819185 X:98485163-98485185 CTGTTCTGGGGTAGGAAGAAGGG + Intergenic
1195432311 X:104803082-104803104 CTGCTGTTGGGGAGGAAGAAAGG + Intronic
1196622439 X:117839086-117839108 GTGCTGTGGAGAAGGAAGAAGGG + Intergenic
1196948971 X:120857128-120857150 GTGTTGTTGGGGAGGAACAGTGG + Intergenic
1197010147 X:121551141-121551163 CTGCTGCTGGGGTTGAAGGAGGG - Intergenic
1197166484 X:123383032-123383054 CTGCTGTTGTGGGTGAAGGATGG - Intronic
1197450338 X:126605577-126605599 TTGCTGGTGGGAAGGTAGAATGG + Intergenic
1198513926 X:137384935-137384957 CTGCTGGTGGGTATGTAGAATGG + Intergenic
1198521545 X:137458409-137458431 CTGCTGATGGGGAAGTAAAATGG - Intergenic
1198682064 X:139193576-139193598 CTGCTGGGAGGGCGGAAGAAAGG + Intronic
1199095580 X:143734788-143734810 TTGCTGGTGGGGATGCAGAATGG + Intergenic
1199471400 X:148199632-148199654 AGGCTGTTGGGCAGAAAGAAGGG - Intergenic
1199871718 X:151904388-151904410 CTGATGGTGGGGAGGGAGGAAGG - Intergenic
1200601901 Y:5215470-5215492 ACTCTGGTGGGGAGGAAGAAGGG + Intronic
1201181486 Y:11351816-11351838 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1201226467 Y:11823562-11823584 CTGCTGCTGGTGAGGGAGGAAGG + Intergenic