ID: 1195450497

View in Genome Browser
Species Human (GRCh38)
Location X:105006716-105006738
Sequence TCTTGGAAACAGTAGTTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195450497_1195450500 17 Left 1195450497 X:105006716-105006738 CCTATGAACTACTGTTTCCAAGA 0: 1
1: 0
2: 0
3: 22
4: 238
Right 1195450500 X:105006756-105006778 TTTGAGATTGTGTCACTGTTGGG 0: 1
1: 0
2: 0
3: 22
4: 245
1195450497_1195450499 16 Left 1195450497 X:105006716-105006738 CCTATGAACTACTGTTTCCAAGA 0: 1
1: 0
2: 0
3: 22
4: 238
Right 1195450499 X:105006755-105006777 TTTTGAGATTGTGTCACTGTTGG 0: 1
1: 0
2: 0
3: 24
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195450497 Original CRISPR TCTTGGAAACAGTAGTTCAT AGG (reversed) Intronic
900682920 1:3927592-3927614 GCTTGCAAACAGCAGCTCATGGG - Intergenic
902310323 1:15577089-15577111 TCATGAAAACAACAGTTCATAGG - Intronic
904779808 1:32937311-32937333 TGTTGGTAAAAGCAGTTCATGGG + Intronic
905787336 1:40768805-40768827 TCTCGGAAAAAGTACTTCATAGG + Intronic
906958464 1:50397639-50397661 TCTTGGTAAGACTATTTCATGGG - Intergenic
907361389 1:53918722-53918744 TTTTGGCAAGAGTACTTCATAGG + Intronic
908321257 1:62981278-62981300 ACATGGAAACAGTGGTTCATTGG - Intergenic
908343965 1:63212342-63212364 AATTAGAAACAGTTGTTCATAGG + Intergenic
908642946 1:66245429-66245451 CCCTAGAAACAGTAGGTCATGGG - Intronic
910141855 1:84034779-84034801 ACTTGCAAACAGCAGATCATGGG + Intergenic
910816303 1:91294486-91294508 GGTTGGAAACTATAGTTCATGGG + Intronic
910904280 1:92158145-92158167 TCTTGTAGACAGTATATCATTGG + Intergenic
911493569 1:98600635-98600657 TGCTGGAAACAGTAGATGATGGG - Intergenic
917300350 1:173567567-173567589 TCTTGGAGACAACAGATCATTGG + Intronic
918467740 1:184838630-184838652 TCTTGGGGACAGTTATTCATGGG + Intronic
918644036 1:186881914-186881936 TCTTGGACACAGGAGTGAATAGG + Intronic
918956927 1:191219444-191219466 TCTTGCACACAGAAGATCATGGG + Intergenic
919717601 1:200795704-200795726 TCTTGGAAACACTTCTTCATTGG + Intronic
923695250 1:236242649-236242671 AGTTGGAAATAGTAGTTCTTTGG - Intronic
924604213 1:245518303-245518325 GCCTGGAAACAGTAGATCATGGG + Intronic
1062894779 10:1094929-1094951 ACTTGGAAACAGGAGGTAATGGG + Intronic
1063495014 10:6498993-6499015 TCTTGGGAACAGCATTTCAGAGG + Intronic
1067185463 10:44023571-44023593 TCTTTGAAACATTTTTTCATGGG + Intergenic
1068196843 10:53728113-53728135 TTTTGGAAATGGTAGTTTATTGG - Intergenic
1068702364 10:60033539-60033561 ACTTGGAAACAGCAATTCATTGG + Intronic
1068840190 10:61604157-61604179 TCTTGTAGACAATAGATCATTGG + Intergenic
1068998936 10:63242095-63242117 TTTAGGAAACAGAAGTTCACAGG + Intronic
1069366019 10:67693521-67693543 ACATGCAAACAGAAGTTCATGGG + Intronic
1071269014 10:83990071-83990093 GCTTGCAAACAGTAGATCATGGG + Intergenic
1071737767 10:88320525-88320547 TCTTGAAAACAGTAGATGGTTGG - Intronic
1071859879 10:89661556-89661578 TCTTGGCAAGACTACTTCATAGG - Intergenic
1073783998 10:106867936-106867958 TCTTGAAGACAGCATTTCATGGG - Intronic
1075981792 10:126746680-126746702 TCTTGGAAATCGTAATTCAACGG - Intergenic
1076439524 10:130471560-130471582 TCTTGGAAACAGAAATTGTTGGG + Intergenic
1078079885 11:8196326-8196348 TCATGAGAACAGAAGTTCATGGG + Intergenic
1078733383 11:13997329-13997351 TTTTGGAATCATTAGATCATTGG + Intronic
1079027842 11:16962794-16962816 TCTTAGAAACACAAGTTCAGGGG - Intronic
1079086962 11:17453285-17453307 TGTTGGAAAGAGAAGTTCAGAGG + Intronic
1079425757 11:20340965-20340987 ACTTGCAAACATTAGTTCTTTGG + Intergenic
1083868963 11:65475263-65475285 TGGTGGAAACACTAGTTCAAAGG + Intergenic
1083999948 11:66290579-66290601 TCTTGGACACAGATGTTTATTGG - Intergenic
1085204202 11:74720809-74720831 TCCAGGAAACAGGAGCTCATGGG + Intronic
1085375456 11:76056702-76056724 TCTTGGCAAGAATACTTCATAGG + Intronic
1085571861 11:77566423-77566445 TCTTGCAGGCAGTAGATCATTGG + Intronic
1086020468 11:82223034-82223056 TCTTGTAAACAGTAGATAGTTGG + Intergenic
1086094468 11:83036619-83036641 TCATGAGAACAGTAGTTCTTTGG - Intronic
1086123375 11:83325159-83325181 TCTTGTAACCAGTAAATCATTGG + Intergenic
1086660648 11:89411899-89411921 TCTTGTAACCAGCAGATCATTGG - Intronic
1087438814 11:98157421-98157443 GCTTGCAGACAGTAGATCATGGG - Intergenic
1087765815 11:102152066-102152088 GATTAGAAACAGTAGTTAATAGG + Intronic
1087824355 11:102747619-102747641 TCTTGTAAGCAATAGATCATTGG + Intergenic
1088163807 11:106907159-106907181 GCTTGGAAACAACAGTTCTTTGG - Intronic
1088431178 11:109760636-109760658 TGTTGGAAAGAGTATTTCCTAGG + Intergenic
1088655085 11:111991405-111991427 CCTTGGCATCAGTAGTTCAAAGG - Intronic
1089169330 11:116501146-116501168 CCTTGGAAACAGAAGCTCAGCGG + Intergenic
1090956799 11:131520409-131520431 TCTTGGAACCAGGAGTCCACTGG + Intronic
1094757742 12:33492107-33492129 TCTTGTAGGCAGCAGTTCATTGG - Intergenic
1095831726 12:46594646-46594668 TCTTGTAAACAGTATATAATTGG + Intergenic
1097660327 12:62423126-62423148 TCTTGGGAACAGTATATAATTGG - Intergenic
1097860246 12:64511706-64511728 TCCTGGAAACAATATTTGATTGG - Intergenic
1099591459 12:84596395-84596417 TGTTGGAAACAGTTGTGCATTGG + Intergenic
1099945996 12:89245038-89245060 TCTTGGAGAAAGTATTTCAGAGG + Intergenic
1101743211 12:107517619-107517641 TCTTTGAAACAGTTGTGAATGGG + Intronic
1103215852 12:119200820-119200842 TCTTGGAGAGGGTACTTCATAGG + Intronic
1105236971 13:18565745-18565767 GCTTGCAAACAGCAGTTGATAGG + Intergenic
1105455025 13:20532572-20532594 TTTGGAAAACAGTAGTTCACAGG + Intergenic
1105491901 13:20896595-20896617 TGTTGGAACCATTAGTTCTTTGG - Intronic
1106651696 13:31697528-31697550 TCTTGGATACATTATTTCAGAGG + Intergenic
1107610527 13:42108164-42108186 TCTTGGAAGCATTTCTTCATAGG + Intronic
1109952254 13:69513517-69513539 TCTTGGAAACATTATTACAGAGG + Intergenic
1110616377 13:77546738-77546760 TCTTGGAAGGAGAAGTTCAGAGG + Intronic
1110755930 13:79173877-79173899 TCTTGAAGACAGCAGATCATTGG - Intergenic
1111306072 13:86414639-86414661 TGTTGGAAAAAGTTGTTCATCGG - Intergenic
1112807857 13:103182891-103182913 TTTTGGAAACATTATTTCAGGGG + Intergenic
1115420720 14:33191965-33191987 TTTTAAAAACAGTAATTCATGGG + Intronic
1120100346 14:80437754-80437776 TCTTGTAGGCAATAGTTCATTGG - Intergenic
1125737645 15:41938984-41939006 TCTAGGAAACAGTATTTCAGCGG + Intronic
1126571896 15:50161277-50161299 TCTTGTAAGCAATAGATCATTGG + Intronic
1127811199 15:62567120-62567142 TCTTGTAAACAGTATTTTACTGG + Intronic
1129987123 15:79927784-79927806 CCTTGAAAAGAGTAGTTCACTGG + Intergenic
1130303649 15:82699004-82699026 TCTTGGGAACAGAAGTTGGTGGG - Intronic
1131850932 15:96542500-96542522 TGTTGGAAACAGAAGCTCAGAGG - Intergenic
1133674170 16:8054219-8054241 TCTTGGAGTCAGGAATTCATAGG - Intergenic
1133949887 16:10382366-10382388 TCCTGGGAAATGTAGTTCATAGG + Intronic
1136178427 16:28534417-28534439 ACTTGGAGTCAGTGGTTCATGGG - Intronic
1137775847 16:51053664-51053686 TCTTGGAGCTGGTAGTTCATGGG + Intergenic
1140637560 16:76933826-76933848 TCTTAGAAATAGTATTTCCTCGG + Intergenic
1143346218 17:6251094-6251116 CCTTGGAAACAGGAGCTCCTGGG + Intergenic
1144436186 17:15244805-15244827 TCGTTGCAACAGTAGTTCCTGGG - Intronic
1145187772 17:20810448-20810470 TATTGGAATCAGTAGTTGACTGG - Intergenic
1146867120 17:36347033-36347055 TATTGGAACCAGTAGTTGACTGG + Intronic
1147069990 17:37947642-37947664 TATTGGAACCAGTAGTTGACTGG + Intergenic
1147081512 17:38027162-38027184 TATTGGAACCAGTAGTTGACTGG + Intronic
1147097463 17:38151137-38151159 TATTGGAACCAGTAGTTGACTGG + Intergenic
1149109805 17:53014784-53014806 TATTTGAAACAGTACTTCATAGG + Intergenic
1150079169 17:62221260-62221282 TATTGGAACCAGTAGTTGACTGG + Intergenic
1150634847 17:66905678-66905700 TCTTGGACAGAGGATTTCATGGG + Intergenic
1151416212 17:73967183-73967205 TCATGGAAACTATACTTCATAGG + Intergenic
1153118094 18:1685577-1685599 TCTGGGAAACAGTAGAACAGTGG + Intergenic
1153325600 18:3816502-3816524 TCTTGAAAACAGTGGTTTGTAGG + Intronic
1156197229 18:34788601-34788623 TCATGGAAACTTTATTTCATTGG - Intronic
1158660465 18:59382613-59382635 TTTTGGCAAGAATAGTTCATAGG + Intergenic
1159611423 18:70530116-70530138 GCTTGCAAACAGCAGATCATGGG - Intergenic
1160548392 18:79677643-79677665 AGTTGGAACCAGGAGTTCATGGG + Intergenic
1162287753 19:9752306-9752328 TTTTAGAAACAGTATTTCAAGGG + Intronic
1162899765 19:13787780-13787802 TTTTTGAAACAGAAGTTCATGGG - Intergenic
1164629528 19:29753030-29753052 TCTGGGAAATACTAGTTCTTGGG - Intergenic
925203188 2:1985411-1985433 CCTTGGAAAGAGTAATTCCTAGG - Intronic
925934931 2:8747420-8747442 TCTTAGATTCAATAGTTCATTGG + Intronic
927909053 2:26883728-26883750 TCTTGCAAACAATAGTTGAGGGG - Intronic
928479341 2:31666223-31666245 ACCTGGAAGCAGTAGTGCATTGG - Intergenic
928690774 2:33796476-33796498 ACTTGAAAACTGTAGTTGATAGG + Intergenic
928715286 2:34053406-34053428 TCTTGTAGGCAGTAGTTCACTGG + Intergenic
929812843 2:45206328-45206350 TCTTGCAAACAGCATTCCATCGG - Intergenic
931590903 2:63882258-63882280 CCTTGCACACAGTAGTTCAGTGG - Intronic
931933070 2:67162701-67162723 ACTTGGACAGAGTATTTCATTGG - Intergenic
932271110 2:70411181-70411203 TCTTGGAAAAATTAATTCCTGGG - Intergenic
933047861 2:77560673-77560695 TTTTTGAAACATTAGTTCAGAGG + Intronic
933421621 2:82054038-82054060 TCTTGGAAACAACAGATGATTGG + Intergenic
933795445 2:85915727-85915749 TCTTGGAACCAGTGCTTCCTTGG - Intergenic
933832919 2:86225066-86225088 TGGTGGACACACTAGTTCATGGG - Intronic
935607577 2:104985939-104985961 ATTTGGAGACTGTAGTTCATGGG - Intergenic
938512816 2:131968804-131968826 GCTTGCAAACAGCAGTTGATGGG - Intergenic
938550029 2:132371462-132371484 TTTTCAAAACAGTAGTTGATTGG - Intergenic
939364032 2:141209637-141209659 TCTTGGAAAAAGGATTTCATGGG - Intronic
940340691 2:152577760-152577782 TCTTGGCAAGAACAGTTCATTGG + Intronic
941306526 2:163875847-163875869 TCTTTGAAACATTATTTCACTGG + Intergenic
941620088 2:167767869-167767891 GCTTGCAAACAGCAGATCATGGG - Intergenic
944234735 2:197431636-197431658 TTTTGGAAATAGTTGTTCACCGG - Intronic
944702349 2:202257416-202257438 TCTAGGAAACAGTAATTTACAGG + Intergenic
945671120 2:212803896-212803918 TCATTGAAACAGTAGTGAATAGG + Intergenic
945864053 2:215156922-215156944 TCTTGGAAACTCTAGATAATAGG + Intergenic
945994820 2:216427310-216427332 TTTTGGAGACAGTAGTTGGTAGG + Intronic
948913008 2:241014637-241014659 TCTTGGTAACACCAGGTCATAGG + Intronic
1169064022 20:2683030-2683052 TCTTTGAAGCAGTAGTGAATGGG + Intergenic
1169595386 20:7192652-7192674 CCATGGAATCAGTGGTTCATAGG - Intergenic
1173211598 20:41037510-41037532 TCTTTGAAATAGTAATTCTTGGG + Intronic
1175075721 20:56371147-56371169 TTTTGGCAAGAGTACTTCATAGG - Intronic
1176780958 21:13194030-13194052 GCTTGCAAACAGCAGTTGATAGG + Intergenic
1177978639 21:27883143-27883165 GCTTGCAAACAGCAGTTGATGGG + Intergenic
1178871597 21:36381805-36381827 TCTTGCAGACAGCAGATCATGGG - Intronic
1178943753 21:36929139-36929161 TCTTGGACAGAGTAGTGGATAGG - Intronic
1180571686 22:16728303-16728325 TCTTAAAAATAGTACTTCATTGG - Intergenic
1182773956 22:32817370-32817392 TCTTGGGAAAATTAGTTCCTTGG - Intronic
1183308590 22:37097319-37097341 TCTGGGAAACAGTAGTTGGGAGG + Intronic
1183879620 22:40816378-40816400 TTTTGAAAACAGTATTTTATTGG + Intronic
950312087 3:11967537-11967559 GCTTGGAGACAGCAGTTCGTGGG + Intergenic
951060358 3:18199709-18199731 TCTTGAAAACAGCAGATGATTGG + Intronic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
955227028 3:57068860-57068882 TGTTGGAACCGGCAGTTCATAGG - Intronic
956405268 3:68922237-68922259 TCCTGGAAACAGAAATTCACAGG + Intronic
956628776 3:71293312-71293334 ACATGGATACAGTAGTTCAGTGG + Intronic
957106509 3:75896167-75896189 TCTTAAAAATAGTACTTCATTGG + Intergenic
958198115 3:90268489-90268511 GCTTGGAAACAGTATTTTGTAGG - Intergenic
958890711 3:99779598-99779620 ACATGGAAACACTAGTTCAAAGG - Intronic
959017540 3:101152720-101152742 TAGTGGAAACAGTAATACATTGG - Intergenic
959326222 3:104940206-104940228 TCTTGGAAACAGTTTTTTAGGGG - Intergenic
959913340 3:111789879-111789901 TCTTGGAAACAATGATTCTTTGG + Intronic
959925599 3:111918302-111918324 TCATGGAAAAACTGGTTCATCGG - Intronic
960008311 3:112804965-112804987 TGTTGTAAACTGTAGATCATAGG + Intronic
960311391 3:116120479-116120501 TCTGGGAGACTGAAGTTCATGGG + Intronic
960379466 3:116941480-116941502 TCTTGAAAACAGCAGATAATTGG - Intronic
962540435 3:136376352-136376374 TCATGGAAACAGTACTTCCCTGG + Intronic
962758951 3:138491563-138491585 TCTTGCAAGCAATAGATCATTGG + Intergenic
962813881 3:138981447-138981469 TCTTGGTCACAGCAGTTCACAGG + Intergenic
964090018 3:152864748-152864770 TCTTAGAAACACTAGTGCTTAGG - Intergenic
964858228 3:161170704-161170726 TTTTCCAAACAGTAGTCCATGGG - Intronic
965874824 3:173303599-173303621 TCTTGGAAACAGTCTCTCAAAGG - Intergenic
966478459 3:180377431-180377453 TCTTGGAAAGGGTGGTTTATGGG - Intergenic
967401197 3:189062994-189063016 TCTTGTAATCAGTATATCATTGG - Intronic
968655781 4:1777912-1777934 TCTTGGAGACAGCAGGCCATGGG + Intergenic
970520554 4:16879677-16879699 GCTTGCAAACAGCAGATCATGGG + Intronic
970762292 4:19505333-19505355 TTTTGGAAAAAATATTTCATAGG + Intergenic
973708161 4:53600434-53600456 TCTTGGAAGCAAAAGTTCCTGGG - Intronic
974282436 4:59815120-59815142 TCTTGTAACCTGAAGTTCATAGG + Intergenic
975423828 4:74202747-74202769 TTTTTGATACAGTACTTCATTGG + Intronic
975915819 4:79324610-79324632 TTTTGGAAAGAATATTTCATAGG + Intronic
976606304 4:86986459-86986481 TTTTGGAAAGACTATTTCATAGG - Intronic
979192472 4:117878840-117878862 TCTTGGAAACAGTCATGAATTGG + Intergenic
982496625 4:156102713-156102735 TCTTGGAGACAGTATTCCAGTGG - Intergenic
986739744 5:10695666-10695688 TCCTGGAAGCAGTAGTTCTGAGG - Intronic
992898644 5:81270393-81270415 TCCTGGAAACATAACTTCATTGG + Intergenic
993951984 5:94187329-94187351 TGGTGGAAGCAGGAGTTCATTGG + Intronic
994854043 5:105093612-105093634 TCTTGTAAACAACAGATCATTGG - Intergenic
995071644 5:107929643-107929665 TCTTGGAATCATTGTTTCATAGG - Intronic
995105560 5:108373965-108373987 TCTTGTAAACAGTATATAATTGG - Intronic
996313984 5:122140945-122140967 CCTTGGCATCAGTAGCTCATGGG - Intronic
997438822 5:133894146-133894168 TCTTGCAATCAGAAGTTCAGAGG - Intergenic
1001310501 5:170606868-170606890 TCTTGGACAAAGTAGTGCTTCGG - Intronic
1002397479 5:178969408-178969430 TCTAGGAAACACTGGTTCTTTGG - Intergenic
1004080214 6:12385092-12385114 TCTTGGATATAGTTGTTCATGGG + Intergenic
1005707907 6:28474572-28474594 TCTTGTAAACAGGAGATCCTGGG - Intergenic
1006215110 6:32434838-32434860 TCTTGGAAACTGTGATGCATTGG + Intergenic
1008021656 6:46585180-46585202 TCTTGGAAACAATAGTCAACAGG + Intronic
1009740586 6:67739343-67739365 TCTTGGAAACAGTGCCTAATTGG + Intergenic
1011641156 6:89417689-89417711 TGCTGAAAACAGTAGTTCCTGGG - Intergenic
1012839293 6:104309216-104309238 TCTTGGAAACAACACTTTATGGG + Intergenic
1013714754 6:112945390-112945412 TCTAGTAAACAGAAATTCATGGG + Intergenic
1014220658 6:118795769-118795791 TCCTGGAAACTAGAGTTCATTGG + Intergenic
1022254891 7:28646088-28646110 GCTTGCAGACAGTAGATCATAGG + Intronic
1026435498 7:70393430-70393452 TCCTGGACACAGTATTTCACTGG + Intronic
1027867132 7:83662490-83662512 TCTAGAAAACCGTAGTTCATAGG - Intergenic
1028067927 7:86411844-86411866 TCTTGAAAACAGTATTTTGTAGG - Intergenic
1029692864 7:102193964-102193986 TCGTAGAAACAGTGGATCATGGG - Intronic
1030728490 7:112955599-112955621 TTTTGGAAAGAGTAGGTCATAGG + Intergenic
1030829047 7:114198260-114198282 GATTGGAAACAATAGGTCATTGG + Intronic
1031700296 7:124917152-124917174 TCTTGGTAGCAGTAGGTCCTGGG - Intronic
1032007171 7:128312101-128312123 TCTTGAAGAGAGTATTTCATAGG - Intronic
1035133675 7:156678619-156678641 CTTTGGAAACATGAGTTCATGGG + Exonic
1037034405 8:14147295-14147317 TCTTGGAGGCAATAGATCATTGG - Intronic
1037553644 8:20000932-20000954 TTTTGGAAACACTACTTCATTGG + Intergenic
1037609894 8:20467184-20467206 TCTTGGGAAGATTAGTCCATTGG + Intergenic
1040518365 8:48153201-48153223 TCCTGGAAACAGAAGTCCGTGGG - Intergenic
1040812325 8:51468554-51468576 TCGTGAAAACAGTAGTCTATTGG - Intronic
1041450540 8:58001919-58001941 TCTTGGAGACAGCAGATCATGGG - Intronic
1041657098 8:60363761-60363783 GCTTGCAAACAGTAGATCACAGG + Intergenic
1041922218 8:63195024-63195046 TTTTGGCAACAGGAGTTCCTCGG + Intronic
1042006008 8:64180852-64180874 TCTTGTAAACAGTATATAATTGG - Intergenic
1042820553 8:72925495-72925517 TCTTTTAAACAACAGTTCATTGG - Intronic
1042862386 8:73327494-73327516 TCCTGGAAACTGTTGTTCTTTGG + Intergenic
1042879767 8:73474051-73474073 TCTTGCAGACAATATTTCATTGG - Intronic
1042964220 8:74333710-74333732 GCTTGGACAGAGTAGTTCTTGGG - Intronic
1043669990 8:82872231-82872253 TCTGAGATACAGTAGTTTATAGG + Intergenic
1043939326 8:86179084-86179106 TCTTGGCAAAAGTAGTTTCTTGG + Intergenic
1044584929 8:93860387-93860409 TCTTGGAGACACCAGTTTATGGG - Intronic
1044589177 8:93897070-93897092 TCTTGGAAACAGTTCTACAATGG + Intronic
1044828022 8:96217053-96217075 AATTTGAAACAGTTGTTCATTGG + Intergenic
1046384608 8:113493214-113493236 TCTTGCCAACAGCAGTTCATAGG + Intergenic
1046606492 8:116376952-116376974 ACTTGGAAAATTTAGTTCATTGG - Intergenic
1047880541 8:129187635-129187657 TCTTAGAAACAATAGCTAATTGG - Intergenic
1050034514 9:1421410-1421432 TCTTGGAAAAAGTAGTGCTTGGG - Intergenic
1052186804 9:25607426-25607448 TCTTGTAAAAATTGGTTCATAGG + Intergenic
1053301098 9:36950145-36950167 TGTTGGTTACAGTAGTTCAAGGG - Intronic
1054894271 9:70290305-70290327 TCTTGTAAACAGTAGATAGTTGG + Intronic
1055663438 9:78530436-78530458 GCTTGCAAACAGCAGATCATGGG - Intergenic
1058128692 9:101225504-101225526 TCTGGGAAACAGGAGTTTATGGG - Intronic
1059057076 9:110995069-110995091 TCCTGGAAACAGAAGTACTTAGG - Intronic
1059892649 9:118819889-118819911 TCTGAGAGACTGTAGTTCATAGG + Intergenic
1060299076 9:122363492-122363514 TCTTGGTACCAGGAGTTCCTGGG - Intergenic
1060335550 9:122718558-122718580 TCTTGGAATCACTAGTTTCTGGG - Intergenic
1061175164 9:128991101-128991123 TCTTGGAATAAGGAGATCATAGG - Intronic
1061199702 9:129130345-129130367 TCTTGGGAACAGCACTTCACTGG - Intronic
1061779215 9:132985813-132985835 TTTTGGAATCAGTGGTTCGTGGG - Intronic
1187548698 X:20279742-20279764 TTTTGAAAACAATACTTCATAGG - Intergenic
1188486653 X:30689459-30689481 TCTTGGAAGCAGCAGTGCAAGGG + Intronic
1188555273 X:31404955-31404977 TATTGAAAACTGTATTTCATTGG - Intronic
1190452842 X:50598161-50598183 TATAGGAAACAGTAGAGCATGGG - Intronic
1191225852 X:58042426-58042448 TCTTGAAGACAGTATGTCATTGG - Intergenic
1191705719 X:64092702-64092724 TTTTGGTAAGAGTACTTCATAGG - Intergenic
1191939991 X:66468323-66468345 TCTTGGAAGCAATTGTTAATGGG - Intergenic
1192379932 X:70605149-70605171 TTTTGGAAAGAGTGGTCCATAGG + Intronic
1193408693 X:81136783-81136805 TCTTGCAAACAGTATATCATTGG - Intronic
1195450497 X:105006716-105006738 TCTTGGAAACAGTAGTTCATAGG - Intronic
1196945678 X:120822973-120822995 CCTTGGAAGCAATAATTCATGGG + Intergenic
1197371434 X:125630541-125630563 TCTTGAAAACAGTAGATATTTGG - Intergenic
1197767295 X:130067301-130067323 TCTTGGAAACTGGCGTTCAGGGG + Exonic
1198974877 X:142325471-142325493 TCTTGGAAACAACATTTCATTGG + Intergenic
1198989285 X:142492089-142492111 TCTTAGAAACATAAGTCCATGGG + Intergenic
1199156428 X:144554030-144554052 TCTTGTAGGCAGTAGTTCAATGG - Intergenic
1199740838 X:150734694-150734716 TCTAGGAAACAGTATTTTCTAGG + Intronic
1199994171 X:153009286-153009308 TCTTGGCAACCCTAGTCCATTGG + Intergenic