ID: 1195457844

View in Genome Browser
Species Human (GRCh38)
Location X:105089524-105089546
Sequence TAGGGGATGGAAAATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 365}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195457844 Original CRISPR TAGGGGATGGAAAATGAGGT GGG (reversed) Intronic
901130884 1:6962255-6962277 TGGGGGGAGTAAAATGAGGTGGG - Intronic
901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG + Intronic
902296470 1:15470533-15470555 TTGGAGATGTAAAATGAGGGGGG - Intronic
902299266 1:15489825-15489847 TTGGAGATGTAAAATGAGGGGGG - Intronic
902328974 1:15721244-15721266 GAGGGGAGGGGAAATGGGGTGGG - Intronic
902729067 1:18356917-18356939 TAGGGGATGGAGATTGAGGATGG + Intronic
902790820 1:18766641-18766663 TACAGGATGGAAAATAAGGCTGG + Intergenic
903008710 1:20315439-20315461 TACAGGAGGGAAAAGGAGGTGGG + Intronic
903392181 1:22972426-22972448 GAGGGGCTGGAAAAAGAGGAGGG + Intergenic
903467723 1:23563852-23563874 CAAGGGATGGAAAATGGTGTGGG + Intergenic
905432644 1:37935639-37935661 TAAGGAATGGAAAATGAGGCTGG - Intronic
905810733 1:40911194-40911216 GAGGGCAAGGAAAATGAGGCTGG + Intergenic
908321071 1:62979478-62979500 TAGGGGATGGAGGATGGGTTGGG - Intergenic
909230839 1:73087739-73087761 GAGGGGGTGGAAAATGGGGATGG - Intergenic
909361408 1:74763650-74763672 TTTGGGTTGGAAAGTGAGGTAGG + Intronic
909610973 1:77551543-77551565 TTGGGGTTGGAAATAGAGGTGGG + Intronic
910926228 1:92400726-92400748 TAGAGGCTGGAAAAAGAGTTTGG + Exonic
911062831 1:93762648-93762670 TTGGGGATGGAATATGTGGTAGG - Intronic
912222050 1:107689464-107689486 TGGGGCATGGAACAGGAGGTTGG + Intronic
912400773 1:109389964-109389986 TGGGGGATGGAAAGAGAGGAGGG - Intronic
912490595 1:110060681-110060703 CTGGGAATGGAAAAAGAGGTGGG + Exonic
914899077 1:151702535-151702557 TAGGGAAAAGAAAATGGGGTGGG - Exonic
914986036 1:152457876-152457898 TAGGAACTGGAAACTGAGGTAGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916064697 1:161126698-161126720 GATGTGATGGGAAATGAGGTTGG - Intronic
916084438 1:161258535-161258557 GCGGGGACGGAAAATGAAGTAGG - Intergenic
917418329 1:174834856-174834878 TAAGTGCTGGAAAATGAGGTTGG + Intronic
918237102 1:182591534-182591556 AGGTGGATGGATAATGAGGTCGG - Intergenic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
919538901 1:198824845-198824867 AAAGGGATAGAAAAGGAGGTGGG + Intergenic
920952100 1:210582139-210582161 TAGGTGTTGGAAAATCAGGGAGG + Intronic
922089099 1:222378589-222378611 CTTGGGATGGAAAATGAGATGGG - Intergenic
922794037 1:228330279-228330301 CAGGGAAGGGAAACTGAGGTAGG - Intronic
923161267 1:231316900-231316922 GAGGGGATGGAAAGGGAGGCAGG - Intergenic
923456218 1:234167865-234167887 TAGGGGATAGAACATGGGCTGGG - Intronic
923697752 1:236270856-236270878 TAGGGGATGGATGATGGGGTAGG + Intronic
923979161 1:239301584-239301606 TGGGGGCTGGAAAATGAGGAAGG - Intergenic
1063088249 10:2838921-2838943 TCGGGGATGGAAAACGTGGTAGG - Intergenic
1063542156 10:6944721-6944743 GTGGGGCTGGAAAATGAGGCTGG + Intergenic
1064516696 10:16157175-16157197 TAGGGGACGGAAACTGAGTCTGG - Intergenic
1065161694 10:22928892-22928914 TAGGGGATAGAAGTTGAGGCAGG + Intronic
1066012942 10:31210908-31210930 CAGGGGATGGGAAATGAGACAGG - Intergenic
1066746459 10:38606486-38606508 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1067056950 10:43058060-43058082 TGGGGGATGGAGAAGGAGGGAGG - Intergenic
1068724677 10:60288175-60288197 TCGGGGAGGGAAAGTGAGGAGGG - Intronic
1070059325 10:72967300-72967322 AAGGGGAGGGAAGATCAGGTGGG - Intergenic
1071120690 10:82274042-82274064 TAGGAGGTGGAAAATGAGGCAGG - Intronic
1071273529 10:84030986-84031008 TATAGGATGGACAATGAGTTTGG - Intergenic
1071741580 10:88364433-88364455 CTGGGGATGTAAAATGAGGATGG - Intronic
1072025671 10:91453454-91453476 CAGGGGATGGTAAGGGAGGTAGG + Intronic
1072671770 10:97435271-97435293 TAGAGGATAGAAACTAAGGTGGG + Intergenic
1072826679 10:98613736-98613758 TAGGGGAGGGGCAAGGAGGTGGG - Intronic
1073044041 10:100625846-100625868 GAGGGGAGGGAAAGGGAGGTGGG - Intergenic
1076531697 10:131149273-131149295 TGGAGGCTGGAAAATGAGGCTGG + Intronic
1076862300 10:133144162-133144184 TACGGGATGGAACATGAGAGCGG - Intergenic
1077868290 11:6240751-6240773 TAGGTGATGGAACCTGAGGGAGG + Intronic
1078314590 11:10282917-10282939 AAGTAGATGGAAACTGAGGTAGG - Intronic
1079275336 11:19030339-19030361 TAGGGGATGGAGATGGAGATGGG + Intergenic
1079312841 11:19381589-19381611 GAGGGCATGGATAGTGAGGTGGG + Intronic
1079329266 11:19520596-19520618 TAGAGGATGGGAAAGGAGGAAGG - Intronic
1080809484 11:35689041-35689063 TAGGGAGGGGAAAAAGAGGTGGG + Intronic
1081691878 11:45083863-45083885 CAGGGGTTGAAAGATGAGGTAGG - Intergenic
1082637688 11:55616575-55616597 TAGACTATGGAAAATGATGTTGG + Intergenic
1082757210 11:57089634-57089656 TAGGAGATGGACAATGAGTGTGG + Intergenic
1083105461 11:60354144-60354166 TGAAGGATGGAAAATGAGGAGGG - Intronic
1084139519 11:67215968-67215990 TAGGGGTTGGAATCTGAAGTTGG + Intronic
1084214688 11:67640929-67640951 TGGGGGATGTAAAAGGAGGAGGG + Intergenic
1084215594 11:67645419-67645441 TTGGGAAGGGAAACTGAGGTGGG + Intronic
1085257785 11:75186062-75186084 GAGGGGTAGGAAAATGAGGCTGG - Intronic
1085294453 11:75423240-75423262 CAGGGGATGGAGAAGAAGGTAGG + Intronic
1085302706 11:75467709-75467731 GAGGGGATGGAGGCTGAGGTGGG + Intronic
1085389557 11:76175569-76175591 TATGGGGTGGAAAATGAGGCTGG - Intergenic
1086728568 11:90220392-90220414 TAAGGGCTGAAAAAGGAGGTTGG + Intronic
1086885822 11:92204693-92204715 GAGGGGGTGGAAAAAGAGGAGGG - Intergenic
1087622677 11:100560264-100560286 TAGGAGGTGGAAAAAGAAGTGGG - Intergenic
1088672856 11:112160337-112160359 TACGGGATGAAAGATGAGGCAGG - Intronic
1089055369 11:115580728-115580750 TAGGAAATTGAAAAAGAGGTAGG + Intergenic
1089593768 11:119561554-119561576 GAGGGGAAGGAAAAAGAGGAAGG - Intergenic
1089822327 11:121239916-121239938 TAGGGGTTGCAAAATGATGAAGG - Intergenic
1090845234 11:130524608-130524630 TAGGGCATGGCAAATGGGTTGGG + Intergenic
1094003455 12:25721792-25721814 CAGGGGAAGGGAAATGAGGGTGG + Intergenic
1095578190 12:43763699-43763721 GAGGGGAGGGAAAATGGGGGTGG - Intronic
1096496023 12:52039941-52039963 GAGTGGCTGGGAAATGAGGTTGG + Intronic
1099287089 12:80726706-80726728 TAGGGAATGGTTAATCAGGTTGG + Intergenic
1102201175 12:111059137-111059159 TGAGGGCTGGAAAATGAGGCTGG - Intronic
1102722486 12:115029316-115029338 AAGGGAGTGGAAAATGAGGCAGG + Intergenic
1103050606 12:117776163-117776185 GAGGGGAAGGAATATGGGGTTGG - Intronic
1103403893 12:120661309-120661331 TGGGGGTTGGAAAATTAGGGCGG - Intronic
1104284890 12:127416050-127416072 TGAGGGCTGGAAAATGAGGCTGG + Intergenic
1104388705 12:128373712-128373734 TGGGGGATGGGGAAGGAGGTAGG + Intronic
1104506981 12:129341515-129341537 TGAGGGCTGGAAAATGAGGCTGG + Intronic
1104508162 12:129352075-129352097 TAAGGGCTGGAAAGTGAGGCTGG + Intronic
1104800425 12:131551817-131551839 TGAGGGCTGGAAAATGAGGTTGG - Intergenic
1104950994 12:132440039-132440061 ATGGGGATGGAGAACGAGGTTGG - Intergenic
1105474191 13:20717093-20717115 GAGGTGATGGAAACTGAGCTGGG - Intronic
1106056884 13:26246181-26246203 TAGGCAATGGAAAATCACGTAGG + Intergenic
1106136257 13:26975858-26975880 TAGGGGGTGGACAATGGGGCAGG + Intergenic
1106227652 13:27797045-27797067 GAGGGGATGGAAACGGCGGTGGG + Intergenic
1106773282 13:32983749-32983771 TAGGGGATGAATCATGAGTTTGG - Intergenic
1107699017 13:43028629-43028651 TAGGGGATGTGAAATGTGGCTGG - Intronic
1108561510 13:51648623-51648645 TAGGGGAGGGAACTTGAGGATGG + Intronic
1109574864 13:64242070-64242092 AAGGTCATGGAAAATGAGGAAGG + Intergenic
1110205298 13:72905043-72905065 TATGGGATTTAAAGTGAGGTTGG - Intronic
1110659173 13:78038614-78038636 AGGGGGATGGAAAATGACGTTGG - Intergenic
1110717306 13:78720976-78720998 TAGGGGAAGGAAAAGAAGGAGGG + Intergenic
1111186383 13:84741709-84741731 CAGGGGATGGAAATTGTAGTGGG + Intergenic
1111623230 13:90750557-90750579 TAGGGGATAGAAAGTGATGGCGG - Intergenic
1111886291 13:94025949-94025971 TTTGGCATGAAAAATGAGGTAGG + Intronic
1111973952 13:94946164-94946186 TAGGGGATGGAACCTGAGCCTGG - Intergenic
1112354687 13:98664103-98664125 TGAGGGCTGGAAAATGAGGCTGG - Intergenic
1112492234 13:99877379-99877401 CAGGGCAAGGAAAATGAGGGTGG - Intronic
1113429100 13:110233763-110233785 TGGTGGAGGGAAAATGAGATGGG - Intronic
1113627196 13:111856070-111856092 AGGGGGATGGAAGGTGAGGTGGG + Intergenic
1114657675 14:24325813-24325835 AAGGAGATGGAGAAAGAGGTGGG - Exonic
1115167527 14:30465604-30465626 TAGGATATGGAGAATGAAGTTGG - Intergenic
1115315787 14:32023604-32023626 TGGGGGATGGAGGAAGAGGTGGG + Intergenic
1118397901 14:65353295-65353317 TAGGGGTTGGCCAAGGAGGTTGG - Intergenic
1119586506 14:75840737-75840759 TAGGGCATGGAAATTAAGGTTGG - Intronic
1119905885 14:78301596-78301618 TAGGGGCTGGAGAATTAGGGAGG - Intronic
1120501309 14:85300528-85300550 TTGAGGATGGGAAATGATGTGGG - Intergenic
1120849114 14:89152920-89152942 TAGAGGATCTAGAATGAGGTGGG + Intronic
1120863162 14:89273240-89273262 TAGGAGGTGGAAACTGAGGCTGG - Intronic
1121160721 14:91737261-91737283 TAGAGGGTAGAAAATGAGGCTGG + Intronic
1121251962 14:92506094-92506116 TTGGGGATGGAAGAGGAGATGGG + Intergenic
1123913675 15:24998469-24998491 CAGAGGATGGAATTTGAGGTAGG + Intergenic
1125496281 15:40197476-40197498 AAGGGTACAGAAAATGAGGTAGG + Intronic
1125496864 15:40204488-40204510 TAGGGGATGAAAATTCTGGTAGG - Intronic
1128447204 15:67774535-67774557 TAGGGGATGGGAAAGAAAGTGGG + Intronic
1130555937 15:84922569-84922591 TACGGGAAGGAAGAAGAGGTAGG - Intronic
1131828995 15:96342453-96342475 TTGGGGATGGAGATAGAGGTGGG - Intergenic
1133417387 16:5616893-5616915 GAGGGGGTGGAAAAAGAGGCAGG - Intergenic
1133445644 16:5858746-5858768 TAGGAGATGGGAAGGGAGGTAGG + Intergenic
1133564146 16:6977496-6977518 TGAGGGCTGGAAAATGAGGCTGG - Intronic
1133657738 16:7882559-7882581 CAGAGGGTGGAAAGTGAGGTGGG + Intergenic
1134892584 16:17854062-17854084 AAGGAGATGGAAGATGAGGGAGG + Intergenic
1135828365 16:25750797-25750819 GCGGGGAAGGAAAATGAAGTAGG - Intronic
1136544354 16:30947449-30947471 CAGGGGATGGACAATGAAGCAGG - Exonic
1136736602 16:32473156-32473178 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1140872236 16:79117485-79117507 TTGGGAATGGTAAATGAGCTTGG + Intronic
1140980454 16:80104057-80104079 AAGGGCATGGAAAAAGAAGTCGG - Intergenic
1141175237 16:81714163-81714185 TGGGGGATGGTCATTGAGGTAGG - Intergenic
1141239706 16:82254322-82254344 AGGGGGATGAAAACTGAGGTAGG + Intergenic
1141673728 16:85506567-85506589 TTGAGGATGGAAGAGGAGGTTGG + Intergenic
1203016466 16_KI270728v1_random:356421-356443 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1203034801 16_KI270728v1_random:629579-629601 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1142529081 17:566553-566575 TAGGGGATGGGAATGGAGGGTGG + Intronic
1143883648 17:10050194-10050216 TAGGGGATGTCAAATGTGATGGG - Intronic
1144034669 17:11354485-11354507 TGGAGAATGGAACATGAGGTCGG - Intronic
1144363366 17:14518235-14518257 TAGGGAATGGAATTTCAGGTTGG + Intergenic
1144765134 17:17728469-17728491 CAGAGGATGCAAAATGGGGTAGG + Intronic
1145026358 17:19470774-19470796 TGAGAGATGGAAAATGAGGCAGG - Intergenic
1145780535 17:27560084-27560106 TCGGGGATAGGAAATGAGATGGG + Intronic
1149065989 17:52479807-52479829 TAGGTGATAGAGAATGAGATGGG + Intergenic
1150995900 17:70317152-70317174 TGGAAGATGCAAAATGAGGTTGG - Intergenic
1151035519 17:70794110-70794132 GAGGGGATGGGAAATCAGATTGG + Intergenic
1151529650 17:74696123-74696145 TGAGAGATGGAAAATGAGGAAGG + Intronic
1152377950 17:79928351-79928373 TAGGGGATGGAGTAAGATGTGGG + Intergenic
1152486430 17:80597220-80597242 GAGGGGATGGAACTTGAGCTGGG + Intronic
1152721153 17:81924388-81924410 TGGGGGATGGAGCATGAGGCGGG - Intronic
1153580525 18:6569060-6569082 TAAGGGATGAAAAATGAGAAAGG + Intronic
1154087710 18:11323345-11323367 TAGTGGATGGAAATGGACGTGGG - Intergenic
1154369350 18:13744989-13745011 TAAAGGATGGAAAAGTAGGTGGG + Intronic
1155232400 18:23786199-23786221 TTGGGGATGGATAATGAAGGGGG - Intronic
1155649374 18:28121967-28121989 AAGGTGATAGAAAATGAGGGTGG + Intronic
1157277965 18:46325677-46325699 TAGGGGCTGGGAAATCAGGTGGG - Intergenic
1157354041 18:46917267-46917289 GAGGGGATGGGAGAGGAGGTGGG - Intronic
1157508167 18:48246572-48246594 TCGCAAATGGAAAATGAGGTAGG + Intronic
1157911754 18:51623131-51623153 CAGGGGCTGGAAGATGAGGAAGG + Intergenic
1158075053 18:53518262-53518284 AAAGGAATGGAAAATGAAGTAGG + Intronic
1158798871 18:60881861-60881883 TAGAGAATAGAAAATGAGGCTGG + Intergenic
1159318607 18:66814879-66814901 GAGGGTAAGGAAAATGAGGAAGG + Intergenic
1160860067 19:1233958-1233980 TAGGGAATGTCAAATGAGGTGGG + Intronic
1161459690 19:4389398-4389420 AAGTGGAGAGAAAATGAGGTTGG + Intronic
1161660136 19:5540729-5540751 TAAGGGAGGGAAACTGAGGCTGG + Intergenic
1161697598 19:5778229-5778251 TAGTGGATGGAAACAGAAGTGGG + Intronic
1162609237 19:11736889-11736911 CAGGGAATGGAAACTGGGGTGGG + Intronic
1163038408 19:14584948-14584970 GATGGGATGGAAAATGGGTTGGG - Intronic
1163039104 19:14589209-14589231 GATGGGATGGAAAATGGGTTGGG - Intronic
1163470243 19:17492456-17492478 TAGAGGATGGGAAATTAGCTAGG + Intronic
1163492739 19:17626466-17626488 AAGGGGATGGAAAGTTGGGTGGG - Intronic
1164836482 19:31358135-31358157 CATGGGATGGAATATGGGGTGGG - Intergenic
1165292942 19:34904146-34904168 TAGGAGATGGCACATCAGGTGGG - Intergenic
1165786935 19:38467212-38467234 GAAGGGATGGAAATTCAGGTTGG - Intronic
1166329007 19:42068179-42068201 TCAGGGAGGGAAACTGAGGTGGG + Intronic
1167271781 19:48510282-48510304 TGGGGGATGGAAATTGGGCTGGG - Intronic
1167749430 19:51370944-51370966 CGGGGGATGGAAAATGAAGAGGG - Intergenic
1168412596 19:56149009-56149031 TGGGGGATGGAAGCAGAGGTCGG - Intronic
1168472155 19:56648500-56648522 TAGGGGATGGATATGTAGGTGGG - Intronic
1168515674 19:57008767-57008789 TAGGGGTTGGTGAATGAGGAGGG - Intergenic
925212635 2:2063030-2063052 AAAGGGATGGAAAATAAGATTGG - Intronic
926304456 2:11627978-11628000 CAGGGGATGGGAAGTGATGTGGG + Intronic
927149772 2:20188936-20188958 TAGGGGATCGGAAGTGAGGGTGG - Intergenic
927557699 2:24047622-24047644 TAAGGGAGGGAAAATGTGGCGGG - Intronic
928207752 2:29298833-29298855 TGGGGGAGAGAAAATGAGCTGGG - Intronic
931081447 2:58776285-58776307 TAAGGGATTAAAAATCAGGTTGG + Intergenic
931415847 2:62079541-62079563 GAGGGCAAGGAAAATGAGGCTGG - Intronic
934040158 2:88121746-88121768 TACGTGCTGGACAATGAGGTAGG + Intergenic
934187756 2:89762273-89762295 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
934308861 2:91845675-91845697 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
935209886 2:100930241-100930263 TCATGGATGGAAGATGAGGTGGG + Intronic
937331014 2:121030010-121030032 GAGGGGATGGAGAATGCAGTGGG + Intergenic
939459434 2:142480234-142480256 TTGGGCATGAAAAATGAGGAAGG + Intergenic
939721892 2:145663880-145663902 AAGTGGAAGGAAAGTGAGGTGGG + Intergenic
941158490 2:162007981-162008003 TAAGCGATGGAAGATGAGGGAGG - Intronic
941215877 2:162708342-162708364 TAGGCCAGGGAATATGAGGTAGG + Intronic
941584743 2:167343652-167343674 TAGGGGGAGGAATATGAGGGAGG - Intergenic
942616375 2:177795512-177795534 TAGGGCATGGAGAAGGGGGTGGG + Intronic
944896930 2:204174695-204174717 TACCGGATGGCAAATTAGGTAGG + Intergenic
945427914 2:209730109-209730131 TGGGAGATGGAGAAAGAGGTAGG + Intronic
945990404 2:216391423-216391445 TTGGTGAGGGAAAATGAGCTGGG - Intergenic
946159655 2:217828370-217828392 TAGGGGGTGGAAAATCAAGGTGG + Intronic
946353079 2:219168362-219168384 TGAGGGATGGGAAAGGAGGTGGG + Intronic
946463663 2:219892192-219892214 AAGAGGAAGGAAAATGAGGAGGG + Intergenic
946572276 2:221037441-221037463 TATGAGATGGAAATTGAGGTGGG + Intergenic
946880467 2:224171971-224171993 TATGGAATGGAAAATGAGGGTGG - Intergenic
947178382 2:227390618-227390640 TGAGGGCTGGAAAATGAGGCCGG - Intergenic
947184854 2:227445743-227445765 TGAGGGCTGGAAAATGAGGCTGG - Intergenic
1168854769 20:1000991-1001013 AAGGGGAAGGAAAATGAGAGAGG - Intronic
1168867138 20:1096622-1096644 AAGGGGAGGGAACATGAGGAGGG - Intergenic
1169203991 20:3730031-3730053 TAGGGGCTGGAAAAAGAGTTTGG + Intergenic
1170902150 20:20474617-20474639 TTGAGGATGGTTAATGAGGTGGG + Intronic
1173122521 20:40306832-40306854 TAGAGGATGTAAAATGAGGAGGG + Intergenic
1178229424 21:30764331-30764353 TAGGGAATGGAACATGTGCTGGG + Intergenic
1179339368 21:40489834-40489856 TAGGGGATGGAAGATGTCTTAGG - Intronic
1180164834 21:46019686-46019708 AAGGAGATGGGAAAGGAGGTGGG - Intergenic
1180535944 22:16392763-16392785 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1181696569 22:24595597-24595619 TGGGGGCTGGAGAATCAGGTAGG + Intronic
1181869110 22:25883986-25884008 CATGGGATATAAAATGAGGTGGG + Intronic
1182500679 22:30744492-30744514 TAGGGCATGGCAAAAGAGCTGGG - Intronic
1182922007 22:34088843-34088865 GAGTGGAAGGAAAATGTGGTGGG - Intergenic
1184576551 22:45372520-45372542 TTGGGAATGGAAAATGAAGAGGG + Intronic
949211773 3:1511635-1511657 AAGGGAATGGGAAATGAGATCGG - Intergenic
949236004 3:1808890-1808912 TTGGGGATGGTAATTGTGGTGGG - Intergenic
949423396 3:3890628-3890650 AACTGGATGGAAAATGAGTTTGG - Intronic
949608899 3:5683580-5683602 TAGGGAAAGAAAAATTAGGTTGG - Intergenic
950121570 3:10485409-10485431 GAGGGATTGGAAAAGGAGGTGGG + Intronic
950402862 3:12783766-12783788 TAGAGCATGGAAAGGGAGGTGGG + Intergenic
950407521 3:12814010-12814032 GATGGGATGGTAAATGAGATTGG + Intronic
950983266 3:17331891-17331913 ACGGGTTTGGAAAATGAGGTTGG + Intronic
951651209 3:24953750-24953772 TAGGGGAACGTATATGAGGTGGG - Intergenic
953353906 3:42237996-42238018 TTGGGGGTGGAAAATGGGGATGG + Intergenic
953973336 3:47363879-47363901 GAGGGGATGGAAAATGGGATGGG + Intergenic
954492118 3:50916092-50916114 TAGGGGATGGGACATGGTGTCGG + Intronic
955476203 3:59338981-59339003 TAGGGAATACAAAATGAGTTTGG - Intergenic
956290084 3:67651999-67652021 TTGGGGATGGTGAATGAGGCAGG - Intronic
956781421 3:72606229-72606251 TAGGGGATGGCAAATAAGACTGG - Intergenic
956798895 3:72739304-72739326 TGGGGGAAGGAAGATGAGGAGGG - Intergenic
957983883 3:87547480-87547502 TAGCAGATGGAAACTAAGGTAGG + Intergenic
958709897 3:97705255-97705277 GAGGGGATGGGAAATGTGGGAGG - Intronic
960520387 3:118647702-118647724 AAGGGGATGTAAAATAAGCTTGG - Intergenic
962046111 3:131760874-131760896 AAAGGGATGGCAAATGAGATGGG + Intronic
962188963 3:133290144-133290166 TAGGGGATAGGAAATGTGGAGGG + Intronic
962228909 3:133642400-133642422 AAGGGCATGGAAAAGAAGGTAGG - Intronic
962278034 3:134030268-134030290 GAGGGGATGGAGAAAGAGGTTGG + Intronic
962377130 3:134867635-134867657 TTGGTGATGGAAAATGGGATGGG + Intronic
963351707 3:144159775-144159797 AAGGGGCTGGAAATTGAGATTGG + Intergenic
963751070 3:149180498-149180520 AATGGGATGGAAAATGAGTGTGG - Intronic
964002092 3:151787207-151787229 TAGGGGAAGGAGAAAGAGATGGG - Intergenic
965678058 3:171220522-171220544 GAGGGGAATGAATATGAGGTGGG + Intronic
965783585 3:172313735-172313757 AAGGGGATGGGAAATGAGAGGGG - Intronic
966636341 3:182138165-182138187 TAGAGGAAGGAAAAGGAGGGAGG + Intergenic
969256773 4:6007766-6007788 TGGTGGATGGGTAATGAGGTGGG + Intergenic
970792993 4:19881156-19881178 TTGGAGAGGGAAAATAAGGTTGG - Intergenic
970886148 4:20989610-20989632 TAGGTCATTGAAAATGAGTTTGG + Intronic
972884994 4:43474945-43474967 GAGGAGATAGAAAATGAGATGGG - Intergenic
973130843 4:46647096-46647118 TAGGGTATGGAAAAAGAAGGAGG + Intergenic
974765125 4:66334322-66334344 ATTTGGATGGAAAATGAGGTTGG - Intergenic
975101652 4:70520988-70521010 TGAGGGAGGGGAAATGAGGTAGG + Intronic
975391308 4:73821002-73821024 TAGAAGATGAAAAATGAGTTGGG + Intergenic
976749563 4:88440558-88440580 TAGGGCATGAAAAACGAGTTAGG + Intronic
977601403 4:98937296-98937318 TCGGGGAGGGACAAAGAGGTAGG + Intergenic
977916675 4:102601863-102601885 TAGGGGAAAGACAGTGAGGTGGG - Intronic
977993452 4:103473798-103473820 TAGGGGAAGGAAAGGGAGGTGGG - Intergenic
978179407 4:105775358-105775380 AACTGGATGGAAAATGAGTTTGG - Intronic
979408541 4:120344614-120344636 AAGGGGATTGAAAATCAGTTAGG + Intergenic
980741251 4:136952363-136952385 TAGGGGAAGGAAAATCAGAGAGG + Intergenic
981160593 4:141494181-141494203 TAGAGGCTGGAAAATCAGGCAGG - Intergenic
981308760 4:143274866-143274888 CAGGAGATGGAGACTGAGGTAGG + Intergenic
981374001 4:143992597-143992619 TAGGGGAAGGGAATTGTGGTTGG + Intergenic
981957734 4:150499925-150499947 TAGAGGTTGGAAAGTGAGGTGGG + Intronic
982137149 4:152282498-152282520 CTGGGGATGGAAGATGAGATGGG + Intergenic
982714901 4:158796489-158796511 TGGGGGAGGGAAGATGGGGTGGG + Intronic
984792776 4:183629466-183629488 AAGGGGATGGGACATGAAGTTGG + Intergenic
987474269 5:18371725-18371747 TAAGGAAAGGAAAATGAGTTTGG - Intergenic
987728456 5:21735141-21735163 TACGGAATGGAAAATGAAATAGG + Intergenic
988584245 5:32495053-32495075 TAGGGAATGGAGAATAAGATGGG + Intergenic
988948310 5:36230206-36230228 ATGGGGAGGAAAAATGAGGTAGG - Intronic
990534164 5:56703837-56703859 TAGAAGATGGAAAAAGAGATGGG - Intergenic
990640053 5:57772940-57772962 GAGGAGATGGTAAATTAGGTGGG + Intergenic
990982495 5:61614723-61614745 TTGTTGATGGAAAATTAGGTTGG + Intergenic
991278072 5:64874723-64874745 CAGGGTTTGGAAAATGAGGAGGG - Intronic
992646855 5:78819258-78819280 TGAGGGATGGGAAGTGAGGTTGG - Intronic
994040820 5:95258129-95258151 TACAGTATGGAAAATGGGGTGGG + Intronic
994397857 5:99240961-99240983 TAGGGAAGGGAGAATGAGGATGG + Intergenic
994458663 5:100047465-100047487 TAAGGGTTGGGAAACGAGGTTGG + Intergenic
995005970 5:107195638-107195660 TAGGGGTTGGAATAGGAGTTAGG + Intergenic
995373389 5:111445957-111445979 TGGGGGAAGGGAAATCAGGTAGG + Intronic
996206943 5:120750942-120750964 CAGTGGCTGGAAAATGTGGTAGG - Intergenic
998018525 5:138751916-138751938 TAGGGGATGGGCAATGTGCTGGG + Intronic
998833818 5:146185317-146185339 GAGGGTATGGAAAGTGAGGGAGG - Intergenic
998855910 5:146395041-146395063 TTAAGGATGGGAAATGAGGTTGG + Intergenic
1001330210 5:170756672-170756694 AAGGGTAAGGAAAAGGAGGTTGG + Intergenic
1001722005 5:173864586-173864608 CAGGAGACGGAAAGTGAGGTTGG + Intergenic
1001947640 5:175793766-175793788 TAGGGGATGGGAAATTAGGCAGG - Intergenic
1002552670 5:180008027-180008049 TATAGGAGGGAAAAGGAGGTGGG + Intronic
1005518924 6:26581239-26581261 AGGGGGATGGAAAAGGAGTTTGG + Intergenic
1006139455 6:31919529-31919551 TGGGGGCTGGAAAATGAGGTGGG - Intronic
1006410532 6:33870940-33870962 GAGGGGAAGGAAAGTGATGTGGG - Intergenic
1006834210 6:36986688-36986710 GAGGAGATGGAAAATGCGATCGG - Intergenic
1007201541 6:40113943-40113965 TAGGGGATGCAAGTTGTGGTAGG + Intergenic
1007201545 6:40113962-40113984 TAGGGGATGCAAGTTGTGGTAGG + Intergenic
1007201549 6:40113981-40114003 TAGGGGATGCAAGTTGTGGTAGG + Intergenic
1007201553 6:40114000-40114022 TAGGGGATGCAAGTTGTGGTAGG + Intergenic
1007201557 6:40114019-40114041 TAGGGGATGCAAGTTGTGGTAGG + Intergenic
1007201561 6:40114038-40114060 TAGGGGATGCAAGTTGTGGTAGG + Intergenic
1007770327 6:44186784-44186806 TAGGCCATGGAACAAGAGGTGGG - Intergenic
1007938892 6:45758341-45758363 TAGGATATGGGAAATGATGTGGG - Intergenic
1009377775 6:62993273-62993295 TAAAAGATGGAAAATGAAGTGGG - Intergenic
1009611643 6:65950318-65950340 AAGGAGAAGGAAAATGTGGTTGG - Intergenic
1011720960 6:90156157-90156179 GTGGGGAGGGAAACTGAGGTAGG + Intronic
1012115073 6:95286234-95286256 TAGGGGGTGGGGACTGAGGTAGG + Intergenic
1013332205 6:109114681-109114703 CAGGGGATGGGAAGAGAGGTGGG + Intronic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1015332853 6:132001649-132001671 GAGGGCAGGGAAAATGAGGCTGG + Intergenic
1015370099 6:132440832-132440854 GAGGGCAGGGAAAATGAGGCTGG - Intergenic
1015780126 6:136856680-136856702 TTGGGAATGGAAAATGAGAGAGG + Intronic
1016079100 6:139833961-139833983 TGGGGGCTGAAAAATGAGATCGG - Intergenic
1017651058 6:156582977-156582999 TAGGGGATAAAAATGGAGGTGGG + Intergenic
1019813551 7:3182816-3182838 TAGAGGCTGGAACAGGAGGTGGG - Intergenic
1021675492 7:23076532-23076554 TAGGGGAAGGACAATGAGGAAGG + Intergenic
1021689098 7:23214927-23214949 TAAGGTTTGGAAAATGGGGTTGG - Intergenic
1021781235 7:24108776-24108798 TTGTGGCTGGAAAAAGAGGTAGG - Intergenic
1022818694 7:33937903-33937925 AGGGTGATGGAAAATGAGGCTGG - Intronic
1023174962 7:37426925-37426947 TATGGCATTGAAAATGAGTTAGG - Intronic
1023472036 7:40533691-40533713 TAAGTGATGGAAAATCAAGTAGG - Intronic
1023792533 7:43764557-43764579 TAGGGGCTGGAAAGTGGGGTGGG + Intronic
1023924631 7:44657598-44657620 TAGGGCATAGAAGCTGAGGTAGG - Intronic
1024078464 7:45836077-45836099 TTGCGGAGGGAAAATGAGCTTGG + Intergenic
1028173134 7:87623474-87623496 TAGGGTATGGATAGTGAGGTGGG - Intronic
1028273922 7:88827683-88827705 GAGTGGAGGGAAAACGAGGTGGG - Intronic
1029556927 7:101276812-101276834 TTGTGGAGGGAAAATGAGCTTGG - Intergenic
1031379941 7:121073324-121073346 GAGGAGATGGAAAAAGAGGAGGG + Intronic
1031744197 7:125472743-125472765 GAGGAAAGGGAAAATGAGGTGGG + Intergenic
1032413777 7:131720399-131720421 TGGGGCATGGAAAAAGGGGTGGG + Intergenic
1034777392 7:153841413-153841435 AAGGGGATGAAAAAGCAGGTAGG - Intergenic
1035703613 8:1656554-1656576 AAGGGGTTTGCAAATGAGGTGGG + Intronic
1035779118 8:2213591-2213613 TAGATGATAGAAAATTAGGTAGG - Intergenic
1038329373 8:26596023-26596045 CAGGGGATGAAAAAGCAGGTAGG + Intronic
1038949329 8:32397082-32397104 TAGGAGATGGATAAATAGGTAGG + Intronic
1039447680 8:37645790-37645812 GAGGCGATAGAAAGTGAGGTTGG + Intergenic
1039785331 8:40829700-40829722 TGGGGGATGGAAAGTGATATAGG + Intronic
1041327994 8:56689485-56689507 TAGTGGATGGAATTTAAGGTAGG + Intergenic
1042592156 8:70406237-70406259 AAGGGATTGGAAGATGAGGTGGG - Intergenic
1043342335 8:79255365-79255387 TAGGGGCAGGAAAATAAGCTAGG - Intergenic
1043555272 8:81423057-81423079 TATGGGATGGGAAACAAGGTGGG + Intergenic
1044859192 8:96505913-96505935 TAGAGAATTGAAAATGAGTTGGG + Intronic
1047096163 8:121628369-121628391 TAGAGTGTGGAAAATGATGTTGG + Intronic
1047783161 8:128126358-128126380 TAGGAGCTGGAAAAGGAAGTGGG - Intergenic
1047845478 8:128801105-128801127 AATGGGATGGAAAATGAGTTAGG + Intergenic
1047891717 8:129319137-129319159 TGGGGGATGGAGGAAGAGGTGGG + Intergenic
1047928021 8:129700315-129700337 TAGGGGGTGGGAAGCGAGGTTGG - Intergenic
1048007638 8:130432027-130432049 AAGGAGGGGGAAAATGAGGTGGG + Intronic
1048248437 8:132835299-132835321 TAGGGGATAGGATGTGAGGTAGG + Intronic
1048655317 8:136530226-136530248 GAGGGGCTGGAAAATGAGGTGGG - Intergenic
1049142069 8:140963921-140963943 CAAGTGATGGAAAATGAGATAGG - Intronic
1049873615 8:145000879-145000901 TAGGGGAGGGTAAAAGAGGTGGG + Intergenic
1051476565 9:17515425-17515447 TCAGGGCTGGAAAATAAGGTTGG - Intergenic
1051600041 9:18863409-18863431 TGGGGAATGGAAAATGGGCTTGG + Intronic
1052166697 9:25339280-25339302 TCTGGGATGGAAAGTGGGGTGGG + Intergenic
1055023989 9:71699756-71699778 GAGGAGATGGAAAAAGAAGTGGG - Intronic
1055904810 9:81280673-81280695 TTGTGTGTGGAAAATGAGGTAGG - Intergenic
1059350461 9:113660643-113660665 GATGAGATGGAAAAGGAGGTAGG + Intergenic
1059637698 9:116187099-116187121 TAAAGGATGGAAAAGGAGGGGGG - Intronic
1061920426 9:133779577-133779599 AAGGGGATGGAGAACGTGGTGGG + Intronic
1185660380 X:1723278-1723300 TAGTGGATGGAGTATGTGGTAGG + Intergenic
1185716413 X:2346433-2346455 TGGGGGCAGGAAAATCAGGTGGG - Intronic
1185870501 X:3660899-3660921 GAGGGGAAGGAAGAAGAGGTGGG + Intronic
1187316768 X:18203126-18203148 TGGGGGAAGGAAAAGGAGGATGG + Intronic
1188895710 X:35665886-35665908 AAGGGGAGGAAAAAAGAGGTAGG - Intergenic
1191055164 X:56233141-56233163 TCCGGGCTGGAAAATGAGGAGGG - Exonic
1192024008 X:67428738-67428760 AAGTGGATGGAAAATGGGGATGG - Intergenic
1192033861 X:67543928-67543950 GAGGGGAGGGAAAAGGAGGTGGG + Intergenic
1192153620 X:68727004-68727026 TAGGAGATGGATAAAGAGGAGGG + Intergenic
1192884507 X:75322530-75322552 TAGTGGATGGACATTTAGGTTGG + Intergenic
1193738745 X:85192377-85192399 GAAGGCATGGAAAATGAGGTTGG - Intergenic
1195006672 X:100691947-100691969 TAGGGGGTGAAAAATGAGACTGG - Intronic
1195158101 X:102142572-102142594 TCGGGGATGGATGGTGAGGTGGG - Intronic
1195457844 X:105089524-105089546 TAGGGGATGGAAAATGAGGTGGG - Intronic
1196275216 X:113758818-113758840 TAGGGGATGGGAAAGGAGGCTGG - Intergenic
1197615050 X:128681444-128681466 TTGGGGGTGGAAAAGGGGGTTGG + Intergenic
1198262529 X:134977709-134977731 TAGGGGATGAACAGTGAGCTTGG - Intergenic
1198376464 X:136045096-136045118 TAGGGGAGGGAGAGTGAGGAGGG + Exonic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1199716459 X:150510462-150510484 TAGGGAATGGAAAAGGGGTTGGG + Intronic
1199996669 X:153030481-153030503 GAGGAGTTGGAAAATGAGGATGG + Intergenic
1200112107 X:153745639-153745661 CAGGGGAAGGAAAATGTGGCGGG + Intergenic
1200379997 X:155826106-155826128 TAGTGGAGGGGAAATGAGGATGG + Intergenic
1200793543 Y:7320244-7320266 GAGGGGAAGGAAGAAGAGGTGGG - Intergenic