ID: 1195449888

View in Genome Browser
Species Human (GRCh38)
Location X:104999230-104999252
Sequence CCTTCTATTGTTACAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 109}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195449888_1195449896 26 Left 1195449888 X:104999230-104999252 CCATCCATTGTAACAATAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 109
Right 1195449896 X:104999279-104999301 TACGTGGAGTGGGAGAGTGTGGG 0: 1
1: 0
2: 1
3: 11
4: 167
1195449888_1195449891 10 Left 1195449888 X:104999230-104999252 CCATCCATTGTAACAATAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 109
Right 1195449891 X:104999263-104999285 GCCAAGATACTATGTGTACGTGG 0: 1
1: 0
2: 0
3: 1
4: 30
1195449888_1195449897 27 Left 1195449888 X:104999230-104999252 CCATCCATTGTAACAATAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 109
Right 1195449897 X:104999280-104999302 ACGTGGAGTGGGAGAGTGTGGGG 0: 1
1: 0
2: 0
3: 24
4: 381
1195449888_1195449894 16 Left 1195449888 X:104999230-104999252 CCATCCATTGTAACAATAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 109
Right 1195449894 X:104999269-104999291 ATACTATGTGTACGTGGAGTGGG 0: 1
1: 0
2: 1
3: 7
4: 67
1195449888_1195449893 15 Left 1195449888 X:104999230-104999252 CCATCCATTGTAACAATAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 109
Right 1195449893 X:104999268-104999290 GATACTATGTGTACGTGGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 61
1195449888_1195449895 25 Left 1195449888 X:104999230-104999252 CCATCCATTGTAACAATAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 109
Right 1195449895 X:104999278-104999300 GTACGTGGAGTGGGAGAGTGTGG 0: 1
1: 0
2: 1
3: 26
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195449888 Original CRISPR CCTTCTATTGTTACAATGGA TGG (reversed) Intronic
902415207 1:16234546-16234568 CCTTCTATTTTTAATACGGATGG + Intronic
904920249 1:34002371-34002393 CCTTGTCTTGTGACAATGGCAGG + Intronic
910863455 1:91765602-91765624 CCTTTTATGGTTCCCATGGATGG - Intronic
911286183 1:95996202-95996224 CTTACTATTGTCACAATGGGTGG + Intergenic
912209478 1:107542881-107542903 CCTTCTATTATCACAATGCTGGG - Intergenic
920978502 1:210808972-210808994 CCTTCTATTTTCAGAAAGGAAGG + Intronic
1071345866 10:84692020-84692042 TTTTCTCTTGTTACAATGGAAGG - Intergenic
1072113893 10:92349766-92349788 CCTACTATTGCTACAATAGTTGG + Exonic
1072455009 10:95567794-95567816 ACTTCTACTGTGTCAATGGAAGG + Intergenic
1076577735 10:131481561-131481583 CCTTCAATGGTTAAAATGCAAGG + Intergenic
1078563020 11:12389641-12389663 CCTTCTCTTGTTGCCCTGGAGGG - Intronic
1083888937 11:65586149-65586171 TCCTCTTTTCTTACAATGGAAGG + Intronic
1088081909 11:105927630-105927652 ACCTCTATTGTTCCGATGGAAGG - Intronic
1088329038 11:108630600-108630622 CCTTATATTTTTAAAAAGGATGG + Intergenic
1093847396 12:23989572-23989594 CCTCCTAATGTCACATTGGAGGG - Intergenic
1098843642 12:75508985-75509007 CCTTTTATAGTTACGATGAAAGG - Intronic
1102415932 12:112762770-112762792 CCTGGTGTTGCTACAATGGATGG - Intronic
1105833526 13:24187552-24187574 CATGCTATTGTAACAATGAATGG - Intronic
1106393376 13:29357405-29357427 CCTTCTATTGTAACAGTGTCAGG + Intronic
1107125776 13:36844367-36844389 CCTTCTAATCTTAAAAAGGAAGG - Intergenic
1107363035 13:39640424-39640446 CCTCCTATTGTTACAGAGAAGGG + Intergenic
1108385102 13:49892523-49892545 CCTTCTTTGGATAAAATGGATGG + Intergenic
1108590519 13:51908673-51908695 CCTTCTTTGGATAAAATGGATGG - Intergenic
1110414626 13:75238394-75238416 CCTTCTTTGGATAAAATGGATGG - Intergenic
1111911613 13:94319317-94319339 TCTTGTATTGTTACAAAAGAGGG - Intronic
1114913323 14:27228903-27228925 CCTTATTTTTTAACAATGGAGGG - Intergenic
1117985630 14:61383845-61383867 CTTTCTAAAGTGACAATGGAAGG + Intronic
1126264673 15:46739814-46739836 CCATCAATTGTTACAATGAGGGG - Intergenic
1126266300 15:46757325-46757347 CCATATATTGTTACAATGAGGGG + Intergenic
1127747689 15:61997314-61997336 GCTTCTATTGTTACAATCAGAGG - Intronic
1131325302 15:91437867-91437889 CCTCCTAAGGTTTCAATGGAAGG - Intergenic
1135342029 16:21656958-21656980 CTTTCTATTTTTACAATCTATGG - Exonic
1138051249 16:53780850-53780872 TATTCAATTCTTACAATGGAGGG - Intronic
1140337879 16:74128194-74128216 CGTTCTATTGTTTCAATGCCAGG - Intergenic
1146221751 17:31029594-31029616 CCTTCTAATGGTAAAATTGATGG + Intergenic
1146442993 17:32913356-32913378 CATTCTAATGTTTCAAAGGAGGG - Intergenic
1150615315 17:66766026-66766048 CATCCTATTGTTACAATTGAAGG + Intronic
1155081619 18:22415947-22415969 CCTTCTTTGGATAAAATGGATGG - Exonic
1155191359 18:23433689-23433711 CCTTCTATTGTTTGAAAGAATGG - Intronic
1156392636 18:36665188-36665210 AGTTTTATTGTTATAATGGAAGG + Intronic
1158668929 18:59457222-59457244 CCTTCAATTGGTGCACTGGAGGG + Intronic
931451029 2:62367708-62367730 CCTTCTATTCTTGCAAGTGATGG + Intergenic
938242804 2:129756325-129756347 CCTCCTTTTGTTACAGTGGAGGG - Intergenic
940529425 2:154861642-154861664 CCTTCTTTTGTTTGAAAGGAAGG - Intergenic
941748122 2:169108894-169108916 TCTTCTATTTTTACTATGGAAGG - Intergenic
942759740 2:179384098-179384120 CCTTCTTTTGTTAAAACAGAGGG - Intergenic
947204990 2:227652395-227652417 TCTTCTATTTTTACAATTAAAGG + Intergenic
948371279 2:237490630-237490652 CATTCTATTTTCAGAATGGATGG - Intronic
948841094 2:240649397-240649419 CCTTCTGTTCTGACAAGGGAAGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1171153302 20:22846950-22846972 CCTTCTCTTGTTATAAGGGTGGG - Intergenic
1179938412 21:44620997-44621019 TCTTCTCTGATTACAATGGAAGG - Intronic
1181311850 22:21949219-21949241 CCTGCTCTTGTTACAAAGGCAGG + Intronic
949861541 3:8509771-8509793 CATTCTACTGTTACACTGTAGGG - Intronic
950422372 3:12906544-12906566 CCTCCTTTTGTTTCAATGGCAGG + Intronic
950435618 3:12977828-12977850 CCTTCTTTTGTCCCAGTGGAAGG + Intronic
952502329 3:33975311-33975333 CCTAATCTTGTTCCAATGGAAGG + Intergenic
952770600 3:36996180-36996202 CCTTTTATATTTACGATGGAGGG - Intronic
956712252 3:72048989-72049011 CCCTCTCTTGTTACACTGGCAGG + Intergenic
956788989 3:72666113-72666135 CCTTCTATTGTGTCAATAGAAGG - Intergenic
956788990 3:72666113-72666135 CCTTCTATTGACACAATAGAAGG + Intergenic
958603058 3:96323854-96323876 CCATGTATTGTCACAATGGATGG - Intergenic
958938932 3:100288712-100288734 CATTCTACTATTACAAGGGAAGG - Intronic
962112093 3:132462470-132462492 CCTTTTATTATTGCCATGGAAGG - Exonic
962702883 3:138016469-138016491 CCTTCTACTGTTTCCAGGGAAGG - Intronic
964178670 3:153857125-153857147 CCTTCTATTGTTATAATTTCTGG - Intergenic
964342818 3:155726415-155726437 GCTTCTATTGTTACATTGTCAGG + Intronic
964647555 3:158974402-158974424 GCTTCTCCTGCTACAATGGAAGG - Intronic
965692317 3:171370930-171370952 CCATATATTATTACAATGGGTGG + Intronic
968312255 3:197693871-197693893 CCTTATATTGTGACACTGGAAGG - Intronic
970831596 4:20346364-20346386 TTTTTTATTGTTACAATTGAGGG - Intronic
971415246 4:26420969-26420991 CCTTCTGTTGTTACAGTGACTGG + Intronic
972875273 4:43351046-43351068 CCTTCTATTGTCCAAAGGGAAGG - Intergenic
974981554 4:68963912-68963934 CCCTCTTTTGTTACAGTGGAAGG + Intergenic
979272088 4:118774935-118774957 CCTTCTCCTGTTACAATGGAAGG + Intronic
979957779 4:126976016-126976038 GATTCTATTATTTCAATGGATGG - Intergenic
980624913 4:135362414-135362436 AATTCTATTGTGACCATGGAAGG - Intergenic
982122573 4:152156970-152156992 CCTTCTGTTGTTTGAATGGCTGG + Intergenic
982844720 4:160235659-160235681 TTTTCAATTGTTAGAATGGAAGG + Intergenic
987770567 5:22297819-22297841 CCATCTTTTATTCCAATGGAAGG + Intronic
987960362 5:24799418-24799440 CCTTGTTTTATTACAATGGATGG + Intergenic
990504425 5:56430551-56430573 CCTTCCATTGTTTCCCTGGAGGG - Intergenic
994431074 5:99662026-99662048 CCATCTGTTGATACTATGGAAGG - Intergenic
994718645 5:103354080-103354102 CCTTCCATTTATACAATGGTGGG + Intergenic
995040735 5:107585119-107585141 CCTTCCATTCCTGCAATGGATGG + Intronic
1000444977 5:161308221-161308243 TCAACTATTGTCACAATGGATGG - Intronic
1002453889 5:179334781-179334803 CCATCTATTGGTACACAGGAAGG - Intronic
1004758517 6:18639958-18639980 CTTTCTATTGTTACCATGAATGG + Intergenic
1005200669 6:23340873-23340895 CGCTCTATTGTTACAAGGCAGGG - Intergenic
1007163658 6:39812611-39812633 CCTTCTATTCTTAGTGTGGATGG + Intronic
1013802297 6:113961628-113961650 CCTTGTATTGTCACCATGTAAGG - Intronic
1014596883 6:123354882-123354904 TATTTTATTGTTACAATGTAAGG - Intronic
1015342054 6:132112004-132112026 CATTCTATTGTTAGAATAGGTGG + Intergenic
1016156919 6:140822169-140822191 TCTTCTCCTGTTCCAATGGATGG - Intergenic
1016815892 6:148302404-148302426 CCTTCTAATGTTAAAATGGTAGG - Intronic
1017879296 6:158548602-158548624 CCTTCCTTTGTTCCAAGGGATGG + Intronic
1018938127 6:168287361-168287383 CCTTCTTTGGATAAAATGGATGG - Intergenic
1019999123 7:4744897-4744919 GCTTTTATTGTAACAATGGAAGG - Intronic
1020861475 7:13497128-13497150 CCTTCTATGGTTACAGTGCTAGG - Intergenic
1021036298 7:15803481-15803503 CCTTCTATTTTCACAAAAGAAGG - Intergenic
1021036299 7:15803481-15803503 CCTTCTTTTGTGAAAATAGAAGG + Intergenic
1021777686 7:24069674-24069696 GCTTCTATTTGTAGAATGGAAGG - Intergenic
1022046896 7:26628785-26628807 ACTTCTAATTTTATAATGGAAGG - Intergenic
1022233764 7:28441161-28441183 CTTTCTATTTTTAAAAGGGAGGG - Intronic
1023630375 7:42157838-42157860 TGTTCTATTGTTTCAAGGGATGG - Intronic
1032306353 7:130734967-130734989 CTTTCTATTATTAAAATGGTGGG - Intergenic
1035870686 8:3133496-3133518 CCTGTTACTGTTACACTGGAAGG + Intronic
1041664774 8:60432550-60432572 CCTTGTATTGTTTCACAGGAAGG + Intergenic
1043559376 8:81472691-81472713 CATTCTATTAACACAATGGAAGG - Intergenic
1046332311 8:112734946-112734968 CTTTCTATTGTTACAAATGGGGG - Intronic
1047714863 8:127586226-127586248 CCTTCTATTGTCCCAGTGAATGG + Intergenic
1050586839 9:7121783-7121805 CCTTCCATTGATTGAATGGAAGG - Intergenic
1061563072 9:131419112-131419134 CCCTCTGATGTTACAATAGATGG - Intronic
1186627206 X:11307040-11307062 CCTTCTCTGGTTCCAAAGGATGG + Intronic
1193882881 X:86946663-86946685 CATTCTATTTTTTAAATGGATGG - Intergenic
1195449888 X:104999230-104999252 CCTTCTATTGTTACAATGGATGG - Intronic
1195449889 X:104999230-104999252 CCATCCATTGTAACAATAGAAGG + Intronic
1197394822 X:125913960-125913982 CCAACTATTTTTAAAATGGATGG - Intergenic
1198746146 X:139892583-139892605 CCTTTTATGGGTACAATGGTTGG - Intronic
1199174463 X:144769180-144769202 ACTTCTATTGTTACAGTGAAAGG + Intergenic
1199202163 X:145104684-145104706 CCTTATATTATCACATTGGAAGG - Intergenic
1200020607 X:153202751-153202773 GCTTCTATTTTTAAAATGTACGG - Intergenic
1200740608 Y:6849944-6849966 CCTTCTCTGGTTCCAAAGGATGG - Intergenic
1201280897 Y:12341054-12341076 CCTTATATTGTATCAGTGGAGGG - Intergenic
1202028013 Y:20544799-20544821 CCTTGGATGGTTACAGTGGATGG + Intergenic