ID: 1195437094

View in Genome Browser
Species Human (GRCh38)
Location X:104857164-104857186
Sequence AAATACCTATTGGACTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195437094 Original CRISPR AAATACCTATTGGACTCTGG AGG Intronic
903227291 1:21901031-21901053 ACATCCCCATTGGAGTCTGGGGG - Intronic
906840016 1:49127260-49127282 AGATACAGATTGGACTCTGCAGG + Intronic
914981287 1:152416482-152416504 AAAGACCTATTAGGCTTTGGAGG - Intergenic
919292901 1:195655718-195655740 AAATACATATTGGATTCTTCAGG + Intergenic
920397831 1:205659637-205659659 AAATACCGAGGGGACACTGGAGG - Exonic
924428300 1:243973944-243973966 AAACAAGTGTTGGACTCTGGAGG - Intergenic
1064017361 10:11782980-11783002 AAATACCCATTGCCCTCTGCTGG - Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064763808 10:18650590-18650612 AAGTAACTATTGAAATCTGGAGG - Intronic
1065089935 10:22221359-22221381 AAATAGCTATTGGAGTCTGAAGG + Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1070360496 10:75683944-75683966 AAAAACCTATAAAACTCTGGTGG - Intronic
1072057511 10:91774706-91774728 AAATACATATTGTAGACTGGAGG - Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1079847776 11:25491506-25491528 AAATGCCTATTTGATTGTGGTGG + Intergenic
1081328262 11:41772534-41772556 AAATACATAGTAGACTCTGTGGG - Intergenic
1081578782 11:44337250-44337272 ATATACCTATTGTAATCTGAAGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084724598 11:70933035-70933057 AAATACCTGTTGGAGTCTCTGGG - Intronic
1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG + Intergenic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085181540 11:74540982-74541004 AAACACCCATTCGACTCTGTCGG - Intronic
1087348633 11:97003292-97003314 ATATTCCCATAGGACTCTGGTGG - Intergenic
1087683965 11:101242797-101242819 AAATACCTATTGCACACCTGTGG - Intergenic
1089363514 11:117906999-117907021 AAAAGCCTATTGGAGCCTGGAGG + Intronic
1092019074 12:5185487-5185509 GAATACCTATAGGGGTCTGGTGG + Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093161225 12:15749222-15749244 AAAAACCTATTGGACAGTGTTGG - Intronic
1093277210 12:17144403-17144425 AAATACCTATTGAACTGTTCTGG + Intergenic
1095054057 12:37579777-37579799 AAATATGGACTGGACTCTGGAGG - Intergenic
1095149471 12:38774984-38775006 ACATACCTTTGGGATTCTGGGGG - Intronic
1097794600 12:63847766-63847788 ACATACATATTGGACTCTATAGG + Intronic
1101961283 12:109252212-109252234 ACATTCCCATTGGTCTCTGGTGG + Intronic
1103966258 12:124641780-124641802 AAATTCCTGTTGGCATCTGGCGG - Intergenic
1104292911 12:127485584-127485606 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1109057096 13:57564597-57564619 AAATGCCAATTGGACTCCTGCGG + Intergenic
1114376973 14:22157186-22157208 AAATACCTATTAGGTTCTGTAGG + Intergenic
1119052222 14:71380999-71381021 AAATGCCAATTGCACTATGGGGG - Intronic
1120312040 14:82841336-82841358 AAATAACTATTTGATTCTGTAGG - Intergenic
1124444559 15:29718567-29718589 AAATACTGCTTGGACTCTGCAGG + Exonic
1127236632 15:57059862-57059884 AGATGCCCATAGGACTCTGGTGG + Intronic
1127668412 15:61171403-61171425 ACAGACCTACTGAACTCTGGGGG - Intronic
1145864846 17:28234496-28234518 AAGCGCCTATTGAACTCTGGGGG - Intergenic
1156099383 18:33575620-33575642 ACATGCCAATTGAACTCTGGAGG + Intergenic
1157367960 18:47083850-47083872 AAATACCTATTTAACTCTCTGGG + Intronic
1158216071 18:55102127-55102149 TAATACCTAATGATCTCTGGTGG - Intergenic
1163856884 19:19709545-19709567 ATATACCTGGTGGGCTCTGGTGG + Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1167947121 19:52997217-52997239 AACTGCCTATTGCACACTGGAGG - Intergenic
1168291513 19:55359813-55359835 GAAGACCTCATGGACTCTGGGGG - Exonic
925234409 2:2265557-2265579 AAATCCCAATTAGACTCGGGAGG - Intronic
930518552 2:52435521-52435543 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
931698380 2:64889215-64889237 AAAGTCCTGTTGAACTCTGGGGG - Intergenic
931752975 2:65347120-65347142 AAAGAATTATTGGAGTCTGGAGG - Intronic
932150251 2:69364606-69364628 AAATACCTATTTGATTTTGGAGG - Intronic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
933004806 2:76978281-76978303 AAACAGCTAATGGAATCTGGGGG - Intronic
939759233 2:146153772-146153794 AAGTACCTATTGTACTCTAGGGG + Intergenic
940630773 2:156235685-156235707 AATTATATAATGGACTCTGGGGG + Intergenic
940729994 2:157377381-157377403 AAATGTCTATAAGACTCTGGAGG + Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
941026259 2:160459656-160459678 AAATACCTCCTGGTCACTGGAGG - Intronic
941856329 2:170234721-170234743 AAATACCAATTCTATTCTGGTGG + Intronic
943045745 2:182860371-182860393 AAATGTCTATTGGAATATGGAGG + Intronic
945893707 2:215458521-215458543 ACATACCTGTTGTACTCTGGTGG + Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947702772 2:232249043-232249065 ATATTCCTATTTGACTCTAGAGG + Intronic
948244500 2:236467907-236467929 AAATACCTATGAACCTCTGGAGG + Intronic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1172021670 20:31919092-31919114 AAATACCTAAAGGACTCTTCTGG + Intronic
1173692574 20:44974851-44974873 AAAAAACTGTTGGATTCTGGAGG + Intronic
1174975955 20:55334196-55334218 AAATACCTTTTAAACTTTGGAGG + Intergenic
1177321864 21:19532854-19532876 AAATACCTACAGAACTCTGAAGG - Intergenic
1184503406 22:44887429-44887451 AAAAACCTGTTGGATGCTGGCGG + Intronic
949158118 3:851155-851177 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
949884564 3:8682968-8682990 AAAGGCCTATTTAACTCTGGGGG + Intronic
949889523 3:8723450-8723472 AAGTTCCTTTTGGTCTCTGGAGG + Intronic
952724611 3:36570528-36570550 AAATACCCATTTGATTCTGTTGG + Intergenic
953762738 3:45704226-45704248 AAATAAATATAGAACTCTGGGGG - Intronic
954745525 3:52785463-52785485 AAATAACAATTGGTCACTGGGGG - Intronic
956297266 3:67728240-67728262 AAGTTCCTATGAGACTCTGGTGG + Intergenic
956883007 3:73530118-73530140 AAATTCCCATCGCACTCTGGGGG + Intronic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957044389 3:75362712-75362734 AAGGTCCTATTGAACTCTGGGGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
957169879 3:76724608-76724630 AAATAGATATTGGGGTCTGGAGG - Intronic
959715207 3:109425149-109425171 AATTACATAATGGACTTTGGGGG - Intergenic
960982276 3:123241047-123241069 AAATACCTGTTGGATTATGAAGG - Intronic
965284052 3:166794158-166794180 AATTACATAATGGACTTTGGGGG - Intergenic
966830469 3:184003690-184003712 AAATACCTGTTTTACTGTGGTGG - Intronic
967719429 3:192799587-192799609 GAATACCTGTTGCTCTCTGGAGG - Exonic
969024340 4:4161595-4161617 AAAGGCCTATTGAACTCTTGGGG - Intergenic
969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG + Intergenic
969785645 4:9455099-9455121 AAGGACCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970834851 4:20391083-20391105 AAATATCTATTTGACTCTAAAGG + Intronic
971378329 4:26073527-26073549 GAAAACCAATTGGACCCTGGTGG + Intergenic
972910815 4:43814128-43814150 AAATACATATTGAACAATGGAGG - Intergenic
973148238 4:46856712-46856734 AAATACCTCTTTGCCTCTAGGGG - Intronic
973844066 4:54893012-54893034 AAATCCCTTTGGGAATCTGGTGG + Intergenic
977558274 4:98506564-98506586 AAATGCCTACTGGCCTCTGAGGG + Intronic
981732622 4:147915574-147915596 AAATATATATTGGAATCTGGAGG + Intronic
985951715 5:3226899-3226921 AAATGTATAATGGACTCTGGAGG + Intergenic
990344724 5:54860850-54860872 AAAAACCTATTGTATTCTGAAGG - Intergenic
993158942 5:84263694-84263716 AAATACCTATAGAAATCTAGTGG + Intronic
993962099 5:94311065-94311087 ATAAACCTATTGCACACTGGAGG - Intronic
994599063 5:101878946-101878968 AAATGTCTATAGCACTCTGGAGG - Intergenic
996896708 5:128492840-128492862 AAATACCTATTGGCATATGGGGG + Intronic
998546706 5:143034780-143034802 AAATACCTGTTGGAATCCAGGGG - Intronic
1002114533 5:176948441-176948463 AAATACCTATTTTACTCTGTTGG - Intronic
1002807369 6:590129-590151 AAATCCCCAGTGGACTCTGATGG + Intronic
1004086281 6:12452705-12452727 AAATGCCAATTGGAAACTGGAGG - Intergenic
1008644322 6:53498139-53498161 AAATACCCATTGAACTCTGATGG - Exonic
1008739525 6:54588621-54588643 AAATTCCTAAAGGACTCTGGGGG - Intergenic
1009300525 6:62012181-62012203 AGATTACTCTTGGACTCTGGAGG - Intronic
1010056979 6:71578070-71578092 AAATATCTGTGGGTCTCTGGAGG + Intergenic
1011565351 6:88666944-88666966 AAAGGCCTATTGAACTCAGGGGG + Intronic
1012264390 6:97123470-97123492 AAAGACTTATTTGACTTTGGGGG + Intronic
1012611689 6:101227133-101227155 AAAGGCCTGTTGAACTCTGGGGG - Intergenic
1015431371 6:133133572-133133594 AAAAACCTATTGGGCTCAAGTGG - Intergenic
1015696289 6:135983669-135983691 AAATGCCTATAGGATACTGGGGG - Intronic
1018536103 6:164821153-164821175 AAATATCTATTAGACTCATGTGG - Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1022260856 7:28703575-28703597 AAATTCCAATTGGATTCTGAAGG + Intronic
1023337190 7:39182850-39182872 AAGTGCCTATCGGACTCTGATGG - Intronic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1030417379 7:109262529-109262551 AAATAACTAATGGACACTAGGGG - Intergenic
1031149303 7:118034680-118034702 TAAATCCTATTGGACTCTAGTGG + Intergenic
1032170776 7:129582843-129582865 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1034059650 7:148075099-148075121 AAATAGCTATAGGACTTTGTAGG - Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1037332128 8:17753276-17753298 AAATAACTCCTGGACTCTTGCGG - Intronic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039278388 8:35956286-35956308 AAAGGCCTATTAAACTCTGGGGG + Intergenic
1043127392 8:76416827-76416849 ACACATCTATTGGACTCTGTTGG - Intergenic
1051872596 9:21756016-21756038 AAATTTCTATGGGACACTGGGGG - Intergenic
1056205235 9:84313521-84313543 AAATACCTAGAGGAATTTGGAGG + Intronic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1060619249 9:125048312-125048334 AGATACCTACTGTACTCTGGTGG + Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1186778688 X:12891615-12891637 ACATAGCTATTGGACTTTGGAGG - Intergenic
1187836235 X:23435041-23435063 GAGTACCAAGTGGACTCTGGGGG + Intergenic
1188595253 X:31892436-31892458 AAATACATATTGGATTCCGAAGG + Intronic
1189011013 X:37045752-37045774 AAATCCCTCATGGACTCTTGAGG + Intergenic
1194783845 X:98057894-98057916 GAATACCTAGTGGATTCTTGGGG - Intergenic
1195437094 X:104857164-104857186 AAATACCTATTGGACTCTGGAGG + Intronic
1197722846 X:129756524-129756546 ATGTACCTGCTGGACTCTGGGGG + Exonic