ID: 1195460101

View in Genome Browser
Species Human (GRCh38)
Location X:105114877-105114899
Sequence GAGTTGTCTTATTAACAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195460096_1195460101 24 Left 1195460096 X:105114830-105114852 CCCCTATTCTTTTTCTTCTCTAT 0: 1
1: 5
2: 10
3: 213
4: 1820
Right 1195460101 X:105114877-105114899 GAGTTGTCTTATTAACAGCTAGG 0: 1
1: 0
2: 0
3: 12
4: 97
1195460098_1195460101 22 Left 1195460098 X:105114832-105114854 CCTATTCTTTTTCTTCTCTATGG 0: 1
1: 2
2: 5
3: 69
4: 732
Right 1195460101 X:105114877-105114899 GAGTTGTCTTATTAACAGCTAGG 0: 1
1: 0
2: 0
3: 12
4: 97
1195460097_1195460101 23 Left 1195460097 X:105114831-105114853 CCCTATTCTTTTTCTTCTCTATG 0: 1
1: 1
2: 7
3: 119
4: 1389
Right 1195460101 X:105114877-105114899 GAGTTGTCTTATTAACAGCTAGG 0: 1
1: 0
2: 0
3: 12
4: 97
1195460095_1195460101 27 Left 1195460095 X:105114827-105114849 CCTCCCCTATTCTTTTTCTTCTC 0: 1
1: 1
2: 4
3: 146
4: 1252
Right 1195460101 X:105114877-105114899 GAGTTGTCTTATTAACAGCTAGG 0: 1
1: 0
2: 0
3: 12
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195460101 Original CRISPR GAGTTGTCTTATTAACAGCT AGG Intronic
904808525 1:33148135-33148157 AGGTTGTCTTAACAACAGCTGGG + Intronic
905095683 1:35468484-35468506 GAGTTGTCCTGTTAGTAGCTGGG - Intronic
908182535 1:61620442-61620464 GAGTTTTTTTATTCTCAGCTGGG - Intergenic
913706047 1:121423972-121423994 GAGTTGTGTCATTAGCTGCTCGG + Intergenic
915301619 1:154954891-154954913 GAGTTTTCTTATAAAGTGCTCGG - Intronic
916887919 1:169088057-169088079 CAGTTGTCTGGTTAACAACTAGG - Intergenic
917068890 1:171127822-171127844 GTGTTTTCTTATTAACAACACGG - Intergenic
920281763 1:204848872-204848894 TATTTAACTTATTAACAGCTGGG - Intronic
923534603 1:234839419-234839441 GGGCTGTCTTATTTACAGCAAGG - Intergenic
924464333 1:244286373-244286395 CAGTTGTCTCATGTACAGCTAGG - Intergenic
1066706188 10:38181214-38181236 GAAATTTCTTAATAACAGCTTGG + Intergenic
1071100209 10:82028000-82028022 GGGTTGTATTATTAACTGCTGGG + Intronic
1080163038 11:29202264-29202286 GATTTGGCTTCTTATCAGCTAGG - Intergenic
1087088304 11:94242411-94242433 TAGCAGTCTTATTACCAGCTTGG - Intergenic
1093742883 12:22708240-22708262 GAGTTGTATTATTAAGAAGTTGG + Intergenic
1094169025 12:27472036-27472058 CAGTTTTTTTATTAACAGATAGG - Intronic
1095213358 12:39520483-39520505 GAATTGTCTTATTACTGGCTGGG + Intergenic
1101621078 12:106388668-106388690 CAGTTCTCTTATTACCTGCTGGG + Intronic
1103070306 12:117935826-117935848 GAGGTGTCTGAGGAACAGCTAGG - Intronic
1104404216 12:128504145-128504167 GAGCTGTCACATGAACAGCTTGG - Intronic
1105238783 13:18590636-18590658 GAGTTCTATTATTAACATCTTGG + Intergenic
1111100959 13:83585364-83585386 GAGTTGTTTTATCAACTGATGGG + Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1114211211 14:20616745-20616767 GAGTTGTGTCATTCACAGCAAGG - Intergenic
1119469269 14:74883756-74883778 GACCTGGCTTATCAACAGCTGGG - Intronic
1120726546 14:87948280-87948302 GATTTCTGTGATTAACAGCTGGG - Intronic
1122994946 14:105258030-105258052 GACTTTTCTTATCAACAACTTGG + Intronic
1126117625 15:45223091-45223113 AAGTTGTGTTCTTAACAGCAAGG + Intergenic
1139185758 16:64804359-64804381 GTGTTGTTTTATAAACAGCATGG + Intergenic
1140449815 16:75061798-75061820 GAGTCGTCTTGTCAGCAGCTTGG + Intronic
1147391640 17:40112850-40112872 TAGTTGTCTCTTTAAGAGCTCGG - Intergenic
1153171493 18:2321025-2321047 GAGTGGTCCTATTAAAAGATAGG - Intergenic
1153942485 18:9990148-9990170 CAGTTGACTTATTGGCAGCTTGG - Intergenic
1154512187 18:15118472-15118494 GAGTTCTATTATTAACATCTTGG + Intergenic
1157932577 18:51839634-51839656 CAGTTGTCTTCTTAACAGGTTGG + Intergenic
1158984191 18:62797260-62797282 AAGTTGTGGAATTAACAGCTGGG - Intronic
1159951792 18:74489372-74489394 GAGTTTGCTCTTTAACAGCTGGG + Intergenic
1162860326 19:13501639-13501661 AAGTTGTCTTGTTAACAGGATGG - Intronic
1164219787 19:23183331-23183353 GAGTTTTCTTTTTAATATCTGGG + Intergenic
927061181 2:19422582-19422604 GAAGTGTCTTATTAACTTCTAGG + Intergenic
929249348 2:39735649-39735671 TGGTTGTGTTGTTAACAGCTGGG - Intergenic
931389277 2:61826712-61826734 GAGTTGTCTTGGTAACAAATTGG - Intronic
931720624 2:65065022-65065044 CAGTTGGCTCATAAACAGCTTGG + Intronic
936723781 2:115287719-115287741 GAGTTCTTTGATTATCAGCTTGG - Intronic
937139069 2:119582749-119582771 GATATGTCTTATTGACAGCTGGG - Intronic
938511751 2:131955239-131955261 GAGTTCTATTATTAACATCTTGG + Intergenic
940840306 2:158572368-158572390 GAATTGTCTTTTTAAAAGCAAGG + Intronic
942168795 2:173269116-173269138 GAGTTATTTTATTACCAGCTTGG - Intergenic
942633921 2:177981174-177981196 AAATTGTCTTATTTACATCTAGG - Intronic
943961932 2:194275670-194275692 GAGTTGTATAATTAACATGTAGG + Intergenic
946805528 2:223467546-223467568 GAGTTGTCTTACTCACATATAGG + Intergenic
1172693846 20:36808425-36808447 GAGTTGTGTCAATACCAGCTGGG + Intronic
1173902793 20:46603196-46603218 GAGTTAACTTATTAAAAGCAAGG + Intronic
1176782777 21:13218903-13218925 GAGTTCTATTATTAACATCTTGG + Intergenic
1177979725 21:27896690-27896712 GAGTTCTATTATTAACATCTTGG - Intergenic
1183261116 22:36796641-36796663 GAGTGGTTTTAATAAGAGCTGGG - Intergenic
949780324 3:7679373-7679395 GAGTTGTGTTATTTGCAGTTTGG - Intronic
950315843 3:12001670-12001692 GAGCTGTCTTCTTAAGAACTTGG + Intergenic
951098445 3:18658532-18658554 GACTTGTGTTAATAACTGCTGGG - Intergenic
952629074 3:35442928-35442950 ATATTGCCTTATTAACAGCTTGG + Intergenic
954337396 3:49927626-49927648 GAGCTGTCTTATAGACAGCTGGG + Intronic
957287878 3:78240395-78240417 AAGTTGGCTTATTAGCAGATTGG - Intergenic
958190598 3:90178802-90178824 GAATTGTCTTTTAAAGAGCTTGG - Intergenic
958412257 3:93832409-93832431 GAATTGTCTTTTAAAGAGCTTGG - Intergenic
958432127 3:94053279-94053301 GAGTTCTCTTAATATCAGCAAGG + Exonic
968516646 4:1018329-1018351 TAGTTGTGTTTTTTACAGCTGGG + Intronic
971625630 4:28916609-28916631 GAGTTGGCTTATTACCAACTTGG + Intergenic
975177718 4:71307404-71307426 GTGTTGTCTGGTTAAAAGCTTGG + Intronic
978183196 4:105827044-105827066 GAATTTCCTTATTAACAGCCAGG - Intronic
979126497 4:116979903-116979925 GAGGTGTCTTATTAAGAGGAAGG - Intergenic
980277365 4:130671416-130671438 CAGGTGTCTCATGAACAGCTTGG + Intergenic
980924802 4:139124857-139124879 GACTTGTATAAATAACAGCTAGG + Intronic
981259392 4:142701542-142701564 GATTTGTCTTGGTAACAGTTTGG + Intronic
982865054 4:160499948-160499970 GCTTTGTCGTATTTACAGCTAGG - Intergenic
989577799 5:43005141-43005163 AAGTTTCCTTATTAACAACTTGG - Intergenic
989810560 5:45667818-45667840 GAGTTGTTTTTTTAGCAACTGGG - Intronic
989971975 5:50535785-50535807 GAGTTGTGTCATTAGCTGCTCGG - Intergenic
992970413 5:82051003-82051025 GAATTGTTTTTTTAACAGATAGG - Intronic
995894001 5:116990130-116990152 CAGTTGTCTCACTGACAGCTGGG + Intergenic
999660425 5:153856757-153856779 CAATTCTCTTATTAACTGCTTGG + Intergenic
1001829150 5:174770850-174770872 GAGCTGTCTCATTTACAGATAGG - Intergenic
1002870459 6:1162568-1162590 GAGTTGTGTTAGCAACAGCGTGG + Intergenic
1003003080 6:2355162-2355184 GACTTGTAATATTAAAAGCTGGG + Intergenic
1004596167 6:17101947-17101969 GAGGTGTCTAAATCACAGCTAGG - Intergenic
1005066244 6:21820650-21820672 CAGTTGTCTTGTCAATAGCTTGG + Intergenic
1010760494 6:79716938-79716960 GAGATGTCTTATTAACTCTTGGG + Intergenic
1014471705 6:121823351-121823373 GAGTTGTTTTCTTAGCTGCTGGG - Intergenic
1015226808 6:130866526-130866548 TAGGTTTCTTATGAACAGCTTGG - Intronic
1016325305 6:142894124-142894146 GAGTTGCCATTTTAATAGCTGGG + Intronic
1016539342 6:145146089-145146111 GAGTCATCTTATTGAAAGCTGGG + Intergenic
1020590755 7:10133772-10133794 GAGTTTTCTGCTTAACAGTTGGG + Intergenic
1023922862 7:44643145-44643167 GAGTTTTGTTTTTAACAGATGGG + Intronic
1024589511 7:50868825-50868847 GAGTTGATTTATTTAAAGCTTGG - Intergenic
1024713248 7:52042354-52042376 CAGTTGTTTTATCAACAACTGGG - Intergenic
1025961023 7:66221739-66221761 GAGTTGACTTTTTAAAATCTGGG + Intronic
1032327405 7:130943245-130943267 AAGTTGTCGTAGTAACAGCATGG - Intergenic
1038341664 8:26691357-26691379 GGGTTGATTTATTAACAACTGGG - Intergenic
1041199707 8:55440018-55440040 GAGTTTTGTTACTAACAGCTAGG + Intronic
1043373423 8:79620070-79620092 AAGTTGTCTTATTTAAAGATTGG + Intronic
1043386325 8:79751349-79751371 GAGTTGTGTTATTAGGTGCTGGG + Intergenic
1047860758 8:128964216-128964238 GAGTTCTCTTATTAATAGTATGG - Intergenic
1048194158 8:132318387-132318409 GAGTTGTCTCTGAAACAGCTGGG + Intronic
1048611118 8:136024274-136024296 GCATTGTCTAATTAACAGCATGG - Intergenic
1058685750 9:107478242-107478264 GAGGTGTATTCTTAAGAGCTGGG + Intergenic
1060854250 9:126902247-126902269 GTCTTATCTCATTAACAGCTTGG + Intergenic
1061577223 9:131514567-131514589 GCCTTGTCTTGTTCACAGCTGGG + Intronic
1187826711 X:23338444-23338466 GAATTGTTTTGTTAACAGCCTGG - Intronic
1189061109 X:37754515-37754537 GAGTTGCTTTATTAAGAACTCGG + Intronic
1194994826 X:100580460-100580482 GAGTTGTCTAGTTGGCAGCTGGG - Intergenic
1195460101 X:105114877-105114899 GAGTTGTCTTATTAACAGCTAGG + Intronic