ID: 1195444032

View in Genome Browser
Species Human (GRCh38)
Location X:104930420-104930442
Sequence TGTTTATAATATTGCAATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195444032_1195444034 4 Left 1195444032 X:104930420-104930442 CCATTATTGCAATATTATAAACA No data
Right 1195444034 X:104930447-104930469 CTGAGTGCTCACTATGTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195444032 Original CRISPR TGTTTATAATATTGCAATAA TGG (reversed) Intronic