ID: 1195460255

View in Genome Browser
Species Human (GRCh38)
Location X:105115890-105115912
Sequence TAGCTGCCTCTCTGCGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1800
Summary {0: 1, 1: 44, 2: 235, 3: 701, 4: 819}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195460255_1195460262 12 Left 1195460255 X:105115890-105115912 CCTGCCCCGCAGAGAGGCAGCTA 0: 1
1: 44
2: 235
3: 701
4: 819
Right 1195460262 X:105115925-105115947 AAATCAAGCACAGCAGCTGCTGG 0: 11
1: 72
2: 299
3: 131
4: 338
1195460255_1195460263 18 Left 1195460255 X:105115890-105115912 CCTGCCCCGCAGAGAGGCAGCTA 0: 1
1: 44
2: 235
3: 701
4: 819
Right 1195460263 X:105115931-105115953 AGCACAGCAGCTGCTGGCCCAGG 0: 318
1: 144
2: 44
3: 76
4: 859

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195460255 Original CRISPR TAGCTGCCTCTCTGCGGGGC AGG (reversed) Intronic
900134116 1:1106987-1107009 CAGCTGCCTCCACGCGGGGCAGG + Intronic
900916769 1:5644898-5644920 CAGCTGCTTCTCTGGGGGTCTGG + Intergenic
901045966 1:6395911-6395933 TAGCTGCCTTCCCCCGGGGCAGG - Intergenic
901130311 1:6958414-6958436 CAGCTGCCTCTCCGCCAGGCTGG - Intronic
901156322 1:7142032-7142054 TAGCTTCCTCTGTGCTGGGAAGG + Intronic
901601451 1:10426497-10426519 TAGCTGCCTTCCTGTGGGGCAGG - Intergenic
902032594 1:13433981-13434003 TAGCTGCCTCCCTGCGGGGCAGG - Intergenic
902033452 1:13439458-13439480 TAGCTGCCTTCCCGCCGGGCAGG + Intergenic
902100407 1:13983300-13983322 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
902538660 1:17136755-17136777 GAGCTTCATCTCTGCAGGGCAGG - Intergenic
902892558 1:19455001-19455023 TGGCTTCCTCTTTGCGGGACCGG - Intronic
902963948 1:19984632-19984654 TAGCTGCCTCCCCGAGGGGCAGG - Intergenic
903009685 1:20320796-20320818 TATCTGCCTCTCAGAGGGACTGG - Intronic
905375655 1:37518474-37518496 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
905742917 1:40388075-40388097 TAGCTGCCTTCCCACGGGGCAGG + Intronic
905761128 1:40559018-40559040 CAGCTGCCTCCCCGCGGGGCAGG - Intergenic
906055961 1:42917131-42917153 CAGCTGCCTCTCTGCAGGGCAGG - Intergenic
906083197 1:43107650-43107672 TAGCTGCCTCCCCACAGGGCAGG - Intergenic
906615676 1:47231444-47231466 TTGCTGCCCTTCTGTGGGGCTGG - Intronic
906876165 1:49541556-49541578 CAGCTGCCTCTCCGCGGGGCAGG + Intronic
907102217 1:51847515-51847537 TAGCTGACTCCCCGCAGGGCAGG - Intronic
907371130 1:54004364-54004386 TAGCTGCCTCACCTCAGGGCAGG - Intergenic
907889517 1:58623653-58623675 TAGCTGCCTTTCCGCGGGGCAGG + Intergenic
907980072 1:59472308-59472330 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
908169317 1:61488874-61488896 TAGGTGCCTCTCCTCAGGGCTGG - Intergenic
908301122 1:62761736-62761758 CAGCCGCCTCCCTGTGGGGCAGG + Intergenic
908888613 1:68817934-68817956 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
909318523 1:74253479-74253501 TAGCTGCCTCCCCGTGCGGCAGG - Intronic
909608721 1:77531898-77531920 TAGCTGCCTCCCCGCGGGGCAGG - Intronic
909782262 1:79561663-79561685 CAGCCGCCTCTCCGTGGGGCAGG - Intergenic
909904542 1:81178745-81178767 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
910034744 1:82776919-82776941 TAGCTGCCTTCCCGCCGGGCAGG - Intergenic
910550317 1:88467288-88467310 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
910622650 1:89273523-89273545 TAGCTGCCTCCCGGTGGGGCAGG - Intergenic
910625547 1:89302957-89302979 CTGCCACCTCTCTGCGGGGCAGG - Intergenic
911001462 1:93170446-93170468 TAGCTGCCTCCCCGCGGGGCAGG + Intronic
911205946 1:95091589-95091611 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
911259578 1:95669766-95669788 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
911305212 1:96224476-96224498 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
911807938 1:102234950-102234972 CAGCCGCCTCCCTGCGGGGCAGG - Intergenic
912058100 1:105631373-105631395 TAGCTTCCTTCCTGCGGGGCAGG - Intergenic
912312856 1:108641007-108641029 TAGCTGCCTTCCCGCAGGGCAGG - Intronic
912315952 1:108667698-108667720 TAGCTGCCCTCCCGCGGGGCAGG + Intergenic
912538732 1:110396471-110396493 TAGCTGCCTCCCCGCAGGGCAGG - Intergenic
912819349 1:112854651-112854673 TAGCTGCCTGCCCGCGGGGCAGG - Intergenic
913077994 1:115357613-115357635 TGGCTGTTTCTCTGCGGGACTGG + Intergenic
913161042 1:116146693-116146715 TAGCTGCCTTACCGCGGGGCAGG - Intergenic
913469018 1:119171728-119171750 TAGCTGCCTCCCTGCGGGGCAGG + Intergenic
913470206 1:119179247-119179269 TAGCTGCCTCCCCGTGGGGCAGG + Intergenic
913486124 1:119333931-119333953 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
913692090 1:121289242-121289264 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
913987117 1:143575283-143575305 TAGCTGCCTCCCTGCGGGGCAGG + Intergenic
914145467 1:144990872-144990894 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
914203411 1:145506008-145506030 TAGCTGCCTTCCCGCGGGGCGGG - Intergenic
914438418 1:147680904-147680926 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
914482533 1:148079162-148079184 TAGCTGCCTTCCCGCGGGGCGGG - Intergenic
915242307 1:154532230-154532252 TAGCTGCCTCCCCGCAGGGCAGG - Intronic
915260077 1:154670973-154670995 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
915666086 1:157446420-157446442 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
915764470 1:158349127-158349149 TAGCTGCCTCCCCGTGGGGCAGG - Intergenic
915865529 1:159494746-159494768 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
916219890 1:162433375-162433397 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
916606034 1:166343214-166343236 TAGATGCCTCCCCGCAGGGCAGG - Intergenic
916939047 1:169661396-169661418 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
916940084 1:169668234-169668256 TAGCTGCCTTCCCACGGGGCAGG + Intronic
916960305 1:169882333-169882355 TAGCTGCCTTCCCACGGGGCAGG + Intronic
917406212 1:174711005-174711027 TAGCTGCCTCCCTGTGGGGCAGG - Intronic
917445386 1:175102438-175102460 TAGCTGCCTTCCCGCCGGGCAGG - Intronic
917446341 1:175108595-175108617 TAGCTGCCTTCCCACGGGGCAGG - Intronic
917578523 1:176349404-176349426 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
917860538 1:179139069-179139091 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
917932975 1:179837068-179837090 TAGCTCCCTCCCCGTGGGGCAGG - Intergenic
918059029 1:181046053-181046075 TAGCTGCCTTCCTGCGGGGCAGG + Intronic
918154596 1:181832638-181832660 CAGCCGCCTCCCTGCAGGGCAGG + Intergenic
918511997 1:185321854-185321876 TAGCTGCATCCCCGCGGGGCAGG - Intergenic
918659742 1:187073954-187073976 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
918708964 1:187703842-187703864 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
918720856 1:187850424-187850446 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
918732279 1:188013440-188013462 TAGCTGCCTTCCCGCGGGTCAGG - Intergenic
918792016 1:188841313-188841335 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
918853188 1:189718436-189718458 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
918993906 1:191731993-191732015 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
919091927 1:192987133-192987155 TAGCTGCCTTCCCGCGGGGCCGG + Intergenic
919167928 1:193919050-193919072 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
919174496 1:194002064-194002086 TAGCTGCCTTCCAGCGGGGCAGG + Intergenic
919201331 1:194358408-194358430 TAGCTGCCTTCCCGCTGGGCAGG - Intergenic
919250853 1:195054497-195054519 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
919297753 1:195723051-195723073 TAGCTGCCTGCCCACGGGGCAGG - Intergenic
919377183 1:196809033-196809055 CAGCTGCCTCCCTGTGGGGCAGG + Intergenic
919386894 1:196933934-196933956 CAGCTGCCTCCCTGTGGGGCAGG + Intronic
919630962 1:199959840-199959862 TAGCTGCCTCCTCGCGGGGCAGG + Intergenic
919779635 1:201213623-201213645 TAGGTGCTTCTCTGCTGAGCTGG + Intronic
920479412 1:206307590-206307612 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
920604843 1:207371536-207371558 CAGCCACCTCCCTGCGGGGCAGG - Intergenic
920731348 1:208488575-208488597 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
920756698 1:208739900-208739922 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
920878435 1:209858792-209858814 CAGCTGCCTCCTCGCGGGGCAGG - Intergenic
920882009 1:209889084-209889106 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
920883130 1:209898938-209898960 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
921094403 1:211874430-211874452 TAGCTGCCTCCCTGCAGGGCAGG - Intergenic
921396360 1:214673284-214673306 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
921903811 1:220475807-220475829 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
921983649 1:221285796-221285818 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
921993193 1:221389720-221389742 TAGCTGCCTCTGTGCCCTGCTGG + Intergenic
922056849 1:222049968-222049990 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
922423230 1:225472929-225472951 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
922485451 1:225969988-225970010 TAGCTACCTTCCGGCGGGGCAGG + Intergenic
922541887 1:226426431-226426453 TAGCTGCCTTCCCGAGGGGCAGG - Intergenic
922855817 1:228773927-228773949 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
922985902 1:229865678-229865700 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
923157209 1:231289613-231289635 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
923172584 1:231430955-231430977 TAGCTGCCTTCCCGCTGGGCAGG - Intergenic
923193437 1:231642086-231642108 TGGCTGCCTTCCCGCGGGGCAGG - Intronic
923324788 1:232871582-232871604 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
923353202 1:233129329-233129351 TAGCTGCCTCCCCACGGGGCAGG + Intronic
923573838 1:235140516-235140538 TAGCTGCCTTCCCGCAGGGCAGG + Intronic
923623217 1:235594568-235594590 TAGCTGCCTCCCTGCGGGGCAGG - Intronic
923810502 1:237309764-237309786 CAGCTGCCTCCCCGCAGGGCAGG - Intronic
923930054 1:238684768-238684790 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
924117544 1:240762711-240762733 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
924219213 1:241855717-241855739 TAGCTGCCTTCCTGCGGGGCAGG - Intronic
924305965 1:242689650-242689672 CAGCTGCCTCCCTGCAGGGCAGG + Intergenic
924313759 1:242774506-242774528 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
924778696 1:247128774-247128796 TTCCTGCCTCACTGCGGGGCGGG - Intronic
924782958 1:247169644-247169666 TTCCTGCCTCACTGCGGGGCGGG + Intronic
1062884945 10:1009303-1009325 TATCTCCCTGTCTGTGGGGCCGG - Intronic
1063300372 10:4845053-4845075 TAGCTGCCTCCCCGCAGGGCAGG - Intronic
1063309291 10:4937564-4937586 TAGCTGCCTTCCTGCGGGGCAGG - Intronic
1063321036 10:5053282-5053304 TAGCTGCCTCCCCATGGGGCAGG - Intronic
1063750149 10:8934795-8934817 TAGGTACCTCTCTCCTGGGCAGG + Intergenic
1063769718 10:9183572-9183594 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
1064197813 10:13259828-13259850 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1064449197 10:15426248-15426270 TAGCTGCCTCCCAGTAGGGCAGG - Intergenic
1064461043 10:15535158-15535180 TAGCTGCCTCCCCCAGGGGCAGG + Intronic
1064790337 10:18951417-18951439 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1065284774 10:24176862-24176884 CAGCTGCCTCCCCGTGGGGCAGG - Intronic
1065441359 10:25756221-25756243 TAGCTGCCTTCCCGCCGGGCAGG + Intergenic
1065743252 10:28815811-28815833 TAGCTGCCTTCCTGCGGGGCAGG - Intergenic
1065752156 10:28896958-28896980 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1065802627 10:29366401-29366423 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1065895904 10:30163034-30163056 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1065981546 10:30902942-30902964 TAGCTGCCTCCCCGCAGGGAAGG - Intronic
1065995527 10:31056045-31056067 TAGCTGCCTCCCTGCCGGGCAGG + Intergenic
1066186327 10:33013514-33013536 TGGCTGCCTTCCCGCGGGGCAGG + Intergenic
1066190288 10:33049448-33049470 TGGCTGCCTTCCCGCGGGGCAGG + Intergenic
1066235443 10:33480606-33480628 TAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1066277961 10:33887343-33887365 TTGCTGCCACTCTGTGGGCCTGG + Intergenic
1066296115 10:34055734-34055756 TAGCTGCCTTCCTGTGGGGCAGG + Intergenic
1066544221 10:36482136-36482158 TAGCTGCCTTCTGGCGGGGCAGG - Intergenic
1066575499 10:36820154-36820176 CAGCTGCTTCCCCGCGGGGCAGG + Intergenic
1066590543 10:36989430-36989452 CAGCTGCCTCCCTGCAGGGCAGG - Intergenic
1066598223 10:37076187-37076209 TAGCTGCCTCCCCATGGGGCAGG + Intergenic
1066615041 10:37285304-37285326 CAGCTGCCTCCCTGTGGGGCAGG - Intronic
1066660908 10:37737554-37737576 TAGCTGCCTCACCACGGGGCAGG + Intergenic
1067363217 10:45600964-45600986 TAGCTGCCTCCCTGCAGGGCAGG + Intergenic
1067512228 10:46905661-46905683 AAGCTGCCTCTCTCTGGTGCTGG - Intergenic
1067650016 10:48146161-48146183 AAGCTGCCTCTCTCTGGTGCTGG + Intergenic
1068374047 10:56155345-56155367 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
1068460384 10:57321700-57321722 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1068554940 10:58448402-58448424 CAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1068788404 10:61001593-61001615 CAGCCGCCGCCCTGCGGGGCGGG + Intergenic
1068863194 10:61867867-61867889 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1068902137 10:62280600-62280622 TAGCTGCCTTCCCTCGGGGCAGG + Intergenic
1068978162 10:63033811-63033833 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1069090787 10:64196912-64196934 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1069215333 10:65812233-65812255 TAGGTGCCTTCCCGCGGGGCAGG - Intergenic
1069930501 10:71878521-71878543 TGGCTGACTCTCTGAGAGGCCGG + Intergenic
1069988700 10:72300826-72300848 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1069992996 10:72326176-72326198 TAGCTGCCTTCCTGAGGGGCAGG + Intergenic
1070162904 10:73876413-73876435 AAGCTGCCTCCCTGAGGGGTGGG + Intergenic
1070172747 10:73944825-73944847 TAGCTGTCTCCCCGCGGGGCAGG + Intergenic
1070402205 10:76062963-76062985 GAGCTGTCTCTCTGCTGTGCAGG - Intronic
1070564074 10:77590419-77590441 TAGCTGCCTTCCCGCAGGGCAGG - Intronic
1070937897 10:80315605-80315627 TAGCTGCCTCCCCACTGGGCAGG + Intergenic
1070968330 10:80543435-80543457 TAGCTGCCTTCCCGCGGCGCAGG + Intronic
1070973406 10:80586098-80586120 TAGCTGCCTCCCCGTGGGGCAGG + Intronic
1070999155 10:80814367-80814389 TAGCTGCCTCCCCGCCAGGCAGG + Intergenic
1071078738 10:81784440-81784462 CAGCTGCCTCCCCACGGGGCAGG + Intergenic
1071085334 10:81862827-81862849 TAGCTGCCTCCCCACAGGGCAGG - Intergenic
1071629980 10:87211967-87211989 TAGCTGGCTCTCTGATGGGGAGG - Intergenic
1071797053 10:89018755-89018777 TAGCTGCCTCCCCATGGGGCAGG - Intergenic
1071963759 10:90832315-90832337 TAGCTGCCTCTCCTCGGGGCAGG - Intronic
1072278504 10:93845371-93845393 TAGCTGCCTCCCTCTGGGGCAGG + Intergenic
1073789749 10:106928241-106928263 TAGCTGCCTCCTCGCGGGGCAGG - Intronic
1073878320 10:107950757-107950779 TAGCTGCCTCCCTGCTGGCAGGG + Intergenic
1074098154 10:110331680-110331702 TAGCTGCCTCCCCACAGGGCAGG + Intergenic
1074317018 10:112369970-112369992 CTGCTGCCTCCCTGTGGGGCAGG + Intergenic
1074317179 10:112370547-112370569 TAGCTGCCTCCCGGCGGGGCAGG + Intergenic
1074732485 10:116393586-116393608 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
1074996318 10:118760285-118760307 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1074999256 10:118783125-118783147 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1075255645 10:120924047-120924069 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1075269357 10:121035477-121035499 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1075307644 10:121382341-121382363 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
1075376001 10:121978527-121978549 TAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1075504981 10:123013642-123013664 TAGCTGCCTCTCCGCGGGGCAGG - Intronic
1075537502 10:123283491-123283513 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1075919892 10:126201895-126201917 CTGCTGCCTCTCTCTGGGGCAGG - Intronic
1076160429 10:128240136-128240158 ATGCTCCCTCTCTGAGGGGCAGG + Intergenic
1076200734 10:128555811-128555833 TAGCAGCCTCACTGGGGGACAGG - Intergenic
1076261636 10:129071490-129071512 TAGCTGCCTTCCTGCAGGGCAGG - Intergenic
1076726384 10:132416112-132416134 CAGTGGCCTCTCCGCGGGGCCGG + Intronic
1076747386 10:132521287-132521309 TGGCTGCCTCTCAGCGGGCCAGG - Intergenic
1076773634 10:132680875-132680897 TAGCTGCCTTCCCGAGGGGCAGG + Intronic
1076796513 10:132801083-132801105 TAGCTGCCTTCCCGAGGGGCAGG - Intergenic
1077486140 11:2839183-2839205 GAGCTGCCTCACTGCCAGGCAGG - Intronic
1077583778 11:3435125-3435147 TAGCTGCCTCTCCGCAGGGCAGG - Intergenic
1077602122 11:3581185-3581207 GAGCGGCCTCTCGGCGGAGCTGG + Intergenic
1077603254 11:3588905-3588927 TAGCTGCCTCCCTGTGGGGCAGG + Intergenic
1077764609 11:5144617-5144639 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1077778194 11:5294579-5294601 TAGCTGCCTTCCTGCGGGGCAGG - Intronic
1077805788 11:5590101-5590123 TAGCTGCCTTCCTGCGGGGCAGG + Intronic
1078720373 11:13878577-13878599 TGGCTGCCTCTCACCTGGGCTGG - Intergenic
1078743671 11:14091465-14091487 GAGCTGCCTTCCCGCGGGGCAGG - Intronic
1079190967 11:18276274-18276296 TAGCTGCCTTCCTGTGGGGCAGG - Intergenic
1079708663 11:23653331-23653353 TAGCTGCCTCTTGGCAGGGCAGG - Intergenic
1079726199 11:23883569-23883591 TAGCTGCCTTCCTGCGGGGCAGG - Intergenic
1079730546 11:23934887-23934909 TAGCTGCCTTCCTGTGGGGCAGG - Intergenic
1079731733 11:23942416-23942438 TAGCTGCCTTCCTGTGGGGCAGG - Intergenic
1079756797 11:24274422-24274444 TAGCTGCCACCCCGTGGGGCCGG - Intergenic
1079867633 11:25756340-25756362 CAGCCGCCTCCCTGTGGGGCAGG + Intergenic
1080106000 11:28512469-28512491 TAGCTGCCTCCCCACTGGGCAGG - Intergenic
1080107480 11:28525938-28525960 TAGCTGCCTCCCCTTGGGGCAGG - Intergenic
1080138841 11:28890815-28890837 TAGCTGCCTCCCCGCGGGTCAGG + Intergenic
1080195174 11:29600284-29600306 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1080621468 11:33990322-33990344 TAGCTGCCTTCCCGCCGGGCAGG + Intergenic
1081126915 11:39333207-39333229 TAGCTGCCTCCCCATGGGGCAGG - Intergenic
1081315213 11:41623054-41623076 TAGCTGCCTCCCCGTGGGGCAGG + Intergenic
1081324445 11:41728233-41728255 TAGCTGCCTCCCTGTGGGGCAGG - Intergenic
1081422092 11:42881605-42881627 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
1081428410 11:42950108-42950130 TAGCTGCCTTCCTGTGGGGCAGG + Intergenic
1082106751 11:48229131-48229153 CAGCCGCCTCCCAGCGGGGCAGG + Intergenic
1082270419 11:50164182-50164204 TAGCTGCCTCCCGGTGTGGCAGG - Intergenic
1082272139 11:50183495-50183517 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1082698740 11:56402058-56402080 TAGCTCCCTTCCTGCGGGGCAGG - Intergenic
1082734941 11:56845419-56845441 CAGCTGCCTCCTTGCAGGGCAGG + Intergenic
1082912307 11:58390709-58390731 TAGCTGCTTCCCCACGGGGCAGG - Intergenic
1082924643 11:58532171-58532193 CAGCTGCCTCCCTGTGGCGCAGG + Intronic
1083074282 11:60020396-60020418 TATCTGCCTCCTGGCGGGGCAGG - Intergenic
1083418249 11:62539216-62539238 TGGCTGCTTTTCTGCAGGGCTGG - Intronic
1084024731 11:66440914-66440936 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1084107432 11:66989016-66989038 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1084186663 11:67476271-67476293 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1084210486 11:67619259-67619281 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
1084240680 11:67817797-67817819 TAGCTGCCTCTCCGCAGGGCAGG - Intergenic
1084259149 11:67963448-67963470 TAGCTGCCTCCATGTGGGGCAGG + Intergenic
1084412031 11:69010921-69010943 TAGATGCTTCTCTGCGGGGAAGG - Intronic
1084459637 11:69289288-69289310 TACCTGCCTCTCTGCCTTGCTGG - Intergenic
1084813621 11:71631731-71631753 TAGCTGCCTCTCTGTGGGGCAGG - Intergenic
1084814727 11:71639479-71639501 GAGCGGCCTCTCGGCGGAGCTGG - Intergenic
1085245620 11:75098429-75098451 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1085250910 11:75143261-75143283 CAGCTGCTTCTCAGCTGGGCGGG - Intronic
1085375907 11:76060787-76060809 CAGCTGCCTCCCCGTGGGGCAGG + Intronic
1085447223 11:76609167-76609189 TAGTTGCCTTCCTGCGGGGCAGG - Intergenic
1085671073 11:78465108-78465130 TAGCTGCCTTCCCGTGGGGCAGG - Intronic
1085687714 11:78639073-78639095 CAGCTGCCTCCCGGTGGGGCAGG + Intergenic
1085762511 11:79254488-79254510 TAGCTGCCTCTCTCCAAGGGTGG - Intronic
1085863155 11:80257785-80257807 TAGCTGCTTCCCCGCGGGGCAGG + Intergenic
1085941150 11:81207839-81207861 TAGCTGCCTCCCTGCAGGGCAGG + Intergenic
1086034927 11:82404115-82404137 CAGATGCCTCCCCGCGGGGCAGG + Intergenic
1086087589 11:82970895-82970917 TAGCTGCCTCCCCGCGGGGTAGG + Intergenic
1086210099 11:84308675-84308697 TAGCTGCCTCCCCGCGGGGCAGG - Intronic
1086397726 11:86433659-86433681 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1086724657 11:90167367-90167389 TAGCTGCCTCCCCGCAGGGCAGG + Intronic
1086808040 11:91268979-91269001 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
1087354562 11:97076823-97076845 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1087407293 11:97745756-97745778 TAGCTGCCTCCCCACGGGGCAGG - Intergenic
1087683784 11:101241387-101241409 CAGCTGCCTCCCGGTGGGGCAGG - Intergenic
1088481694 11:110301076-110301098 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1088570899 11:111222201-111222223 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1088843948 11:113649482-113649504 CAGCCGCCTCCCTGTGGGGCAGG - Intergenic
1089062096 11:115634031-115634053 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1089373548 11:117978625-117978647 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1089620475 11:119719366-119719388 GAGCTGCCTCTCTTCCTGGCGGG - Intronic
1089666888 11:120026121-120026143 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1089800263 11:121021882-121021904 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1090133539 11:124170859-124170881 TAGCTGCCTTCCCGCGGGACAGG - Intergenic
1090229246 11:125089719-125089741 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
1090307663 11:125704840-125704862 TAGCTGCCTTCCCGAGGGGCAGG - Intergenic
1090586166 11:128215409-128215431 CAGCTGCCTCTCCATGGGGCAGG - Intergenic
1090588272 11:128237269-128237291 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1090776702 11:129971970-129971992 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1090782739 11:130021852-130021874 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1090820510 11:130337541-130337563 TAGCTGCCTCCCCACAGGGCAGG - Intergenic
1091233428 11:134003000-134003022 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1091402231 12:188255-188277 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1091692831 12:2608773-2608795 TCGCAGCCCCTCTGCGGGGTGGG - Intronic
1091703027 12:2676524-2676546 TGGCTGCATCCCTGCTGGGCTGG - Intronic
1092101680 12:5889029-5889051 TAGCTGCCTCCCCACGGGGCGGG - Intronic
1092135225 12:6142419-6142441 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1092137451 12:6159698-6159720 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1092172762 12:6384051-6384073 TGTCTGCCTCGATGCGGGGCGGG - Exonic
1092220310 12:6708505-6708527 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
1092221422 12:6716259-6716281 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1092272946 12:7037643-7037665 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
1092336703 12:7640062-7640084 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1092350495 12:7752211-7752233 TAGCTGCCTTCTCGCGGGGCAGG - Intergenic
1092364078 12:7862408-7862430 TAGCTGCCTTCCCACGGGGCAGG + Intronic
1092410921 12:8252371-8252393 TAGCTGCTTCCCTGCAGGTCAGG - Intergenic
1092428268 12:8390537-8390559 GAGCGGCCTCTCGGCGGAGCTGG + Intergenic
1092429344 12:8396690-8396712 AAGCGGCCTCTCGGCGGAGCTGG + Intergenic
1092471791 12:8787489-8787511 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
1092545842 12:9450570-9450592 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1092572396 12:9739714-9739736 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1092617129 12:10225766-10225788 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1092732477 12:11547471-11547493 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1093034519 12:14320316-14320338 TAGCTGCCTTCTCGCGGGGCAGG + Intergenic
1093172364 12:15874806-15874828 TAGCTGCCTCCCCACAGGGCAGG + Intronic
1093189428 12:16057597-16057619 TAGCTGCCTTCTCGCGGGGCAGG + Intergenic
1093266296 12:17007846-17007868 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1093524774 12:20093464-20093486 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1093580145 12:20777549-20777571 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
1093581003 12:20783918-20783940 TAGCTGCCTTCCTGCAGGGCAGG - Intergenic
1093652574 12:21661752-21661774 TAGCTGCCTCCCTGCGGGGCAGG + Intronic
1093653914 12:21674190-21674212 TAGCTGCCTCCCCAAGGGGCAGG - Intronic
1093715544 12:22377129-22377151 TAGCTGCCTCCCCGCGGGGCAGG + Intronic
1093793739 12:23286148-23286170 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1093921693 12:24866316-24866338 TAGCTGCCTCCCTGCAGGGCAGG + Intronic
1093970237 12:25369588-25369610 TAGCTGCCTTCCTGCAGGGCAGG + Intergenic
1093972982 12:25391651-25391673 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
1094000170 12:25686474-25686496 CAGCCGCCTCCCTGCGGGTCAGG + Intergenic
1094108807 12:26839395-26839417 CAGCTGCCTCCCTGTGGGGCAGG + Intergenic
1094327584 12:29256865-29256887 TAGCTGCCTTCCTGTGGGACAGG + Intronic
1094409857 12:30157082-30157104 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1094448747 12:30561856-30561878 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1094507113 12:31071503-31071525 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1094589279 12:31805927-31805949 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1094661307 12:32472514-32472536 TGGCTGCCTTTCCACGGGGCAGG + Intronic
1094666509 12:32525896-32525918 TAGCTGCCTTCCCACGGGGCAGG + Intronic
1094718174 12:33034069-33034091 TAGCTGCCTTCCCGTGGGGCTGG - Intergenic
1094722069 12:33075524-33075546 TAGCTGCCTCCCTGCAGGGCAGG + Intergenic
1095123118 12:38442171-38442193 TAGCTGCCTCCCTGCAGGGCAGG + Intergenic
1095304165 12:40620835-40620857 TAGCTGCCTTCTTGCGGGGCAGG + Intergenic
1095444936 12:42273840-42273862 TAGCTGCCTCCCTGCAGGGCAGG - Intronic
1095533988 12:43224502-43224524 TAGCTGCCTTCCGGCGGGGCAGG + Intergenic
1095587434 12:43864116-43864138 TAGCTGCCTCCCTGGGGGGCAGG + Intronic
1095642399 12:44500613-44500635 TAGCTGCCTCCCTGTGGGGCAGG + Intergenic
1095776724 12:46018240-46018262 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
1096085436 12:48862432-48862454 GTGCTGTCTCTCTGCAGGGCTGG - Intronic
1097017901 12:56000281-56000303 TAGCTGCCTCCCCGCGGGGCAGG - Intronic
1097182080 12:57177457-57177479 AGGCTGCCTCAATGCGGGGCAGG - Exonic
1097212954 12:57386491-57386513 TAGCTGCCTCCCCTCGGGGCAGG + Intronic
1097664177 12:62461414-62461436 TAGCTGCCTCCCCACGGGGCAGG - Intergenic
1097698894 12:62800848-62800870 TTGCTGCCCCTCTGCCTGGCAGG - Intronic
1097863863 12:64543355-64543377 TAGCTGCCTCCCCACGGGGCAGG + Intergenic
1097982026 12:65744538-65744560 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
1098168196 12:67719370-67719392 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1098588699 12:72185268-72185290 TAGCTGGCTTCCCGCGGGGCAGG + Intronic
1098759263 12:74403169-74403191 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1099190184 12:79554143-79554165 CAGCTGCCTCCCTGTGGGGCAGG - Intergenic
1099190980 12:79561762-79561784 CAGCCGCCTCCCTGCGGGGCAGG + Intergenic
1099191410 12:79565174-79565196 TAGCTGCCTCCCCGTGGGGCAGG + Intergenic
1099204379 12:79711156-79711178 TAGCTGCCTCCCTGTGGGACAGG + Intergenic
1099413691 12:82361555-82361577 CAGCTGCCTCCCTGCGGGGCAGG - Intronic
1099443838 12:82728945-82728967 TAGCTGCCTCCCCGCCAGGCAGG + Intronic
1099450561 12:82802156-82802178 TAGCTGCCTCCCCACGGGGCAGG - Intronic
1099523915 12:83696424-83696446 TAGCTGCCTTCCTGCGGGGCAGG - Intergenic
1099559599 12:84155259-84155281 TAGCTGCCTTTCCATGGGGCAGG - Intergenic
1099790733 12:87330438-87330460 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1100142361 12:91634163-91634185 TAGGTGCCTCCCCGCGGGGCAGG + Intergenic
1100166601 12:91924045-91924067 TAGCTGCCTCCCTGCGGGGCAGG - Intergenic
1100211862 12:92406656-92406678 TAGCTGCCTTCCCTCGGGGCAGG - Intergenic
1100521477 12:95379807-95379829 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
1100584717 12:95969357-95969379 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1100600657 12:96109084-96109106 TAGCTGCCTTCCGGCGGAGCAGG + Intergenic
1100734613 12:97512923-97512945 TAGCTGCCTTCCCGCTGGGCAGG - Intergenic
1101009013 12:100430524-100430546 TAGCTGCCTTCCCGCGGGACAGG + Intergenic
1101021647 12:100559604-100559626 TAGCTGCCTTCCCGAGGGGCAGG + Intronic
1101461940 12:104905650-104905672 TAGCTGCCTTCCCACGGGGCAGG - Intronic
1102309779 12:111835876-111835898 TAGCTGCCTCCCGTCGGGGCAGG + Intergenic
1102811193 12:115825294-115825316 TAGCTGCCTCTCTCCCTTGCTGG - Intergenic
1102904030 12:116660904-116660926 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1103028571 12:117593800-117593822 TAGCTGTCTCTCTTCCTGGCTGG + Intronic
1103146122 12:118597313-118597335 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1103459652 12:121093689-121093711 TAGCTGCATCCCCGTGGGGCAGG - Intergenic
1103497566 12:121374644-121374666 TAGCTGCCTCCCTGCAGGGCAGG + Intronic
1103668570 12:122592247-122592269 TAGCTGCCTTCCCACGGGGCAGG + Intronic
1103678699 12:122676777-122676799 TAGCTGCCTTCCTGCGGGGCAGG - Intergenic
1103783372 12:123414251-123414273 TAGCTGCCTTCCCGTGGGGCAGG - Exonic
1103853312 12:123947183-123947205 TAGCTGCCTTCCCGCAGGGCAGG + Intronic
1104749261 12:131228034-131228056 TAGCTGCCTCCCCTCGGGGCAGG + Intergenic
1105037773 12:132938976-132938998 TAGCTGCCTCCCCGCGGGGCAGG + Intronic
1105425669 13:20292639-20292661 TAGCTGCCTCCCTGCCGGGCAGG + Intergenic
1105593911 13:21818175-21818197 AAGCCGCCTCCCTGCGGGGCAGG + Intergenic
1105605135 13:21920803-21920825 TAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1105697213 13:22900590-22900612 TAGCTGCCTCCCTGTGGGGCAGG - Intergenic
1105722195 13:23127794-23127816 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
1105763148 13:23531681-23531703 CAGCCGCCTCCCTGCGGGGCAGG + Intergenic
1105777619 13:23677963-23677985 CAGCTGCCTCCCCGTGGGGCAGG - Intergenic
1105871122 13:24506944-24506966 TAGCTGCCTCCCCGCGGGGCAGG - Intronic
1105876663 13:24560843-24560865 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1105883504 13:24623579-24623601 CAGCTGCCTCCCCGTGGGGCAGG + Intergenic
1106221303 13:27748452-27748474 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1106600540 13:31183191-31183213 TAGCTGCCTTCCGCCGGGGCAGG - Intergenic
1106617044 13:31339804-31339826 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1106643411 13:31608965-31608987 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
1107590441 13:41898716-41898738 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1108099157 13:46936193-46936215 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1108435367 13:50396817-50396839 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
1108469437 13:50753445-50753467 TAGCTGCCTTCCCACGGGGCAGG - Intronic
1108685449 13:52815400-52815422 TAGCTGCCTCCCTGAGGGGCAGG - Intergenic
1108750073 13:53439742-53439764 CAGCTGCCTCCTGGCGGGGCAGG + Intergenic
1108858937 13:54829638-54829660 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1108991123 13:56659251-56659273 CAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1108996020 13:56735785-56735807 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1109007786 13:56900952-56900974 TAGCTGCCTCCCCGTGGGGCAGG + Intergenic
1109110996 13:58318674-58318696 CAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1109124693 13:58504407-58504429 TTGCTGCCTTCCCGCGGGGCAGG - Intergenic
1109124905 13:58505568-58505590 CAGCTGCCTCCCCGCGGAGCAGG - Intergenic
1109159852 13:58958320-58958342 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1109201890 13:59440132-59440154 TAGCTGTCTCCCTGTGGGGCAGG + Intergenic
1109364658 13:61339387-61339409 TAGCTGCCTCCCAGTGGGGCAGG + Intergenic
1109416432 13:62046676-62046698 CAGCTGCCTCCCTGCCGGGCAGG - Intergenic
1109441389 13:62379450-62379472 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
1109446589 13:62448037-62448059 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1109745840 13:66622171-66622193 TGGCTGCCTCCCTGCGGGACAGG + Intronic
1109808174 13:67471181-67471203 TGGCTGCCTCTCTGCTGGAGTGG + Intergenic
1109858829 13:68171141-68171163 TAGGTGCCTCCGCGCGGGGCAGG + Intergenic
1110024052 13:70512044-70512066 TAGCTGCCTCCCCTCGGGGCAGG - Intergenic
1110417504 13:75268671-75268693 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1110497874 13:76190314-76190336 CAGCTGCCTCCCCGCGGCGCAGG + Intergenic
1110751375 13:79119773-79119795 TAGCTGCCTGCCGGCGGGGCAGG - Intergenic
1110854185 13:80278790-80278812 CAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1110862160 13:80355769-80355791 TAGCTGCCTTCCTGTGGGGCAGG + Intergenic
1110940274 13:81340909-81340931 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1110999821 13:82165088-82165110 TAGCTGCCTTCCCGAGGGGCAGG - Intergenic
1111006666 13:82258182-82258204 TAGCTGCCTCCCCACGGGGCAGG + Intergenic
1111138775 13:84086554-84086576 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1111441928 13:88292042-88292064 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1111556163 13:89884009-89884031 TAGCTGCCTCCCCGCGGGGCTGG - Intergenic
1111591045 13:90348821-90348843 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1111602745 13:90495002-90495024 TAGCTGCCCTCCCGCGGGGCAGG + Intergenic
1111747695 13:92291068-92291090 TAGCTGCCTTTCCGCTAGGCAGG + Intronic
1111748347 13:92296888-92296910 TAGCTGCCTTCCCGCAGGGCAGG + Intronic
1111841392 13:93454923-93454945 TGGCTGCCTTCCTGCGGGACAGG - Intronic
1112282677 13:98076473-98076495 TAGCTGCCTCCTGGCGGGGCAGG - Intergenic
1112518669 13:100077738-100077760 TAGCTGCCTTCCTGCAGGGCAGG + Intergenic
1112533153 13:100224187-100224209 TAGCTGCCTTCCCGCCGGGCAGG - Intronic
1112613118 13:100975918-100975940 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1112705874 13:102068696-102068718 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
1112842709 13:103600162-103600184 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
1113371938 13:109732811-109732833 TAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1113482666 13:110633167-110633189 TAGCTGCCTTCCCGCCGGGCAGG - Intronic
1113506657 13:110821382-110821404 TAGCTGCCTTCCCGCGAGGCAGG + Intergenic
1113538111 13:111084010-111084032 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1113678076 13:112221939-112221961 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1113680277 13:112238913-112238935 CAGCCGCCTCCCCGCGGGGCAGG + Intergenic
1114559656 14:23580819-23580841 TAGCTGCGTCCCTGCAGGGCAGG + Intergenic
1114679583 14:24473331-24473353 CAGCTGCCTCTCCGTGGGGCAGG + Intergenic
1115174577 14:30547655-30547677 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1115268612 14:31527226-31527248 TTGCTGCCTCCCTGTGGGGCAGG - Intronic
1115740566 14:36383150-36383172 TAGCTGCCTCTCTCCTGGAATGG + Intergenic
1116114483 14:40629778-40629800 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1116223171 14:42113630-42113652 TAGCTGCCTCCCCGCGGGGCGGG - Intergenic
1116251014 14:42482530-42482552 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1116297888 14:43136065-43136087 CAGCCGCCTCCCTGCGGGGCAGG - Intergenic
1116452383 14:45080659-45080681 TAGCTGCCTTCCCTCGGGGCAGG + Intergenic
1116594400 14:46820656-46820678 CAGCTGCCACCCCGCGGGGCAGG + Intergenic
1116653790 14:47626736-47626758 TAGCTGCCTCCCAGCGAGGCAGG + Intronic
1116656980 14:47665753-47665775 TAGCTGCCTCCCTGCGGGGCAGG + Intronic
1116900974 14:50362105-50362127 TAGGTGCCTCCCTGCAGGGCAGG + Intronic
1117302534 14:54443274-54443296 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1117449827 14:55839688-55839710 TAGCTGCCTTCCCCCGGGGCAGG + Intergenic
1117565653 14:56991242-56991264 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1117571903 14:57056753-57056775 TAGCTGCCTTACCACGGGGCAGG - Intergenic
1118215348 14:63803402-63803424 TAGCTGCCTTTCTGCGGGGCAGG - Intergenic
1118558894 14:67056854-67056876 CAGCCGCCTCCTTGCGGGGCAGG - Intronic
1119027791 14:71167717-71167739 TAGCTGCCTCCCCGCAGGCCGGG + Intergenic
1119303665 14:73590616-73590638 TAGCTGCCTCCCCGCGGCGCAGG - Intergenic
1119424844 14:74528535-74528557 GGGCTGCCTCTCTGCTGGCCCGG + Exonic
1119486802 14:74994371-74994393 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1119745450 14:77040600-77040622 CCGCAGCCTCTCTGCGCGGCAGG + Intergenic
1119870681 14:78014118-78014140 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1120209847 14:81623905-81623927 TAGCTGCCTCCCCGCTGGGCAGG - Intergenic
1120215718 14:81679331-81679353 TAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1120331005 14:83092607-83092629 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1120480546 14:85043913-85043935 AAGCTGCATCTCTGAGAGGCTGG + Intergenic
1120632287 14:86905568-86905590 TAGCTGCTCCCCCGCGGGGCAGG - Intergenic
1120704748 14:87734886-87734908 TAGCTGCCTCCCCGAGGGGCAGG - Intergenic
1120844185 14:89111870-89111892 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
1121350642 14:93170255-93170277 TAGCTGCCTCCCCGCCGGGCAGG - Intergenic
1121670735 14:95709118-95709140 CAGGTGCCTCTCAGCAGGGCTGG - Intergenic
1121927076 14:97937453-97937475 TAGCTGCCTTTCTGGGGCACTGG - Intronic
1122216514 14:100208318-100208340 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1122493435 14:102135649-102135671 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1122894800 14:104751636-104751658 CAGCTGCCTCCCCGCGAGGCAGG - Intergenic
1122898217 14:104770987-104771009 GAGCTGCCTCTGTGGGGGGCTGG - Intronic
1123799162 15:23803136-23803158 TAGCTGCCTTCCCGCGGGACAGG + Intergenic
1123825556 15:24078564-24078586 CAGCTGCCTCCCCACGGGGCAGG - Intergenic
1123949108 15:25253331-25253353 TAGCTGCCTTCCCTCGGGGCAGG - Intergenic
1124036379 15:26057095-26057117 TAGCTGCCTCCCTGTGGGGCAGG + Intergenic
1124110587 15:26781807-26781829 TAGCTGCTTCCCCGTGGGGCAGG - Intronic
1124114833 15:26831317-26831339 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1124170226 15:27366520-27366542 TAGCTCCCTGTCTGCGGGGTAGG + Intronic
1124244869 15:28060151-28060173 CACCTGCCTCAGTGCGGGGCCGG - Intronic
1124387838 15:29224930-29224952 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1124818451 15:33019616-33019638 TAGCTGCCTCCTTGCAGGGCAGG - Intronic
1125112240 15:36047177-36047199 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1125480269 15:40074911-40074933 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1125548834 15:40529097-40529119 AAGCTGCCGCTCTGCAGGGGTGG + Intronic
1125565731 15:40677065-40677087 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1125631607 15:41151861-41151883 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1125885521 15:43226689-43226711 TAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1125914527 15:43474010-43474032 TAGCTGCCTTCCAGTGGGGCAGG - Intronic
1126089016 15:45035057-45035079 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
1126128098 15:45314315-45314337 TAGCTGCCTTCCTGCCGGGCAGG + Intergenic
1127211600 15:56779835-56779857 TAGCTGCCTCCCCGCGGGGAAGG + Intronic
1127984798 15:64061106-64061128 TAGCTGCCTCCCCACGGGGCAGG + Intronic
1128110867 15:65075247-65075269 TAGCTGCCTTCCCGCAGGGCAGG + Intronic
1128141033 15:65301209-65301231 TAGCTGCCTCCCTGCAGGGCAGG - Intergenic
1128594077 15:68929055-68929077 TAGCTGCCTCCCCGCAGGGCAGG - Intronic
1128598551 15:68975807-68975829 TAGCTGCCTCCCCGTGGGGCAGG - Intronic
1128669960 15:69567496-69567518 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1128813284 15:70587310-70587332 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1129158250 15:73732326-73732348 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1129196947 15:73973931-73973953 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1129208648 15:74052717-74052739 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1129280376 15:74480483-74480505 TAGCTGCCTTCCCGCCGGGCAGG - Intergenic
1129373994 15:75116134-75116156 TAGCTGCCTTCCCACGGGGCAGG - Intronic
1129586832 15:76875967-76875989 TTGCTGCCTCCCAGCGGGGCAGG - Intronic
1129777477 15:78246275-78246297 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1129850981 15:78793810-78793832 CAGCTGCCCCTCTCCAGGGCAGG + Intronic
1129986925 15:79926334-79926356 TAGGTGCCTCCCCGCGGGGCAGG + Intergenic
1129997161 15:80016701-80016723 TAGCTGCCTTCCGGCGGGGCAGG + Intergenic
1130077732 15:80704247-80704269 CAGCTGCCTCTCTCTGGGGTTGG + Intronic
1130132887 15:81158845-81158867 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1131250265 15:90825692-90825714 TAGCTGCTTCCCCGCAGGGCAGG + Intergenic
1131472817 15:92711199-92711221 TAGCTGCCTCCCCGCGGGGCAGG - Intronic
1131846095 15:96491972-96491994 TAGCTGCCTCCCTGCGGGGCAGG - Intergenic
1131892163 15:96984313-96984335 TAGCTGCCTCCCGGCGGGGCAGG - Intergenic
1131969247 15:97875671-97875693 TGGGGGCCTCTCTCCGGGGCTGG + Intergenic
1131992368 15:98104404-98104426 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1132044227 15:98549933-98549955 TAGCTGCCTCCCTGCAGGGCAGG + Intergenic
1132097719 15:99000229-99000251 TAGCTGCCTTCCTGCCGGGCAGG + Intronic
1132155823 15:99494815-99494837 TAGCTGCCTACCTGCGGGGCAGG - Intergenic
1132511040 16:341486-341508 TAACTGCCTTCCTGCAGGGCAGG + Intronic
1132544245 16:526032-526054 CAGCTGCCTCTCTGGTGGGGAGG + Intergenic
1132629057 16:907998-908020 TGGCGGCTCCTCTGCGGGGCCGG + Intronic
1132836798 16:1958336-1958358 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1132934607 16:2474294-2474316 CATCTGCCTCTGTGCGGGGCGGG - Intergenic
1133352147 16:5108691-5108713 TAGCTGCCTCTCCGCAGGGCAGG - Intergenic
1133362635 16:5186503-5186525 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1133367511 16:5222143-5222165 TAGCTGCCTCCCTGCGGGGAAGG - Intergenic
1133369960 16:5239816-5239838 GAGCGGCCTCTCGGCGGAGCTGG - Intergenic
1134678128 16:16104808-16104830 TAGCTGCCTCCCCGCGGGGCAGG - Intronic
1134836099 16:17362406-17362428 TAGCTAGCTCTATGCGTGGCAGG + Intronic
1135262102 16:20989779-20989801 TAGCTGCCTTGCCGCGGGGCAGG - Intronic
1135280875 16:21152820-21152842 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
1135299372 16:21312918-21312940 TAGCTGCCTTACCGCGGGGCAGG - Intergenic
1135751041 16:25059048-25059070 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1135942678 16:26836236-26836258 TAGCTGCCTTCCTGCGGGCAGGG - Intergenic
1135964964 16:27028104-27028126 TGGCTGCCTTTCCCCGGGGCTGG + Intergenic
1136163316 16:28435592-28435614 TAGCTGCCTTCCCGCCGGGCAGG + Intergenic
1136356662 16:29748576-29748598 CAGCTGCCTCCCCACGGGGCAGG + Intergenic
1137442532 16:48508912-48508934 TAGCTGCCTCTCCTCGGGGCAGG + Intergenic
1138688799 16:58749076-58749098 TAGCTGCCTCCCCGCGGGGCGGG + Intergenic
1139019031 16:62725047-62725069 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1139125517 16:64072466-64072488 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1139147758 16:64344117-64344139 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1139442319 16:66974450-66974472 TAGCTGCCTCCCCGCGGGGCAGG + Exonic
1139516523 16:67455435-67455457 CACCTGCATCTCTGGGGGGCTGG + Intronic
1139600304 16:67982446-67982468 TAGCTGCCTCCCCGCCGGGCAGG + Intergenic
1139676431 16:68526927-68526949 TAGCTGCCTCCCCGCCGAGCAGG + Intergenic
1139919567 16:70450934-70450956 TAACTGCCTCCCCGCGGGGCAGG - Intergenic
1140722497 16:77784524-77784546 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1141465725 16:84204753-84204775 TAGATGCCTTCCCGCGGGGCAGG - Intergenic
1141690402 16:85593382-85593404 AGGCTGGCTCTCTGCAGGGCTGG + Intergenic
1141702282 16:85648048-85648070 GAGCTGCCTCTCGGTGGGGCAGG + Intronic
1142060702 16:88027406-88027428 GAGCTGCCTGGCTGCAGGGCCGG - Intronic
1142299239 16:89247160-89247182 GAGCAGCCTCTCCGCGGGACTGG + Intergenic
1142828795 17:2532274-2532296 TAGCTGCCTCCCTGCGGGGCAGG - Intergenic
1143127972 17:4656690-4656712 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1143135255 17:4709231-4709253 TAGCTGCCTTCCCTCGGGGCAGG - Intergenic
1143460502 17:7100736-7100758 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1143708631 17:8718216-8718238 TAGCTGCCTCCCAGCGGGGCAGG - Intergenic
1143731229 17:8884121-8884143 ATGCTGCCTCTGTGCTGGGCAGG - Intronic
1143866327 17:9926435-9926457 GAGCTGCCTCCCTGTGGTGCTGG - Intronic
1144128100 17:12221084-12221106 TAGGTGCCTCCCCGCGGGGCAGG + Intergenic
1144455988 17:15418641-15418663 TAGCTGCTTCTCTGAGGAGCTGG + Intergenic
1144467172 17:15505911-15505933 TAGCTGCCTTCCTGCAGGGCAGG + Intronic
1144804649 17:17956629-17956651 CAGCGGTCTCCCTGCGGGGCAGG - Intronic
1146476013 17:33163340-33163362 GACCTGCCTCTCTGTGGGCCTGG + Intronic
1146740445 17:35279052-35279074 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1147150835 17:38512712-38512734 AAGCCTCCTGTCTGCGGGGCAGG - Intergenic
1147373645 17:40011161-40011183 TAGCAGCCTTCCCGCGGGGCAGG + Intergenic
1147431840 17:40376057-40376079 TAGCTGCCTCCCCACGGGGCAGG + Intergenic
1147859175 17:43507122-43507144 TAGCTGCCACTCTTCTGGGCTGG - Exonic
1147997554 17:44369026-44369048 TAGCTGCCTTCCTGCAGGGCAGG + Intergenic
1148016897 17:44528197-44528219 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1148023386 17:44568396-44568418 TAGCTGCCTCCCTGCTGGGCAGG + Intergenic
1148366155 17:47057420-47057442 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1149753995 17:59172745-59172767 CAGCTGCCTCCCCGTGGGGCAGG + Intronic
1150505221 17:65691928-65691950 GAGCTGTCTCTCAGCGGGGCTGG - Intronic
1150682523 17:67294929-67294951 TAGCTGGCTCCCCGCGGGGCAGG + Intergenic
1150772305 17:68052095-68052117 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1150775837 17:68080835-68080857 TAGCTGCCTCCCTGCGGGGCAGG + Intergenic
1150788292 17:68180071-68180093 TAGCTGCCTCCCCACGGGGCAGG + Intergenic
1150804588 17:68309047-68309069 TAGCTGCCTTCCTGTGGGGCAGG - Intronic
1150847732 17:68676716-68676738 TATCTCCCTCCCTTCGGGGCTGG - Intergenic
1151438492 17:74113469-74113491 TAACTGCCTCCCCGCGGGGCAGG - Intergenic
1151567442 17:74907179-74907201 CAGCTGCCTCCCTGAGGGGCAGG - Intergenic
1151782654 17:76257785-76257807 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1151866452 17:76806337-76806359 TAGCTGCCTCCCTGCGGGGCAGG + Intergenic
1151954716 17:77374527-77374549 TAGGAGCCTCTCCGAGGGGCGGG - Intronic
1151956095 17:77380937-77380959 GTGCTGCCCCTCTGAGGGGCTGG + Intronic
1152575130 17:81136560-81136582 CAGCTGCCTCAGTGCGGGGAAGG - Intronic
1153070399 18:1098450-1098472 TAGCTGCCTCCCTGTGGGGCAGG + Intergenic
1153644034 18:7178803-7178825 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1153832441 18:8935560-8935582 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1153868730 18:9297159-9297181 CAGCTGCCTCCCCGTGGGGCAGG + Intergenic
1154057219 18:11023784-11023806 TAGCTGCCTCCCAGCGGGGCAGG - Intronic
1154128740 18:11717083-11717105 TAGCTGCCTTCCCGCGTGGCAGG - Intronic
1154231420 18:12559226-12559248 CAGCTGCCTCCCTGCGGGGCAGG - Intronic
1154294094 18:13134820-13134842 TAGCTGCCTCCTCGCAGGGCAGG - Intergenic
1154942941 18:21132638-21132660 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1155003338 18:21706740-21706762 CAGCTGCCTCCCCACGGGGCAGG + Intronic
1155271933 18:24149691-24149713 TAGCTGCCTTCCTGCGGGGCAGG - Intronic
1155295009 18:24376717-24376739 TAGCTGCCTTCCTGCGGGGCAGG - Intronic
1155611686 18:27674002-27674024 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1155806280 18:30175255-30175277 TAGCTGCCTCCCCGGGGGGCAGG - Intergenic
1155856359 18:30839296-30839318 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1156038693 18:32794797-32794819 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1156610482 18:38718566-38718588 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1156629037 18:38944540-38944562 CAGCTGCCTCCCTGCAGGGCAGG - Intergenic
1156657847 18:39309316-39309338 CAGCTGCCTCCCCACGGGGCAGG + Intergenic
1156683587 18:39618678-39618700 CAGCTGCTTCCCTGCAGGGCAGG + Intergenic
1156863676 18:41865980-41866002 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
1156943188 18:42795455-42795477 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
1156969696 18:43139744-43139766 TAGCTGCCTCCCTGCAGGGCAGG + Intergenic
1157085990 18:44580956-44580978 TAGCCGCCTTCCCGCGGGGCAGG + Intergenic
1157856889 18:51111986-51112008 TAGCTGCCTCCCTGCGGGGCAGG - Intergenic
1157979781 18:52367041-52367063 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1158266464 18:55665113-55665135 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1158282291 18:55840846-55840868 CAGCTGCCTCCCTGCGGGGAAGG - Intergenic
1158351942 18:56572513-56572535 TAGCTGCCTTCCCGCGTGGCGGG + Intergenic
1158460719 18:57643795-57643817 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1158553900 18:58459596-58459618 TAGCTGCCTCCCCACGGGGAAGG + Intergenic
1158617187 18:58999029-58999051 TAGCAGCCACTATGCGGGGGAGG + Intergenic
1158697237 18:59714230-59714252 TAGCTGCTTTCCCGCGGGGCAGG - Intergenic
1158705732 18:59790589-59790611 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1159109820 18:64043186-64043208 CAGCTGCCTCCCCGTGGGGCAGG + Intergenic
1159167931 18:64725776-64725798 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1159230824 18:65605477-65605499 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1159260467 18:66006092-66006114 TAGCTGCCTCCCTGAGTGGCAGG - Intergenic
1159322234 18:66866884-66866906 TAGCTGCCTCCCCGCAGGGCAGG + Intergenic
1159655908 18:71030267-71030289 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1159670204 18:71212662-71212684 TAGCTGCCTCCCCTCGGGGCAGG - Intergenic
1160198578 18:76777468-76777490 TAGCTGCCTTCCCGCCGGGCAGG + Intergenic
1160200059 18:76788713-76788735 TAGCTGCCTCCCGGCAGGGCAGG - Intergenic
1160898001 19:1411803-1411825 GAGCGCCCTCTGTGCGGGGCGGG - Intronic
1161324533 19:3657097-3657119 AAGCTGCATCTCTGATGGGCAGG + Intronic
1162091068 19:8280495-8280517 CAGCTGCCTCCCGGCTGGGCAGG - Intronic
1162093302 19:8295333-8295355 CAGCTGCCTCCCGGCTGGGCAGG - Intronic
1162107018 19:8375987-8376009 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
1162230168 19:9259736-9259758 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1162233089 19:9283591-9283613 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1162237665 19:9321616-9321638 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
1162632681 19:11941433-11941455 TAGCTGCCTTCCCACGGGGCAGG - Intronic
1162814705 19:13186842-13186864 TAGCTGCCTTTCCGTGGGGCAGG - Intergenic
1163181702 19:15608782-15608804 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1163218869 19:15899909-15899931 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1163534686 19:17870342-17870364 TTGCTCCCTCTCTGCTGTGCAGG - Intergenic
1163631857 19:18421564-18421586 TACCTGCCTCCCTGCTGGGGTGG - Intronic
1164144011 19:22499126-22499148 TAGCTGCCTTCCTGTGGGGCAGG - Intronic
1164270564 19:23668664-23668686 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1164310481 19:24041537-24041559 TAGCTGCTTTCCTGCGGGGCAGG + Intronic
1164807415 19:31127734-31127756 TCCCGGCCTCTCTACGGGGCTGG - Intergenic
1164975818 19:32571808-32571830 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1165036398 19:33036818-33036840 TAGCTGCCTTCCCGTGGGGCAGG + Intronic
1165266947 19:34668373-34668395 TAGCTGCCTTCCGGCGGGGCAGG + Intronic
1165386111 19:35511583-35511605 CCGCTGCCTCCCTGAGGGGCAGG + Exonic
1165415516 19:35691239-35691261 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1165846604 19:38821719-38821741 CAGCTGCCTCCCTGTGGGGCAGG + Intronic
1166036199 19:40170278-40170300 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1166204417 19:41259775-41259797 TAGCTGCCTCACTGCGGCTGAGG + Exonic
1166853393 19:45770879-45770901 TAGCTGCGCATTTGCGGGGCTGG - Intronic
1168659908 19:58157526-58157548 TAGCTGCCTCCCCGCGTGGCAGG + Intergenic
924967394 2:91214-91236 CAGCTGCCTCCCCGCGGGGCAGG + Intergenic
924977459 2:191496-191518 CAGCCACCTCCCTGCGGGGCAGG - Intergenic
925088676 2:1134860-1134882 TAGCTGCCTCCCCGCGGGGCAGG - Intronic
925098952 2:1229736-1229758 TGGCTGCCTTCCGGCGGGGCAGG - Intronic
925537787 2:4935451-4935473 TAGCTGCCTTCCCGAGGGGCAGG - Intergenic
926097515 2:10091640-10091662 TAGCGGCCGCGCCGCGGGGCAGG + Intergenic
926444521 2:12926690-12926712 TAGCTGCCTTCCTACGGGGCAGG - Intergenic
926474765 2:13308472-13308494 TAGCTGCCTCCCCGCCGGGCAGG - Intergenic
926616613 2:15002672-15002694 TAGCTGCCTTCCCGCCGGGCAGG - Intergenic
926850668 2:17193734-17193756 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
927357094 2:22186523-22186545 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
927777812 2:25915684-25915706 TAGCTGCCTTCCCGCCGGGCAGG + Intergenic
927900439 2:26814650-26814672 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
927942174 2:27111648-27111670 CAGCTGCCTCCCCGCGGGGCAGG - Intronic
928106373 2:28472851-28472873 TAGCTTCCTCCCTGCAGGGCAGG + Intronic
928493103 2:31803926-31803948 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
928617923 2:33057565-33057587 TAGCTGCCTCCCTGTGGGGCAGG - Intronic
928688579 2:33775574-33775596 CAGCCGCCTCCCCGCGGGGCAGG + Intergenic
928701533 2:33903698-33903720 TAGCTGCCTCCCCGCAGGGCAGG - Intergenic
928753214 2:34494516-34494538 TGGCTGCCTTCCTACGGGGCAGG + Intergenic
928880598 2:36092464-36092486 CAGCTGCCTCCCTGTGGGGCAGG + Intergenic
928936918 2:36688484-36688506 TAGCTGCCTTCCCGCTGGGCAGG + Intergenic
929070077 2:38020734-38020756 TAGCTGCCTCCCGGCAGGGCAGG + Intronic
929109876 2:38397485-38397507 TAGCTGCCTCCCCACAGGGCAGG + Intergenic
929137998 2:38643206-38643228 CAGCTGCCTCCTCGCGGGGCAGG - Intergenic
929201876 2:39244498-39244520 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
929233730 2:39585578-39585600 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
929379707 2:41335813-41335835 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
929890849 2:45917809-45917831 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
930312942 2:49764643-49764665 TGGCTGGCTCTCTGCTGGGATGG - Intergenic
930338742 2:50084346-50084368 TAGCTGCCTCCCTGCGGGGCAGG - Intronic
930420866 2:51151756-51151778 CAGCTGCCTCCCCGCGGGGTGGG - Intergenic
930485531 2:52007022-52007044 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
931106992 2:59067151-59067173 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
931708709 2:64969227-64969249 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
932178290 2:69622254-69622276 TAGCTGCCTCCCCGCGGGGCAGG + Intronic
932239954 2:70148528-70148550 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
932486499 2:72087104-72087126 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
932521790 2:72422050-72422072 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
932902069 2:75711797-75711819 TAGCTGCCTTCCCGCGGTGCAGG + Intergenic
933060823 2:77734920-77734942 TAGCTGCCTCCCCGCGGGCAGGG - Intergenic
933139831 2:78779217-78779239 CAGCCGCCTCCCCGCGGGGCAGG + Intergenic
933442066 2:82326387-82326409 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
933511453 2:83246106-83246128 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
933712145 2:85334550-85334572 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
934085137 2:88503318-88503340 TAGCTGCCTCCCCGCCGGGCAGG + Intergenic
934479524 2:94622351-94622373 CAGCCGCCTCGCTGTGGGGCAGG - Intergenic
934898515 2:98139226-98139248 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
935866448 2:107392498-107392520 TAGCTGCCTCCCCGCTGGGCAGG + Intergenic
935872822 2:107469561-107469583 CAGCTGCCTCCCCGCGAGGCAGG - Intergenic
935878343 2:107536228-107536250 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
935922574 2:108031790-108031812 CAGCCGCCTCCCTGTGGGGCAGG + Intergenic
936172691 2:110190369-110190391 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
936346906 2:111682073-111682095 TAGCTGCCTTCCCGCGGGCCAGG + Intergenic
936581498 2:113704542-113704564 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
937181160 2:119997208-119997230 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
937596868 2:123683996-123684018 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
937746617 2:125422471-125422493 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
937789416 2:125943062-125943084 CAGCTGCCTCCCTGCCAGGCAGG - Intergenic
937914066 2:127090346-127090368 TTGCTGCCTGCCTGCGGGGGTGG - Intronic
937977514 2:127590658-127590680 AAGCTGACTGTCTGCAGGGCTGG - Intronic
938126058 2:128672262-128672284 TAGCTGCCTCCCCGAGGGGCAGG - Intergenic
938401048 2:130991668-130991690 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
938726008 2:134109483-134109505 TAGCTGCCTCCCTGGGGGGCAGG - Intergenic
938931196 2:136088204-136088226 TAGCTGCCTTCCAGCGAGGCAGG - Intergenic
939053195 2:137331745-137331767 TAGCTGCCTTCCCTCGGGGCAGG - Intronic
939229780 2:139410563-139410585 TAGCTGCCTTCCCTCGGGGCAGG + Intergenic
939465150 2:142546283-142546305 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
939738758 2:145881037-145881059 TAGCTGCCTTCCTGCGGGGCAGG - Intergenic
939886410 2:147686389-147686411 CAGCTGCCTCCCTACAGGGCAGG - Intergenic
939898936 2:147827082-147827104 TAGCTGCCTCCCTGTGGAGTAGG + Intergenic
940145773 2:150542697-150542719 TAGCTGCCACCCCGCAGGGCAGG - Intergenic
940666686 2:156618172-156618194 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
941178911 2:162235064-162235086 TAGCTGCCTCCCTGCGGGGCAGG + Intronic
941309805 2:163913836-163913858 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
941397910 2:164994892-164994914 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
941820814 2:169841756-169841778 TGGCTGCCTTCCCGCGGGGCAGG + Intronic
941928049 2:170915514-170915536 TAGCTGCCTCCCCGCAGGGCAGG - Intergenic
942170233 2:173282726-173282748 CAGCTGCCTCCGCGCGGGGCAGG - Intergenic
942235400 2:173899131-173899153 TAGTCTCCTCTCTGCTGGGCTGG - Intergenic
942250462 2:174043400-174043422 AAGATGCCTCTGTGAGGGGCTGG - Intergenic
942299583 2:174548732-174548754 TAGCTGCCTTCCCGCCGGGCAGG - Intergenic
942317577 2:174709708-174709730 TAGCTGCCTCCCTGCAGGGCAGG - Intergenic
942368651 2:175257140-175257162 CAGCCGCCTCCCCGCGGGGCAGG - Intergenic
942469225 2:176242499-176242521 AAGATGCCTCTGTGAGGGGCTGG - Intergenic
942540209 2:177008074-177008096 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
942867311 2:180691610-180691632 TAGCTGCCTTCCCGCGGTGCAGG + Intergenic
943024228 2:182608627-182608649 TAGCTGCCTCCCCACAGGGCAGG + Intergenic
943106148 2:183546827-183546849 TAGCTGCCTTCCTGTGGTGCAGG - Intergenic
943166061 2:184327829-184327851 TAGCTGCCTCCCCACGGGGCAGG - Intergenic
943443313 2:187951937-187951959 CAGCCGCCTCCCTGTGGGGCAGG + Intergenic
943494732 2:188606532-188606554 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
943680319 2:190761092-190761114 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
943835180 2:192508191-192508213 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
943906106 2:193502590-193502612 TAGCTGCCTCCCCGCCGGGCAGG - Intergenic
943941426 2:194002878-194002900 TAGCTGCCTCCCCGTGGGGCAGG - Intergenic
943942746 2:194020384-194020406 TAGCTGCCTCCCTGCGGGCAGGG + Intergenic
943954937 2:194176536-194176558 TAGCTGCCTCCCCGCAGGGCAGG + Intergenic
944058480 2:195547500-195547522 TAGCTGCCTCCTCGCGGGGCAGG - Intergenic
944252470 2:197591695-197591717 TAGCTGCCTCCCCGCCGGGCAGG - Intronic
944482811 2:200174958-200174980 TAGCTGCCTCCCGGCAGGGCAGG + Intergenic
944728621 2:202497133-202497155 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
944843129 2:203643010-203643032 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
944857915 2:203785712-203785734 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
945069652 2:205977406-205977428 TAGCTGCCTCCCTGCAGGGCAGG + Intergenic
945401404 2:209387557-209387579 TAGCTGCCTCCCCAAGGGGCAGG + Intergenic
945575456 2:211524515-211524537 TAGCTGCCTTCCCACGGGGCAGG - Intronic
945664210 2:212721207-212721229 CAGCTGCCTCCCCGCGGGGCAGG - Intergenic
945745801 2:213718714-213718736 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
945870233 2:215219280-215219302 TAGCTGCCTCCCCACGGGGCAGG + Intergenic
945872807 2:215245866-215245888 TAGCTGCCTCCCCACGGGGCAGG - Intergenic
945907872 2:215615023-215615045 CAGCCGCCTCCCCGCGGGGCAGG - Intergenic
946054003 2:216885428-216885450 TAGCTACCTCCCTGCCGGGCAGG + Intergenic
946152750 2:217787403-217787425 CAGCTGCCTCCCCGAGGGGCAGG - Intergenic
946358065 2:219201565-219201587 TAGCTGCCTTCCCGCCGGGCAGG - Intronic
946376518 2:219313000-219313022 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
946982145 2:225229586-225229608 TAGCTGCCTCCCCTCGGGGCAGG - Intergenic
947103816 2:226648230-226648252 TAGCTGCCTCCCAAAGGGGCAGG + Intergenic
947536830 2:230945009-230945031 CAGGAGCCTCACTGCGGGGCTGG + Intronic
947539338 2:230964374-230964396 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
947720442 2:232366563-232366585 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
947932037 2:233972606-233972628 TAGCTGCCTTCCCGTGGGGCAGG - Intronic
948449088 2:238057991-238058013 TAGCTGCCTCCCCGTGGGGCAGG - Intronic
948611069 2:239167366-239167388 TGGCTCCCTCTATGCAGGGCTGG + Intronic
948712485 2:239833669-239833691 TTGCTGCCCCTCTGCCGGCCAGG - Intergenic
948775609 2:240287349-240287371 CAGCTGCCTGTGTGCGGGACAGG - Intergenic
948820115 2:240538503-240538525 CAGCTGCCTCCCCACGGGGCAGG + Intronic
948835837 2:240625589-240625611 TAGGGGCCTCCCAGCGGGGCAGG + Intronic
1169130787 20:3165505-3165527 TAGTTTCCTCTATCCGGGGCAGG + Exonic
1169645336 20:7803698-7803720 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1169814433 20:9641726-9641748 TAGCTGCCTTCCCACGGGGCAGG - Intronic
1170204577 20:13784654-13784676 TAGCTGCCCCCCTGCGGTACAGG - Intronic
1170230860 20:14044964-14044986 TAGCTGCCTCCCTGTGGGGCAGG - Intronic
1170246490 20:14226730-14226752 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
1170297866 20:14849083-14849105 TAGCTGACTCTCTTCTGGTCAGG + Intronic
1170649523 20:18226988-18227010 TAGCTGCCTCCCTGCGGGGCAGG + Intergenic
1170806829 20:19639768-19639790 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1170989906 20:21292094-21292116 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1171189054 20:23145413-23145435 TTGCTGCCTGCCTGCGGGGAAGG + Intergenic
1171318832 20:24220858-24220880 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1172431838 20:34898940-34898962 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1173601615 20:44299356-44299378 TAGCTGCCTTCCCGCGGAGCAGG + Intergenic
1173831530 20:46092073-46092095 TAGCTGCCTCCCCGTGGGGCAGG + Intergenic
1174162872 20:48564245-48564267 TAGCTGCCTCCCTGCGGGGCAGG - Intergenic
1175204449 20:57301130-57301152 CAGCTGCCTCACAGCTGGGCAGG - Intergenic
1175210087 20:57348619-57348641 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
1175254170 20:57629012-57629034 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1176189398 20:63800760-63800782 TAGCTGCCTCCCCTCAGGGCAGG + Intronic
1176344819 21:5733654-5733676 TAGCTGCCTCCCCACGGGGCAGG - Intergenic
1176351633 21:5854238-5854260 TAGCTGCCTCCCCACGGGGCAGG - Intergenic
1176500008 21:7590801-7590823 TAGCTGCCTCCCCACGGGGCAGG + Intergenic
1176539140 21:8131724-8131746 TAGCTGCCTCCCCACGGGGCAGG - Intergenic
1176558091 21:8314769-8314791 TAGCTGCCTCCCCACGGGGCAGG - Intergenic
1176872230 21:14093108-14093130 TAGCTGCCTCCCTGTGGGGCGGG - Intergenic
1176966596 21:15218713-15218735 TGGCTGCCTTCCCGCGGGGCAGG - Intergenic
1177182369 21:17757725-17757747 TAGCTGCCACCCTGCCGGGCAGG - Intergenic
1177318730 21:19493763-19493785 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1177496952 21:21902647-21902669 TAGCTGCCTTCCCGCTGGGCAGG + Intergenic
1177565811 21:22818996-22819018 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1177637639 21:23807238-23807260 TAGCTGCCTTCCCGCGGGTCAGG + Intergenic
1178054553 21:28783979-28784001 CAGCTGCCTCCCTGCGGGGCAGG + Intergenic
1178082200 21:29077296-29077318 TAGCTGTCTTCCTGCAGGGCAGG - Intergenic
1178398763 21:32265554-32265576 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1178585624 21:33868454-33868476 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1178983330 21:37283322-37283344 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1179411981 21:41168819-41168841 GAGCTCCCCCTCCGCGGGGCTGG + Intronic
1180741022 22:18053494-18053516 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1180755105 22:18155707-18155729 TAGCTGCCTCCTGGCAGGGCAGG + Intronic
1180979032 22:19870077-19870099 TAGCTGACTCTCACAGGGGCAGG - Intergenic
1181077658 22:20392546-20392568 TCGTTGCCTCCCCGCGGGGCAGG - Intergenic
1181450531 22:23017196-23017218 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1181466634 22:23113949-23113971 GGGCTGCCTGTCTGCTGGGCAGG - Intronic
1181851500 22:25753025-25753047 CAGCCGCCTCCCCGCGGGGCAGG + Intronic
1182338018 22:29598204-29598226 TAGCTGCCCCTCCGCGGAGAAGG - Intergenic
1182479405 22:30597086-30597108 TAGCTGCCTCCCCGTGGGGCAGG + Intronic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183064071 22:35351654-35351676 TAGGGGCCTGTCTGTGGGGCAGG - Intergenic
1183387098 22:37521023-37521045 GAGCTGCCGCTCTGCGTGGGAGG - Intergenic
1183685257 22:39357822-39357844 TAGCTGCCTTCCCTCGGGGCAGG + Intronic
1183990377 22:41593744-41593766 TAGCTGCCTCCCCGCTGGGCAGG + Intergenic
1184042624 22:41953001-41953023 CAGCTGCCTTTCTGGGGAGCTGG - Intergenic
1184584277 22:45436951-45436973 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1184906231 22:47488444-47488466 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1185229099 22:49670339-49670361 CAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1203244090 22_KI270733v1_random:48079-48101 TAGCTGCCTCCCCACGGGGCAGG - Intergenic
949258995 3:2083850-2083872 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
949292774 3:2485131-2485153 CAGCTGCCTCCCCGTGGGGCAGG + Intronic
949770015 3:7568819-7568841 TAGCTGCCTCCCCGTGGGGAGGG + Intronic
950068941 3:10136573-10136595 TAGCTGCCTCCCAGCCGGGCAGG - Intergenic
950119225 3:10470771-10470793 TTGCTGACTCTCTTGGGGGCTGG - Intronic
950203621 3:11061596-11061618 TAGGTGCCTCCCCACGGGGCAGG + Intergenic
950207912 3:11094259-11094281 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
950256636 3:11511733-11511755 TAGCTGCCTTCCCTCGGGGCAGG - Intronic
950256940 3:11513380-11513402 TAGCTGCCTCCCCGCGGGGCAGG - Intronic
950400996 3:12769005-12769027 TAGCTGCCTCCCTGAGAGGCAGG - Intronic
950418565 3:12883069-12883091 TAGCTGCCTCCCAGCGGGGCAGG + Intergenic
950470179 3:13179935-13179957 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
950513346 3:13447334-13447356 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
950600357 3:14029632-14029654 TAGCTGCCTTCCCGTGGGGCAGG - Intronic
950632655 3:14293391-14293413 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
950634772 3:14307212-14307234 GTGCTGCCTCTGTGCAGGGCTGG + Intergenic
951024837 3:17817820-17817842 TAGCTGCCTCCCCACCGGGCAGG - Intronic
951184982 3:19702752-19702774 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
951323184 3:21271759-21271781 CAGTTGCCTCCCCGCGGGGCAGG - Intergenic
951332937 3:21387390-21387412 TAGCTGCCTCCCCGTGGGGCAGG - Intergenic
951415460 3:22417175-22417197 CAGCTGCCTCCCCCCGGGGCAGG + Intergenic
951551862 3:23882673-23882695 CAGCTGCCTCCCCGTGGGGCAGG - Intronic
951734806 3:25851943-25851965 TAGCTGCCTCCCCACTGGGCAGG + Intergenic
951737856 3:25887551-25887573 TAGCTCCCTCTCTGTGGGCTTGG + Intergenic
951951067 3:28200550-28200572 TAGCTGCCTTCCCGCCGGGCAGG - Intergenic
952058071 3:29473639-29473661 TAGCTGCCTCCCCGAGGGGCAGG - Intronic
952076332 3:29701794-29701816 CAGCTGTCTCCCAGCGGGGCAGG + Intronic
952360493 3:32625856-32625878 TAGCTGCCTTCCCTCGGGGCAGG + Intergenic
952398252 3:32939906-32939928 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
952453712 3:33453677-33453699 TAGCTGCCTCCCCGCAGGGCAGG + Intergenic
952593660 3:34988599-34988621 TAGCTGCCTTCCGGCAGGGCAGG + Intergenic
952713329 3:36453525-36453547 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
952730663 3:36634130-36634152 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
952795266 3:37233226-37233248 TAGCTGCCTTCTCGCGGGGCAGG + Intergenic
953002912 3:38951374-38951396 TAGCTGACTTCCCGCGGGGCAGG + Intergenic
953124492 3:40078064-40078086 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
953423035 3:42769890-42769912 TAGCTGCCTCCCCGCAGGGCAGG + Intronic
953522475 3:43656564-43656586 TAGCTGCCTTCCCGCAGGGCAGG - Intronic
953674060 3:44986266-44986288 TAGCTGCCTTCCCACGGGGCAGG - Intronic
954041024 3:47887429-47887451 TAGCTGCTTTCCCGCGGGGCAGG + Intronic
954226183 3:49182803-49182825 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
954502200 3:51029335-51029357 TTGCTCACCCTCTGCGGGGCTGG + Intronic
954620150 3:51990795-51990817 TAGCTGCCTTCCCGCGGGTCAGG + Intergenic
955183374 3:56692102-56692124 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
955186444 3:56719155-56719177 TAGCTGCCTTCCTGCAGGGCAGG + Intergenic
955219686 3:57013090-57013112 CAGCTGCCTCCCCGCTGGGCAGG + Intronic
955449505 3:59051080-59051102 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
956183922 3:66544794-66544816 CAGCTGCCTCCCTGCGGGGCGGG - Intergenic
956362799 3:68467090-68467112 TAGCTGCCTGTGGGCCGGGCAGG - Intronic
956563645 3:70612035-70612057 TAGCTGCCTCCCCATGGGGCAGG + Intergenic
956632611 3:71331311-71331333 TAGCTGCCTCCCCGCGGGGCAGG + Intronic
956855280 3:73269416-73269438 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
956986982 3:74712244-74712266 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
957002253 3:74900114-74900136 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
957009161 3:74985263-74985285 TAGCTGCCTTCCTGCGGGGCAGG - Intergenic
957056155 3:75444594-75444616 TAGCTGCTTCCCTGCAGGGCAGG - Intergenic
957074096 3:75587979-75588001 TAGCTGCCTCCCCACAGGGCAGG + Intergenic
957209411 3:77240224-77240246 CAGCTGCCTCCCTGCGGGGCAGG - Intronic
957277486 3:78108611-78108633 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
957371503 3:79300442-79300464 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
957386457 3:79502433-79502455 TAGCTGCCTCCCCGCGGGGCAGG + Intronic
957419647 3:79951508-79951530 TAGCTGCCTTCCCGGGGGGCAGG - Intergenic
957446139 3:80314673-80314695 TAGCTGCCTCCCCACAGGGCAGG + Intergenic
957556275 3:81767524-81767546 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
957560146 3:81812146-81812168 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
957804885 3:85133998-85134020 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
957829993 3:85504813-85504835 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
957885517 3:86282444-86282466 TTGCTGCCTCCCAGTGGGGCAGG + Intergenic
957921843 3:86757824-86757846 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
957970408 3:87375522-87375544 CAGCTGCCTCCCTGCCTGGCAGG + Intergenic
958022654 3:88015912-88015934 TAGCTGCCTTCCCGCGGGACAGG + Intergenic
958419892 3:93917809-93917831 TAGCTGCCTCCCTGCAGGGCAGG + Intronic
958810747 3:98858108-98858130 TAGCTGCCTCCCCGTGGGGCAGG - Intronic
959323357 3:104906360-104906382 CAGCTGCCTCCCTGTGGGGCAGG + Intergenic
959422761 3:106148850-106148872 TAGCTGCCTTCCTGTGGGGCAGG + Intergenic
960149782 3:114238427-114238449 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
960199392 3:114812834-114812856 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
960227517 3:115185025-115185047 TAGCTGCGTTCCCGCGGGGCAGG - Intergenic
960282160 3:115791785-115791807 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
960487329 3:118269880-118269902 TAGCTGCCTCCCCGAGGGGCAGG + Intergenic
960669225 3:120140472-120140494 CAGCTGCCTCCCCGCGGGGCAGG + Intergenic
960685510 3:120289902-120289924 TAGCTGCCCCACCGCAGGGCAGG + Intergenic
960761652 3:121078691-121078713 TAGCTGCCTCCCTGTGGGGCAGG - Intronic
960868582 3:122227359-122227381 TAGCTGCCTCCCCGTGGGGCAGG - Intronic
961268798 3:125671899-125671921 CAGCTGCCTCCCCGCGGGGCAGG + Intergenic
961279996 3:125758760-125758782 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
961298240 3:125904113-125904135 TAGCTGCCTCTCCACAGGGCAGG + Intergenic
961460485 3:127046900-127046922 TAGCTGCCTTCCTGCGGGGCGGG + Intergenic
961461938 3:127056245-127056267 TAGCTGCCTCCCTGTGGGGCAGG - Intergenic
961465033 3:127076422-127076444 TAGCTGCCTCCCCGCGGGGAAGG - Intergenic
961500034 3:127325863-127325885 TAGCTCACTCTCTGGTGGGCAGG + Intergenic
961688824 3:128653622-128653644 TAGCTGCCTCCCCGCAGGGCAGG + Intronic
961700770 3:128743059-128743081 CAGCTGCCTCCCCGTGGGGCAGG - Intronic
961746717 3:129068463-129068485 TAACTGCCTCCCCGCAGGGCAGG - Intergenic
961873267 3:130003056-130003078 GAGCGGCCTCTCGGCGGAGCTGG + Intergenic
961874406 3:130010819-130010841 TAGCTGCCTCCCCGTGGGGCAGG + Intergenic
962177223 3:133167529-133167551 CAGCCGCCTCCCCGCGGGGCAGG - Intronic
962283732 3:134070398-134070420 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
962398733 3:135039566-135039588 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
962591053 3:136890135-136890157 CAGCTGCCTCCCCGTGGGGCAGG - Intronic
962671675 3:137714660-137714682 TAGCTGCCTCCCCACGGGGCAGG - Intergenic
963397231 3:144750035-144750057 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
963440426 3:145333601-145333623 TAGCTGCCTTCCCGCGGGGCGGG + Intergenic
963509135 3:146225569-146225591 TAGCTGCCTTCCTGCGGGGCGGG - Intronic
963533287 3:146497521-146497543 TAGCTGCCTCCCCGTGGGGCAGG + Intergenic
963554681 3:146772568-146772590 CAGCTGCCTCCCCGCCGGGCAGG + Intergenic
963589966 3:147245746-147245768 TGGCTGCCTTCCCGCGGGGCAGG - Intergenic
963742996 3:149098031-149098053 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
963760604 3:149284202-149284224 TAGCTGCCTTCCCTCGGGGCAGG + Intergenic
963862193 3:150323191-150323213 TAACTGCCTTCCCGCGGGGCAGG + Intergenic
964032339 3:152152640-152152662 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
964037562 3:152217525-152217547 TAGCTGCCTCCCTGTGGGGCAGG + Intergenic
964064082 3:152559658-152559680 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
964129268 3:153268904-153268926 CAGCCGCCTCCCCGCGGGGCAGG + Intergenic
964138341 3:153369893-153369915 CAGCCGCCTCCCTGCGGGGCAGG - Intergenic
964139197 3:153378473-153378495 TAGCTGCCTTTCCACGGGGCAGG - Intergenic
964198164 3:154088192-154088214 TAGCTGCTTCCCTGTAGGGCAGG + Intergenic
964265357 3:154889374-154889396 CAGCTGCCTCCCTGTGGGGCAGG - Intergenic
964375065 3:156041499-156041521 TAGCTGCCTCCCTGCGGGGCAGG + Intronic
964376281 3:156051989-156052011 CAGCTGCCTCCCCACGGGGCAGG + Intronic
964378535 3:156073340-156073362 TAGCTGCCTCCCCATGGGGCAGG + Intronic
964381110 3:156099647-156099669 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
964393762 3:156224059-156224081 TAGCTGCCTCCCCACGGGGCAGG - Intronic
964444024 3:156740801-156740823 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
964527795 3:157633356-157633378 TAGCTGTGTCTCTGCATGGCAGG - Intronic
964751880 3:160060747-160060769 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
964802875 3:160574126-160574148 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
964974195 3:162599921-162599943 TGGCTGCCTTCCCGCGGGGCAGG + Intergenic
964977777 3:162640293-162640315 TAGCTGCCTCCCCACGGGGCAGG + Intergenic
964982486 3:162703062-162703084 TAGCTGCCTCCCCATGGGGCAGG - Intergenic
964983134 3:162710647-162710669 TAGCTGCCTCCCTATGGGGCAGG - Intergenic
964993491 3:162844751-162844773 CAGCTGTCTCCCTGCGAGGCAGG - Intergenic
965040317 3:163499245-163499267 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
965044112 3:163552459-163552481 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
965078014 3:164003191-164003213 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
965092265 3:164179471-164179493 CAGCTGCCTCCCCACGGGGCAGG + Intergenic
965109402 3:164402027-164402049 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
965200324 3:165649454-165649476 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
965220194 3:165918586-165918608 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
965220879 3:165924475-165924497 TAGCTGCCTTCCCGCGGGGTAGG - Intergenic
965298152 3:166976057-166976079 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
965446482 3:168780319-168780341 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
965652384 3:170947451-170947473 CAGCTGCCTCCCCACGGGGCAGG + Intergenic
965753209 3:171999008-171999030 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
965837391 3:172867005-172867027 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
965943462 3:174212109-174212131 TAGCTGCCCTCCCGCGGGGCAGG - Intronic
966076085 3:175937596-175937618 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
966096768 3:176213557-176213579 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
966108189 3:176362360-176362382 CAGCTGCCTCTCCACAGGGCAGG - Intergenic
966183010 3:177204007-177204029 CAGCCGCCTCCCTGTGGGGCAGG - Intergenic
966190994 3:177271866-177271888 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
966372410 3:179263190-179263212 TAGGTGCCTCCCCGCGGGGCAGG - Intronic
966725409 3:183103883-183103905 TGGCTGCCTCCCCGCGGGGCAGG - Intronic
967234081 3:187367708-187367730 TAGCTGCCTCTCTGTGGGGCAGG - Intergenic
967448526 3:189596347-189596369 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
967499131 3:190177186-190177208 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
967594901 3:191317145-191317167 CAGCCGCCTCCCCGCGGGGCAGG - Intronic
967718375 3:192789255-192789277 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
967923474 3:194629716-194629738 TACCTGCCTCCCGGAGGGGCTGG + Intronic
967923490 3:194629788-194629810 TACCTGCCTCCCGGAGGGGCTGG + Intronic
968079996 3:195839452-195839474 TACCTGCCTCCCTCCAGGGCCGG - Intergenic
968412794 4:404139-404161 TAGCTTCCTCCCCGCGGGGCAGG - Intergenic
968469691 4:773746-773768 TAGCTGCCTCCCTGCAGGGCAGG + Intergenic
968804419 4:2763262-2763284 TAGCTGCATTCCCGCGGGGCGGG - Intergenic
968998963 4:3964874-3964896 TAGCTGCTTCCCTGCAGGGCAGG - Intergenic
969016573 4:4107547-4107569 GAGCGGCCTCTCGGCGGAGCTGG + Intergenic
969265128 4:6059500-6059522 TAGATGCCTCTCTGCAGGCAGGG + Intronic
969362377 4:6672947-6672969 TAGCTGCCTTTCCGAGGGGCAGG + Intergenic
969440764 4:7215352-7215374 TAGCTGCCTTTCCGCGGGGCAGG + Intronic
969597596 4:8158033-8158055 TGACAGCCTCTGTGCGGGGCTGG - Intronic
969654954 4:8491547-8491569 TAGCTGCCTTTCCATGGGGCAGG - Intronic
969737383 4:9000770-9000792 GAGCGGCCTCTCGGCGGAGCTGG - Intergenic
969755037 4:9143758-9143780 TAGCTGCTTCCCTGCAGGGCAGG + Intergenic
969795470 4:9524595-9524617 TAGCTGCCTCCCCGTGGGGCAGG - Intergenic
970108328 4:12609811-12609833 TAGCTGCCTCCCTGCAGGGCAGG + Intergenic
970272132 4:14358843-14358865 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
970391238 4:15615137-15615159 TAGCTGCCTTCCTGCGGGGCAGG + Intronic
970408628 4:15786872-15786894 CAGCTGCCTCCCCGCGGGGCAGG - Intronic
970443652 4:16106664-16106686 GAGCTGCCTCTCTCAGGGGTGGG - Intergenic
970576849 4:17436703-17436725 TAGCTGCCTCCCCGTGGGGCAGG - Intergenic
970615737 4:17766944-17766966 CAGGTGCCTCCCCGCGGGGCAGG - Intronic
970649303 4:18159406-18159428 TAGCTGCCTTCCAGCGGGGCAGG - Intergenic
970673144 4:18418475-18418497 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
970803551 4:20004235-20004257 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
971280513 4:25239379-25239401 TAGCTGCCTCCCCGTAGGGCAGG - Intronic
971281663 4:25246761-25246783 TAGCTGCCTCCCCACAGGGCAGG - Intronic
971377087 4:26064105-26064127 TAGTTGCCTTCCTGCGGGGCAGG - Intergenic
971553018 4:27978472-27978494 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
971563586 4:28113003-28113025 TAGCTGTCTCCCTGCGGTGCAGG + Intergenic
971564174 4:28117278-28117300 CAGCTGCCTCCCGGTGGGGCAGG - Intergenic
971639847 4:29117577-29117599 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
971811975 4:31438875-31438897 TAGCTGCCTTCCTGTAGGGCAGG + Intergenic
971852118 4:31996612-31996634 TAGCTGCCTCCCCGCAGGGCAGG + Intergenic
971905174 4:32716362-32716384 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
972173393 4:36375171-36375193 CAGCTGCCTCCCCACGGGGCAGG + Intergenic
972344659 4:38182788-38182810 CAGCTGCCTTTCCGTGGGGCAGG + Intergenic
972360922 4:38325053-38325075 CAGCTGCCTCCTTGTGGGGCAGG - Intergenic
972505762 4:39718638-39718660 TAGCTGCCTCCCCACGGGGCAGG - Intronic
973037121 4:45420380-45420402 TAGCTGCCTCCCCACTGGGCAGG + Intergenic
973041784 4:45477486-45477508 CAGCTGCCTCCCCACGGGGCAGG - Intergenic
973048594 4:45567276-45567298 TAGCTGCCTCCCTGCGGGGCAGG + Intergenic
973190292 4:47378188-47378210 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
973308100 4:48675564-48675586 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
973587744 4:52409883-52409905 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
973817605 4:54632760-54632782 TAGCTGCCTCCCCACGGGGCAGG + Intergenic
973854121 4:54993693-54993715 TAGCTGCCTCCCCACAGGGCAGG + Intergenic
974147441 4:57965648-57965670 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
974147729 4:57967420-57967442 TAGCCACCTCCCTGTGGGGCAGG + Intergenic
974186804 4:58457154-58457176 CAGCCGCCTCCCTGTGGGGCAGG + Intergenic
974484765 4:62492033-62492055 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
974641724 4:64640610-64640632 TAGCTGCCTTCCTGCGGGGCAGG - Intergenic
974781723 4:66561626-66561648 TCGCTGCCTCCCCGCGGGGCAGG - Intergenic
974792748 4:66712551-66712573 TAGCTGCCTCCCTGCGGGACAGG - Intergenic
974804407 4:66860392-66860414 TAGCTGCCCTCCCGCGGGGCAGG + Intergenic
974807546 4:66899596-66899618 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
974827782 4:67152103-67152125 TAGCTACCTTCCCGCGGGGCAGG + Intergenic
974839322 4:67282958-67282980 TAGCTGCCTCCCCATGGGGCAGG - Intergenic
974892277 4:67896699-67896721 TAGCTGCCTCCCTGCGAGGCAGG - Intergenic
974992852 4:69115381-69115403 TAGCTGCCTTCCTGCAGGGCAGG - Intronic
975055425 4:69924114-69924136 TAGCTGCCTTCCGGCCGGGCAGG + Intergenic
975298830 4:72766079-72766101 TAGCTGCCTTCCTGCAGGGCAGG + Intergenic
975308557 4:72877285-72877307 TAGCTGCCTCCCAGCGGGGCAGG + Intergenic
975439931 4:74399201-74399223 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
975595168 4:76043432-76043454 TAGCTGCCTTCCTACAGGGCAGG - Intronic
975596344 4:76050794-76050816 TAGCTGCCTTCCTGCGGGGCAGG - Intronic
975754838 4:77562091-77562113 CAGCTGCCTCCCTGTGGGGAAGG + Intronic
975898455 4:79122156-79122178 TAGCCGCCTCCCTGTGGGGCAGG + Intergenic
975994953 4:80303020-80303042 TAGCTGCCGCCCTGCCAGGCAGG + Intronic
976102512 4:81580674-81580696 CAGCTGCCTCCCCGTGGGGCAGG + Intronic
976690580 4:87863805-87863827 CAGCTGCCTCCCGGCGGGGCAGG - Intergenic
976736280 4:88313327-88313349 TAGCTGCCTCCCTGCGGGGCAGG - Intergenic
976980274 4:91218107-91218129 TAGCTGCCTTCCCACGGGGCAGG - Intronic
977416683 4:96742742-96742764 CAGCTGCCTCCCTGCGGGGCAGG + Intergenic
977470681 4:97438222-97438244 TAGCTGCCTCCCCATGGGGCAGG - Intronic
977606911 4:98993623-98993645 TACCTGCCTCCCCACGGGGCAGG - Intergenic
977717328 4:100196657-100196679 TAGCTGCCTTCCCGCGGAGCAGG - Intergenic
977750944 4:100608902-100608924 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
977885742 4:102250425-102250447 TAGCTGCCTCCCTGCCGGGCAGG - Intergenic
978030616 4:103937001-103937023 CAGCTGCCTCCCGGCGGGGCAGG + Intergenic
978080272 4:104582204-104582226 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
978207178 4:106092538-106092560 TAGCTGCCTGCCCGCAGGGCAGG - Intronic
978254864 4:106681591-106681613 TAGCTGCCTCCCCGCAGGGCAGG - Intergenic
978285548 4:107073318-107073340 CAGCTGCCTCTGTGGGGGGCAGG + Intronic
978463606 4:108984531-108984553 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
978466278 4:109012700-109012722 CAGCCGCCTCTCCGCCGGGCAGG + Intronic
978748586 4:112222656-112222678 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
978917964 4:114148723-114148745 TAGCTGCCTCCCCACAGGGCAGG - Intergenic
978929777 4:114296288-114296310 CAGCTGCCTCCCCGCTGGGCAGG - Intergenic
978998023 4:115179566-115179588 TAGCTGCCTTCCTGAGGGGCAGG - Intergenic
979224211 4:118265781-118265803 TACCTGCCTCTCCGCGGGGCAGG + Intergenic
979290797 4:118977187-118977209 TAGCTGCCTTCCCACGGGGCAGG - Intronic
979308343 4:119174009-119174031 TAGCTGCCTTCCCGCAGGGCAGG + Intronic
979424731 4:120550874-120550896 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
979688612 4:123538140-123538162 TAGCTGCCTTCCCCCGGGGCAGG + Intergenic
979755881 4:124339233-124339255 TAGCTGCCTTCCAGAGGGGCAGG + Intergenic
979825682 4:125229717-125229739 TACCTGCCTTCCCGCGGGGCAGG - Intergenic
979857493 4:125651906-125651928 TAGCTGCCTTCCTTCGGTGCAGG - Intergenic
980043357 4:127964374-127964396 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
980115230 4:128672843-128672865 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
980230233 4:130038682-130038704 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
980470207 4:133240545-133240567 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
980595415 4:134948288-134948310 CAGCTGCCTCCCTGCAGGGCAGG - Intergenic
980739280 4:136929217-136929239 CAGCTGCCTCCCTGTGGGGCAGG + Intergenic
980774515 4:137421244-137421266 TAGCCGCCTCCCCGCGGGGCAGG + Intergenic
980799780 4:137733959-137733981 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
980827314 4:138088746-138088768 TAGCTGCCTCCCTGCAGGGCAGG - Intergenic
980865938 4:138553367-138553389 CAGCCGCCTCCCTGCGGGGCAGG + Intergenic
980888259 4:138786334-138786356 TGGCTGCCTCTGTGTGGAGCAGG - Intergenic
981169539 4:141605532-141605554 TAGCTGCCTCCCCACGGGGCAGG - Intergenic
981176569 4:141689995-141690017 TAGCTGCCTTCCTGCAGGGCAGG - Intronic
981275838 4:142897720-142897742 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
981280615 4:142954491-142954513 TAGCCGCCTCCCTGGGGGGCAGG + Intergenic
982033601 4:151325155-151325177 GAGCTGCCGCTGTGTGGGGCAGG + Intronic
982408248 4:155044526-155044548 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
982647681 4:158044350-158044372 TAGCTGCCTCCCCGCAGGGCAGG + Intergenic
982692786 4:158567121-158567143 TAGCTGCCTCCCCGCTTGGCAGG + Intronic
982728214 4:158927925-158927947 TAGCTGCCTTCCTGTGGGGCAGG + Intronic
982768957 4:159378321-159378343 CAGCCGCCTCTCCGCAGGGCAGG + Intergenic
982814560 4:159869170-159869192 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
982863401 4:160481983-160482005 TAGCTGCTTCCCCACGGGGCAGG + Intergenic
982985785 4:162203811-162203833 CAGCTGCCCCGCCGCGGGGCAGG + Intergenic
983026121 4:162739764-162739786 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
983060357 4:163153069-163153091 TAGCTGCCTTCCTGCGGGGCAGG + Intronic
983064069 4:163189852-163189874 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
983369746 4:166842962-166842984 CAGCTGCCTCCCCGCGGGGCAGG - Intronic
983425725 4:167581782-167581804 CAGCTGCCTCCTTGCAGGGCAGG + Intergenic
983553034 4:169035972-169035994 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
983656759 4:170091452-170091474 CAGCTGCCTCCCAGCGGGGTGGG + Intronic
983734734 4:171043382-171043404 CAGCTGCCTCCCTGCGGGGATGG + Intergenic
983835376 4:172377673-172377695 CAGCTGCCTCCCTGTGGGGCAGG - Intronic
984192813 4:176625302-176625324 TAGCTGCCTTTCTGCGGGGCAGG - Intergenic
984238797 4:177193333-177193355 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
984241822 4:177227708-177227730 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
984275725 4:177607252-177607274 TAGCTGCCTCCCCGGAGGGCAGG - Intergenic
984662270 4:182386774-182386796 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
984728676 4:183045292-183045314 CAGCTGCCTCCCTGCAGGGCAGG + Intergenic
984776091 4:183482829-183482851 TAGCTGCCTTCCTGCGGGGCAGG - Intergenic
984833842 4:184000623-184000645 TAGGTGTGTCCCTGCGGGGCTGG - Intronic
984901761 4:184592089-184592111 TAGCTGCCTTCCCGCCGGGCAGG + Intergenic
984918125 4:184741430-184741452 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
985087122 4:186324807-186324829 TAGCTGCCTTCCCGCCGGGCAGG + Intergenic
985195091 4:187420759-187420781 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
985203272 4:187505854-187505876 TAGCTGCCTTCCCGCCGGGCAGG + Intergenic
985269325 4:188179185-188179207 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
985366424 4:189236531-189236553 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
985403582 4:189615353-189615375 CAGCTGCCTCCCTGCAGGGTAGG - Intergenic
985403848 4:189616783-189616805 TAGCTGCCTTCCCGCCGGGCAGG - Intergenic
985409147 4:189664874-189664896 CAGCTGCCTCCCTGTGGGGCAGG - Intergenic
985541449 5:489358-489380 CTGCTGCCTCTCTGCTGGGCTGG + Intronic
985590905 5:764584-764606 CAGCTGCCTCCCTGCGGGGCAGG + Intronic
985593636 5:777959-777981 CAGCCGCCTCCCTGCTGGGCAGG - Intergenic
986121155 5:4837761-4837783 TAGCTGCCTCCCCGCAGGTCAGG + Intergenic
986152025 5:5138009-5138031 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
986626187 5:9725541-9725563 TAGCTGCCTCCCCACGGGGCAGG + Intergenic
986661767 5:10065713-10065735 TAGCTGCCTCCCCTCCGGGCAGG + Intergenic
986698017 5:10375380-10375402 TAGCTGCCTTCCCGCTGGGCAGG + Intronic
986912363 5:12574081-12574103 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
986912526 5:12574654-12574676 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
986963612 5:13244412-13244434 CAGCTACCTCCCTGTGGGGCAGG + Intergenic
986993292 5:13578690-13578712 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
987146225 5:14993942-14993964 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
987283752 5:16436405-16436427 TAGCTGCCTCCCCTCAGGGCAGG + Intergenic
987347420 5:16991118-16991140 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
987352269 5:17032572-17032594 TAGCTACCTTCCCGCGGGGCAGG - Intergenic
987355858 5:17062408-17062430 TAGCTGCCTCCCCGCAAGGCAGG + Intergenic
987358246 5:17083674-17083696 TAGCTGCCTTCCCGCGGGGAAGG + Intronic
987383987 5:17311909-17311931 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
987476673 5:18399809-18399831 TAGCTGCCTTCCCGCCGGGCAGG - Intergenic
987532762 5:19142907-19142929 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
987876971 5:23691348-23691370 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
988073525 5:26324684-26324706 TAGCTGCCTTCCCGGGGGGCAGG + Intergenic
988086964 5:26485416-26485438 TAGCTGCCTTCCCGGGGGGCAGG - Intergenic
988132180 5:27120122-27120144 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
988177291 5:27743685-27743707 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
988279532 5:29127759-29127781 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
988291743 5:29296625-29296647 TAGCTGCCTCCCTGAGGGGCAGG - Intergenic
988369262 5:30345951-30345973 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
988500152 5:31777326-31777348 CAGCCGCCTCCCTGCGGTGCAGG + Intronic
988684713 5:33515523-33515545 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
988915875 5:35893004-35893026 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
989003221 5:36782804-36782826 TAGCTGTCTTCCCGCGGGGCAGG + Intergenic
989346815 5:40438883-40438905 TAGCCGCCTTCCCGCGGGGCAGG + Intergenic
989956869 5:50369662-50369684 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
989957947 5:50377054-50377076 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
990243263 5:53837151-53837173 TAGCTGCCTCCCTGCAGGGCAGG + Intergenic
990323157 5:54649158-54649180 TAGCTGCCTCCCAGCAGGGCAGG - Intergenic
990345287 5:54865300-54865322 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
990461544 5:56035713-56035735 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
990869488 5:60415635-60415657 TAGTTGCCTCCCCACGGGGCAGG + Intronic
990880233 5:60530500-60530522 TAGCTGCCTCCCCGCAGGGCAGG + Intergenic
991214968 5:64150303-64150325 TAGCTGCCTCCCTACGGGGCAGG + Intergenic
991330218 5:65485611-65485633 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
991427103 5:66503460-66503482 TAGCTGCCTCCCTGCGGGGCAGG + Intergenic
991505443 5:67319085-67319107 CAGCTGCCTCACTGTGGGACAGG + Intergenic
991567543 5:68020539-68020561 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
991657816 5:68921091-68921113 CAGCTGCCTCCCTGTGGGGCAGG + Intergenic
992296758 5:75333909-75333931 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
992639126 5:78753213-78753235 TAGGTGCCTCCCAGCAGGGCAGG + Intronic
992947468 5:81823946-81823968 TAGCTGCCTTCCTGCTGGGCAGG + Intergenic
993031893 5:82714913-82714935 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
993320912 5:86466818-86466840 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
993328554 5:86569660-86569682 TAGCTGCCTCCCCGCGGGGCGGG - Intergenic
993529171 5:89003758-89003780 TAGCCGCCTCCCCGCGGGGCAGG - Intergenic
993678587 5:90847654-90847676 TAGCTGCCTCCCTGCGGGGCAGG - Intronic
993770311 5:91917500-91917522 TAGCTGCCTCCCCGTGGGGCAGG + Intergenic
993803528 5:92375037-92375059 TAGCTGCCTCCCCGCAGGGCAGG - Intergenic
993822059 5:92631555-92631577 TAGCTGCCTTCCGGCGGGGCAGG + Intergenic
994167031 5:96618735-96618757 CAGCTGCCTCCCTGCAGGGCAGG + Intronic
994239889 5:97407385-97407407 CAGCTGCCTCCCTGCGGGGCAGG + Intergenic
994254774 5:97580131-97580153 TAGCTGCCTTCCCGAGGGGCAGG - Intergenic
994507135 5:100656986-100657008 TAGCTGCCTTCCCGAGGGGCAGG + Intergenic
994509820 5:100689005-100689027 TAGCTGCCTTCCTGCGGGGCAGG - Intergenic
994605580 5:101962582-101962604 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
994620365 5:102155162-102155184 TAGCTGCCTCCCCGCGAGGCAGG + Intergenic
994669774 5:102752289-102752311 TAGCTACCTCCCTGCGGGGCAGG + Intergenic
994701678 5:103142171-103142193 TAGCTGCCTTCCCGCAGGGCAGG - Intronic
994768620 5:103953951-103953973 TAGCCGCCTCCCGGCAGGGCAGG - Intergenic
994841415 5:104929227-104929249 TAGCTGCCTCCCCGCAGGGCAGG + Intergenic
994932429 5:106206236-106206258 TAGCTGCCTCCCCGCCAGGCAGG - Intergenic
994935299 5:106246434-106246456 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
995032342 5:107494467-107494489 TAGCTGCCTTCCCGTGGGGCTGG + Intronic
995112364 5:108442219-108442241 TAGCTGCCTCCCTGCAGGGCAGG - Intergenic
995206637 5:109487982-109488004 CAGCTGCCTCCCTGCAGAGCAGG - Intergenic
995326398 5:110894163-110894185 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
995388323 5:111612302-111612324 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
995529151 5:113075259-113075281 CAGCTGCCTCCCCGCGGAGCAGG + Intronic
995568698 5:113457368-113457390 TAGCTGCCTTCCCGCGGAGCAGG + Intronic
995596436 5:113753255-113753277 TAGCTGCCTTCCTGCGGGGCAGG - Intergenic
995679847 5:114704425-114704447 TAGCTGCCTTCCCGCTGGGCAGG - Intergenic
995920424 5:117304886-117304908 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
995988412 5:118208085-118208107 CCGCTGCCTCTCCGTGGGGCAGG - Intergenic
996107065 5:119517328-119517350 TAGCTGCCTTCCCGCAGGGCAGG + Intronic
996234243 5:121107401-121107423 TAGCTGCCTTCCTGCAGGGCAGG + Intergenic
996435714 5:123430773-123430795 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
996478677 5:123949324-123949346 TAGCTGCCTCCCGGTGGGGCAGG - Intergenic
996530413 5:124521846-124521868 TAGCTGCCTGCCCGCCGGGCAGG + Intergenic
996586006 5:125088883-125088905 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
996815586 5:127569636-127569658 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
997375526 5:133394576-133394598 CAGCTGCCTCCCCGCAGGGCAGG + Intronic
999348560 5:150845643-150845665 TAGCTGCCTCCCCGCAGGGCAGG + Intergenic
999406205 5:151309416-151309438 TAGCTGCCTTCCCGCGGCGCAGG + Intergenic
999809590 5:155115026-155115048 CAGCTGCCTCCCTGCGGGCAGGG + Intergenic
1000001467 5:157142736-157142758 CAGCTTCCTCTGTGCTGGGCTGG - Intronic
1000066055 5:157694062-157694084 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
1000084766 5:157879505-157879527 CAGCTGCCTCCCTGCGGGGCAGG + Intergenic
1000432348 5:161166287-161166309 TAGCTGCCTCCCAGCAGGGCAGG - Intergenic
1000547632 5:162622067-162622089 TAGCTGCCTCCCCGTGGGGCAGG + Intergenic
1000608275 5:163347875-163347897 CAGCTGCCTATCAGCAGGGCTGG - Intergenic
1000609158 5:163356038-163356060 TAGCTGCCTCTCCGCGGGGCAGG + Intergenic
1000889308 5:166784678-166784700 TAGCTTCCTCCCCTCGGGGCAGG - Intergenic
1000891796 5:166810332-166810354 TAGCTGCCTCCCCACGGGGCAGG - Intergenic
1000903536 5:166936395-166936417 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1000987972 5:167881700-167881722 CAGCTGCCTCTCTTCTGGACAGG + Intronic
1001636464 5:173213655-173213677 TAGCTGCCTCCCCGAGGGGCAGG + Intergenic
1002004612 5:176222161-176222183 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1002221767 5:177688459-177688481 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1002616471 5:180459393-180459415 CAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1002758042 6:179817-179839 TAGCTGCCTCCCCACGGGGCAGG + Intergenic
1002789355 6:426337-426359 TAGCTGCCTTCCCGCGGGACAGG - Intergenic
1002790722 6:435718-435740 TAGCAGCCTCTCCGCAGGGTAGG - Intergenic
1002816291 6:684055-684077 TAGCAGCCTCTCGGCTGAGCGGG + Intronic
1002817720 6:694806-694828 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1002907004 6:1457107-1457129 TAGCTGCCTCCCCGCGGGACAGG - Intergenic
1003060746 6:2860364-2860386 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1003070246 6:2939854-2939876 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1003081935 6:3027925-3027947 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1003100214 6:3170990-3171012 TAGCTACCTCCCCGCGGGGCAGG + Intergenic
1003176879 6:3758343-3758365 TAGCTGTCTCCCCGCGAGGCAGG + Intergenic
1003177294 6:3761579-3761601 TAGCTGCCTCCCTGCGGAGCAGG + Intergenic
1003178494 6:3771817-3771839 TAGCGCCCTCCCCGCGGGGCAGG + Intergenic
1003213761 6:4090322-4090344 TAGCTGCCTCCCTGCAGGGCAGG + Intronic
1003489215 6:6606609-6606631 TAGCTTCCTCCCCGCGTGGCAGG - Intronic
1003490019 6:6613428-6613450 TGGCTGCCTCCCGGCGCGGCAGG - Intronic
1003508817 6:6762617-6762639 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1003531397 6:6940316-6940338 TAGCTGCCTCCCTGCAGGGCAGG + Intergenic
1003578051 6:7315399-7315421 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
1003581465 6:7344440-7344462 TAGCTGCCTTCCCGCAGGGCAGG + Intronic
1003593727 6:7456541-7456563 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1003717643 6:8665915-8665937 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1003717724 6:8666193-8666215 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
1003736918 6:8887390-8887412 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1003770132 6:9290576-9290598 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1003802060 6:9681105-9681127 TGGCTGCCTGTGTGCCGGGCGGG - Intronic
1003824933 6:9942399-9942421 TAGCTGCCTTCCTGCCGGCCAGG + Intronic
1003836198 6:10074846-10074868 TAACTGCCTCCCCGCGGGGCAGG - Intronic
1003862814 6:10337635-10337657 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1003882045 6:10487915-10487937 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1003897002 6:10617197-10617219 TAGCTGCCTCCCAGCGGGGCAGG - Intronic
1003901619 6:10660110-10660132 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1003908153 6:10720813-10720835 TAGCTGCCTTCCGACGGGGCAGG + Intergenic
1003947298 6:11087441-11087463 TAGCTGCCTTCCCGCGGAGCGGG + Intergenic
1003956702 6:11171289-11171311 TAGCTGCCTCCCTGCGGGGCAGG + Intergenic
1004036990 6:11933305-11933327 TAGCTGCCTCCCCACGGGGCGGG + Intergenic
1004045343 6:12018057-12018079 TAGCTGCTTCCCCGTGGGGCAGG - Intronic
1004053130 6:12108526-12108548 TAGCTGCCTTCCTGCGGGGCAGG - Intronic
1004196561 6:13511171-13511193 TAGCTGCCTCCCCACAGGGCAGG - Intergenic
1004200288 6:13541765-13541787 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1004217605 6:13716975-13716997 CAGCTGCCTCTCCGCGGGGCAGG + Intergenic
1004224416 6:13772713-13772735 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1004234289 6:13860362-13860384 TAGTTGCCTCCCCGCAGGGCAGG + Intergenic
1004235522 6:13872058-13872080 TAGCTGCCTTCCGGCAGGGCAGG - Intergenic
1004338206 6:14783744-14783766 TAGCTGCCTCCCCGTGGGGCAGG - Intergenic
1004354097 6:14916207-14916229 CAGCTGCCTCCCCACGGGGCAGG + Intergenic
1004452366 6:15758894-15758916 TAGCTGCCTCCCTACAGGGCAGG - Intergenic
1004486250 6:16069337-16069359 TAGCTGCCCTCCGGCGGGGCAGG - Intergenic
1004499656 6:16198237-16198259 TAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1004501915 6:16217048-16217070 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1004511666 6:16288478-16288500 TAGCTGCCTCCCTGCGGGGCAGG + Intronic
1004689067 6:17976324-17976346 TAGCTGCCTTACAGCGGGGCAGG - Intronic
1004693301 6:18011369-18011391 TAGCTACCTCCCCGCGGGGTAGG - Intergenic
1004694308 6:18019813-18019835 CAACCGCCTCCCTGCGGGGCAGG - Intergenic
1004861368 6:19807147-19807169 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1004866030 6:19854563-19854585 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1004883717 6:20032551-20032573 TAGCTGCCTCCCCGCCGGGCAGG + Intergenic
1004905440 6:20233396-20233418 TAGCTGCCTCCCCGCAGGGCAGG + Intergenic
1004906226 6:20239244-20239266 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1004906913 6:20244907-20244929 TAGCTGCCTTCCTGCGGCGCAGG - Intergenic
1004914458 6:20319099-20319121 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1005035547 6:21552420-21552442 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1005042253 6:21610040-21610062 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1005059308 6:21761382-21761404 TAGCTGCCTCCCCGTGGGGCAGG + Intergenic
1005171735 6:22993713-22993735 TAGCTGGGTCTCTGCGAGGGTGG + Intergenic
1005332857 6:24766072-24766094 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1005561453 6:27045466-27045488 TAGCTGCCTTCCTGTGGGGCAGG + Intergenic
1005596191 6:27381204-27381226 TAGCTGCCTTCCCGCGGCGCAGG - Intronic
1005600848 6:27424964-27424986 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1005707424 6:28469489-28469511 TAGCTGCCTTCCCGCGGGACAGG - Intergenic
1005712025 6:28512011-28512033 TAGCTGCCACCCCGCGGGGCAGG + Intronic
1005758871 6:28949929-28949951 TAGTTGCCTTCCCGCGGGGCAGG - Intergenic
1005759827 6:28958068-28958090 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1005976984 6:30807578-30807600 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1006005793 6:31000689-31000711 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1006033657 6:31195685-31195707 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1006227046 6:32548060-32548082 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1006348492 6:33502915-33502937 CAGCTGCCTCCCTGAGGGGCAGG + Intergenic
1006352665 6:33532614-33532636 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1006477854 6:34269250-34269272 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
1006696032 6:35931494-35931516 TAGCTGTCTTCCTGCGGGGCAGG + Intergenic
1006748876 6:36364368-36364390 TAGCTGCCTTCCTGCGGGGCAGG - Intronic
1006978349 6:38124473-38124495 TAGCTGCCTCCCGGCAGGGCAGG - Intronic
1007738749 6:43998280-43998302 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1008005569 6:46405903-46405925 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1008230806 6:48983571-48983593 TAGCTGCCTCCTAGCGGGGCAGG - Intergenic
1008230910 6:48984125-48984147 TAGCTGCCTCCCCACGGGGCAGG + Intergenic
1008254090 6:49275666-49275688 TAGCTGCCTCCCCACAGGGCAGG + Intergenic
1008270162 6:49481960-49481982 TAGCTGCCTCCCTGTGGGGCAGG - Intronic
1008270471 6:49483555-49483577 TAGCTGCCTCCCTGTGGGGCAGG - Intronic
1008284322 6:49629685-49629707 TAGCTGCCTTCCCGTGGGGCAGG - Intronic
1008567841 6:52786696-52786718 TAGCTGCCTCCCCGCCAGGCAGG + Intergenic
1008771019 6:54979460-54979482 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1008844857 6:55950534-55950556 CAGCCGCCTCCCTGCGGGGCAGG + Intergenic
1009402679 6:63275119-63275141 TAGCTGCCTTGCCTCGGGGCAGG - Intergenic
1009470294 6:64023958-64023980 TGGCTGCCTTCCCGCGGGGCAGG + Intronic
1009510788 6:64547860-64547882 TAGCTGCCTCCTTGCAGGGCAGG - Intronic
1009587670 6:65627766-65627788 TAGCTGCCTTCCCGCGGGGTAGG + Intronic
1009615480 6:65999518-65999540 CAGCTGCCTCCCCGTGGGGCAGG - Intergenic
1009685361 6:66949439-66949461 TAGCTGCCTTCCCGCCGGGCAGG + Intergenic
1009746701 6:67825624-67825646 CAGCTGCCTCCCCACGGGGCAGG + Intergenic
1009800730 6:68533613-68533635 TAGCTGCCTCCCCGCAGGGCAGG + Intergenic
1009872287 6:69467426-69467448 TAGCTGCCTCCCTGCGGGGCAGG + Intergenic
1010235625 6:73572672-73572694 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1010270388 6:73910212-73910234 CAGCTGCCTCCCTGAGAGGCAGG + Intergenic
1010277936 6:73990806-73990828 TAGCTGTCTCCCTGCAGGGCAGG - Intergenic
1010617408 6:78030027-78030049 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1010836436 6:80593098-80593120 CAGATGCATCTCTTCGGGGCAGG - Intergenic
1011178135 6:84587612-84587634 TAGTTGCCTTCCTGCAGGGCAGG + Intergenic
1011246545 6:85326193-85326215 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1011879915 6:92011881-92011903 CAGCTGCCTCCCTGCATGGCAGG - Intergenic
1011974776 6:93282824-93282846 TAGCTGCCTCCCTGCAGGGCAGG + Intronic
1012131312 6:95497167-95497189 TAGCTGTCTCCTTGAGGGGCAGG + Intergenic
1012145041 6:95670265-95670287 CAGCTGCCTCCCTGTGGGGCTGG + Intergenic
1012578209 6:100829368-100829390 TAGCTGCCTTCCCACGGGGCAGG - Intronic
1012598880 6:101070487-101070509 CAGCTGCCTCCCTGCAGGGCAGG + Intergenic
1012733526 6:102910822-102910844 TAGCTGCCTCCCTGCGGCGCAGG - Intergenic
1012760478 6:103294540-103294562 TAGCTGTCTTCCCGCGGGGCAGG - Intergenic
1013025696 6:106269542-106269564 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1013080250 6:106805980-106806002 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1013081462 6:106816898-106816920 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1013143544 6:107364381-107364403 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1013624190 6:111920519-111920541 TAGCTTCCCCTCTGCGAGGTGGG - Intergenic
1013694789 6:112689502-112689524 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1013955322 6:115834736-115834758 TAGCTGCCTTCCCGCGGAGCAGG - Intergenic
1013957263 6:115855419-115855441 TAGCTGCCTCTCCGCAGGGCTGG + Intergenic
1013960102 6:115889282-115889304 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1013963431 6:115928218-115928240 TAGCTGCCTCCCTGCGGGACAGG - Intergenic
1014240766 6:119015548-119015570 TAGCTGCCTTCCCACGGGGCAGG + Intronic
1014280827 6:119441223-119441245 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1014507783 6:122280805-122280827 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1014718583 6:124892197-124892219 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1014739022 6:125126081-125126103 TAGCTGCCTCCCCGCGGGGCAGG + Intronic
1014921050 6:127214726-127214748 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1015572229 6:134633680-134633702 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
1015600370 6:134904955-134904977 TAGCTGCCTTCCCGCGGGGCGGG + Intergenic
1016069868 6:139726484-139726506 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1016092809 6:139999720-139999742 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1016217222 6:141618436-141618458 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1016482296 6:144495286-144495308 TAGCTGCCTTCCTGCGGGGCAGG - Intronic
1016859043 6:148698759-148698781 TAGCTGCCTCCCCCAGGGGCAGG - Intergenic
1017325110 6:153133846-153133868 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1017537395 6:155363293-155363315 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1017581195 6:155866891-155866913 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1017839486 6:158209924-158209946 TAGCTGCCTTCCCGCGAGGCAGG - Intergenic
1017976254 6:159360027-159360049 ATGCTGGCTCTCTGCGGGCCAGG - Intergenic
1018551321 6:165001763-165001785 CAGCTGCCTCCCTGACGGGCAGG - Intergenic
1018624622 6:165765422-165765444 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1018865576 6:167744811-167744833 TATGTGCCTCTTTCCGGGGCAGG + Intergenic
1018976316 6:168570125-168570147 CAGCTGCCTCTGTGGGGGTCGGG + Intronic
1019086246 6:169480260-169480282 CAGCCGCCTCCCCGCGGGGCAGG + Intronic
1019944243 7:4314074-4314096 TAGCTGCCTTCCTGCGGGGCAGG - Intergenic
1019965730 7:4497066-4497088 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1020008292 7:4793708-4793730 TAGCTGCCTTCCTGCGGGGCAGG + Intronic
1020375329 7:7478681-7478703 TAGCTGCCTCTCCGCGGGGCAGG - Intronic
1020552260 7:9621618-9621640 TAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1020662178 7:10995688-10995710 CAGCTGCCTCCCTGCGGGGCAGG - Intronic
1020784413 7:12556295-12556317 CAGCTTCCTCCCCGCGGGGCAGG - Intergenic
1021065739 7:16170717-16170739 CAGCTGCCTCCCTGCAGGGCAGG - Intronic
1021133893 7:16943213-16943235 CAGCTGCTTCCCTGCAGGGCAGG + Intergenic
1021324147 7:19245708-19245730 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1021513791 7:21461373-21461395 TAGCTGCCTCCCCGCGAGGCAGG - Intronic
1021520695 7:21536727-21536749 TAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1021567874 7:22032503-22032525 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1021573917 7:22090640-22090662 CAGCTGCCTCCCTGCGGGGCAGG + Intergenic
1021686745 7:23193870-23193892 TAGCTGCCTCCCTGCGGGGCAGG - Intronic
1021761254 7:23904847-23904869 TAGCTGCCTCCCCGAGGGGCAGG - Intergenic
1021964851 7:25907300-25907322 CAGCTGCCTCTTGGCAGGGCAGG - Intergenic
1022750456 7:33219198-33219220 TAGCTGCCTTCCCGTGGGGCAGG + Intronic
1023127958 7:36973962-36973984 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
1023232522 7:38049973-38049995 CAGCTGCCTCCCTGCCGGGCAGG + Intergenic
1023570407 7:41565770-41565792 CAGCTGCGTCTGTGTGGGGCAGG + Intergenic
1024269100 7:47628701-47628723 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1024335614 7:48203049-48203071 TAGCTGCCTTCCCGTGGGGCAGG - Intronic
1024443863 7:49453872-49453894 TAGCTGCCTTCCCGAGGGGCAGG + Intergenic
1024465923 7:49711477-49711499 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1024691301 7:51806051-51806073 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1024700616 7:51901031-51901053 TAGCTGCCTTCCCGCTGGGCAGG - Intergenic
1024735818 7:52303094-52303116 TAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1024741790 7:52362831-52362853 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
1024794364 7:53004156-53004178 TAGCTGCCTCCCCACAGGGCAGG + Intergenic
1024825404 7:53385297-53385319 TAGCTGCCTTCCTGCGGGGCAGG - Intergenic
1024834069 7:53495245-53495267 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1025962055 7:66231497-66231519 TAGCTGCCTTCCCACGGGGCAGG - Intronic
1026187068 7:68090550-68090572 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1026202973 7:68231257-68231279 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1026236973 7:68535235-68535257 TAGCTGGCTCCCCGCAGGGCAGG - Intergenic
1026335917 7:69394051-69394073 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
1026406467 7:70071261-70071283 TAGCTGCTTCTCTGTAGGGCTGG + Intronic
1026596536 7:71738215-71738237 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1027238001 7:76309616-76309638 TAGCTGCCTCTCAGCAGAGCAGG - Intergenic
1027561693 7:79739525-79739547 TAGCTGCTTTCCCGCGGGGCAGG + Intergenic
1027579689 7:79977739-79977761 TAGCTGCCTTCCTGTGGGGCAGG - Intergenic
1027665913 7:81042932-81042954 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
1027667511 7:81057619-81057641 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1027674493 7:81141962-81141984 TAGCTGCCTCCCCGAGGGGCAGG + Intergenic
1027698260 7:81437226-81437248 TAGGTGCCTTCCGGCGGGGCAGG - Intergenic
1027778968 7:82499793-82499815 TAGCTGCCTCCCCGCAGGGCAGG + Intergenic
1027868120 7:83673542-83673564 TAGCTGCCTTCCCTCGGGGCAGG + Intergenic
1027956059 7:84880755-84880777 TAGCTGCCTCCCGGCGGGGCAGG + Intergenic
1028058719 7:86282299-86282321 CAGCTGCCTGCCCGCGGGGCAGG - Intergenic
1028070118 7:86440791-86440813 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
1028303280 7:89228907-89228929 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1028392693 7:90334645-90334667 TAGCCGCCTCCCCACGGGGCAGG + Intergenic
1028511198 7:91627529-91627551 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1028558024 7:92143506-92143528 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1028719398 7:94012004-94012026 CAGCTGCCTCCCTGTGGGGCAGG - Intergenic
1028778341 7:94705717-94705739 TAGCTGCCTTCCTGCCGGTCAGG + Intergenic
1028852493 7:95552599-95552621 TAGCTGCCTCCCGGCGGGGCAGG - Intergenic
1028913009 7:96228931-96228953 CAGCTGACTCCCGGCGGGGCAGG + Intronic
1028989520 7:97034563-97034585 TAGCTGCCTCCCCACAGGGCAGG + Intergenic
1029065325 7:97843002-97843024 CAGCCACCTCCCTGCGGGGCAGG - Intergenic
1029075039 7:97928346-97928368 AAGCGGCCTCTCGGCGGAGCTGG + Intergenic
1029076161 7:97936109-97936131 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1029407110 7:100381943-100381965 TAGCTGCCTCCCGGCAGGGCAGG + Intronic
1029567530 7:101348799-101348821 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1029809614 7:103034382-103034404 TAGCTGCCTTCCCGTGGGGCAGG - Intronic
1029988181 7:104940377-104940399 TAGCTGCCTCCCCACGGGGCTGG + Intergenic
1030102113 7:105955945-105955967 TAGCTGCCTCCCTGCGGGGCAGG - Intronic
1030215712 7:107042498-107042520 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1030367002 7:108657395-108657417 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1030599958 7:111582079-111582101 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1030733502 7:113017567-113017589 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
1030780436 7:113593543-113593565 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1030980680 7:116182127-116182149 TAGCTGCCTCTCTGCAGGGCAGG - Intergenic
1031109982 7:117596326-117596348 TAGCTGCCTCCCTGCGGGGCAGG + Intronic
1031253117 7:119413489-119413511 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1031292240 7:119951647-119951669 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1031387265 7:121167040-121167062 TACCTTCCTCCCTGAGGGGCTGG - Intronic
1031409229 7:121421953-121421975 TAGCTGCCTCCCCATGGGGCAGG + Intergenic
1031902889 7:127429395-127429417 CAGCTGCCTCCCCGTGGGGCCGG + Intronic
1032248093 7:130230246-130230268 TAGCTGCCTCCCGGCGGGGCAGG + Intergenic
1032266362 7:130372809-130372831 CAGCAGCTTCTCTGAGGGGCAGG + Intergenic
1032339669 7:131058987-131059009 CAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1032914218 7:136469599-136469621 TAGCTGCATCTCAGAGGGTCTGG + Intergenic
1033065095 7:138146345-138146367 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1033157814 7:138971599-138971621 AAGCTGGCCCTCTGAGGGGCTGG + Intronic
1033312412 7:140271484-140271506 TAGCGGCCTCCCCGCAGGGCAGG - Intergenic
1033394071 7:140957091-140957113 TAGCTGCCTTCCGGCGGGGCAGG - Intergenic
1033571426 7:142632608-142632630 TTGCTGCCTCGCTGCCGGGCGGG + Intergenic
1033664082 7:143424533-143424555 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1033758600 7:144418105-144418127 TAGCTGCCTCCCCGTGGGGCAGG - Intergenic
1033839903 7:145360773-145360795 TAGCTGCCTCCCTGCGGGGCAGG - Intergenic
1033866626 7:145697548-145697570 TAGCTGCCTCCCGGCGGTGCAGG - Intergenic
1034097935 7:148426632-148426654 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
1034155037 7:148949305-148949327 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
1034167736 7:149038835-149038857 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1034632125 7:152539024-152539046 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1034656019 7:152730412-152730434 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1034900862 7:154907133-154907155 TAGCTGCCTCCCCTCGGGGCAGG + Intergenic
1035060632 7:156066757-156066779 TCGCTGCCTCTCTGCATGCCTGG - Intergenic
1035287096 7:157813612-157813634 TTGCTGCCTCTGGGCGGGTCCGG + Intronic
1035463879 7:159063275-159063297 CAGCTGCCTCCCCGCAGGGCAGG - Intronic
1035999261 8:4583051-4583073 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
1036123806 8:6045197-6045219 TAGCTGCCTTCACGCGGGGCAGG - Intergenic
1036135078 8:6152931-6152953 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
1036242485 8:7092032-7092054 GAGCGGCCTCTCGGCGGAGCTGG - Intergenic
1036258308 8:7221979-7222001 GAGCGGCCTCTCGGCGGAGCTGG + Intergenic
1036259369 8:7228123-7228145 GAGCGGCCTCTCGGCGGAGCTGG + Intergenic
1036260483 8:7235877-7235899 TAGCTGCCTCCCTGCGGGGCAGG + Intergenic
1036306131 8:7603645-7603667 TAGCTGCCTCCCTGCGGGGCAGG - Intergenic
1036311411 8:7686693-7686715 GAGCGGCCTCTCGGCGGAGCTGG + Intergenic
1036312520 8:7694433-7694455 TAGCTGCCTCCCTGCGGGGCAGG + Intergenic
1036356977 8:8051630-8051652 TAGCTGCCTCCCTGCGGGGCAGG - Intergenic
1036359177 8:8065528-8065550 GAGCGGCCTCTCGGCGGAGCTGG - Intergenic
1036378274 8:8219074-8219096 TAGCTGCTTCCCTGCAGGGCAGG + Intergenic
1036441010 8:8781528-8781550 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1036554642 8:9847935-9847957 TAGCTGCCTTCCTGCAGGGCAGG - Intergenic
1036801380 8:11794983-11795005 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1036830250 8:12015098-12015120 GAGCGGCCTCTCGGCGGAGCTGG + Intronic
1036831370 8:12022829-12022851 TAGCTGCCTCCCTGCGGGGCAGG + Intergenic
1036851297 8:12203543-12203565 TAGCTGCTTCCCTGCAGGGCAGG - Intergenic
1036872661 8:12445817-12445839 TAGCTGCTTCCCTGCAGGGCAGG - Intergenic
1036891781 8:12601424-12601446 GAGCGGCCTCTCGGCGGAGCTGG + Intergenic
1036901594 8:12673632-12673654 TAGCTGCCTCCCCATGGGGCAGG + Intergenic
1036914994 8:12796487-12796509 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1036928625 8:12931441-12931463 CAGCCGCCTCCCTGCGGGGCAGG - Intergenic
1037065046 8:14567063-14567085 TAGCTGCCTCCCAGTGGGGCAGG + Intronic
1037239488 8:16760675-16760697 CAGCTGCCTCCCCGTGGGGCAGG - Intergenic
1037241572 8:16784130-16784152 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1037263823 8:17036954-17036976 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1037305217 8:17497254-17497276 CCGCGGCCTCTCGGCGGGGCTGG - Intronic
1037417554 8:18667820-18667842 CAGCTGCCTCCCTGCGGGGCAGG - Intronic
1037558959 8:20054951-20054973 TAGCTGCCTCCCTGTGGGGCAGG + Intergenic
1037725482 8:21479486-21479508 TAGCTGCCTGTTTGGGGAGCTGG - Intergenic
1037971321 8:23173937-23173959 TAGCTGCCTTCCTGCGGCGCAGG - Intergenic
1037983545 8:23272340-23272362 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
1038638299 8:29304477-29304499 TAGCTGCCTTCCTGCCTGGCAGG + Intergenic
1038639425 8:29311689-29311711 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
1038870721 8:31490090-31490112 TAGCTGCCTTCCTGTGGGGCAGG + Intergenic
1039068754 8:33631901-33631923 TAGCTGCCTCCCTGTGGGGCAGG + Intergenic
1039069089 8:33633969-33633991 TAGCTGCCTTCCTGCAGGGCGGG - Intergenic
1039284882 8:36029050-36029072 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
1039587626 8:38720021-38720043 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1040014462 8:42689674-42689696 TAGCTGCCTTCCCGCTGGGCAGG + Intergenic
1040303503 8:46200303-46200325 TCGCTGCTTCTCTCCTGGGCCGG - Intergenic
1040583390 8:48716114-48716136 CAGCTGCCTCCCCACGGGGCAGG - Intronic
1040622214 8:49103147-49103169 TAGCTGCCTCCCCGTGGGGCAGG - Intergenic
1040791027 8:51230828-51230850 TAGCTACCTCCCTGCAGGGCAGG + Intergenic
1040794194 8:51271463-51271485 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
1040804360 8:51377740-51377762 CAGCTGCCTCCCTGCGGGGCAGG + Intronic
1040806818 8:51404962-51404984 CAGCTGCCTCCCTGCGGGGCAGG - Intronic
1040952688 8:52952993-52953015 TAGCTGCCTTCCTGCGGGGCAGG - Intergenic
1040954018 8:52961592-52961614 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
1040954901 8:52969984-52970006 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1040965551 8:53077764-53077786 CAGCTGCCTTCCTGAGGGGCAGG - Intergenic
1040981730 8:53251637-53251659 TGGCGGCGGCTCTGCGGGGCGGG + Exonic
1041034636 8:53776035-53776057 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1041068551 8:54104417-54104439 CAGCCGCCTCCCCGCGGGGCAGG + Intergenic
1041604335 8:59762135-59762157 TAGCTGCCTCCCCACAGGGCAGG - Intergenic
1041918950 8:63162213-63162235 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1042336044 8:67630947-67630969 CAGCTGCCTCCCCGAGGGGCAGG + Intronic
1042512549 8:69626620-69626642 TAGCTGCCTTCCCGCAGGGCAGG - Intronic
1042948740 8:74179666-74179688 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1043073326 8:75665601-75665623 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1043102214 8:76060587-76060609 TAGCTGCCTTCCTGCTGGGTAGG - Intergenic
1043110122 8:76169794-76169816 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
1043129915 8:76447750-76447772 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1043346480 8:79303718-79303740 TAGCTGCCTTCCTGTGGGGCAGG + Intergenic
1043352467 8:79377341-79377363 TAGCTGGCTTCCCGCGGGGCAGG - Intergenic
1043435345 8:80232032-80232054 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1043640176 8:82441600-82441622 TAGCTACCTCCCCGCTGGGCAGG + Intergenic
1043670659 8:82880912-82880934 CAGCTGCCTCCCTGCGGGGCAGG + Intergenic
1043701146 8:83290576-83290598 TAGCCGCCTTCCCGCGGGGCAGG + Intergenic
1043731929 8:83694134-83694156 TACCTGCCTCCCGGCGGGGCAGG - Intergenic
1044075841 8:87821058-87821080 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
1044088502 8:87971339-87971361 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1044404902 8:91816544-91816566 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1044459632 8:92429368-92429390 CAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1044633456 8:94300470-94300492 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
1044788703 8:95823862-95823884 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1044853584 8:96452504-96452526 CAGCTGCCTCCCTGTGAGGCAGG + Intergenic
1044862127 8:96533946-96533968 CAGCTGCCTCCCCGCGGGGCAGG - Intronic
1044880647 8:96719223-96719245 TAGCTGCCTTCCTGCGGGGCAGG - Intronic
1045131923 8:99163536-99163558 TAGCTGCCTTCCCACGGGGCAGG - Intronic
1045232307 8:100316911-100316933 TAGCTGCCTTCCCGCGGGGCAGG - Intronic
1045306020 8:100957290-100957312 TAGCTGCCTCCCAGCAGGGCAGG - Intergenic
1045467741 8:102485649-102485671 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1045743324 8:105387466-105387488 TAGCTGCCTCCCGGCGGGGCAGG - Intronic
1046149332 8:110202710-110202732 TAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1046208870 8:111040974-111040996 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1046251903 8:111643050-111643072 CAGCTGCCTCCCTGCGGGGCAGG + Intergenic
1046288926 8:112132915-112132937 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1046445358 8:114311574-114311596 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1046497788 8:115036915-115036937 CAGCTGCCTCCCCGCTGGGCAGG + Intergenic
1046621228 8:116531268-116531290 TAGCTGCCTTCCTGCGGGGCAGG + Intergenic
1046661184 8:116949890-116949912 CAGCTGCCTCCCCGCGGCGCAGG - Intergenic
1047124759 8:121948262-121948284 TAGCTGCCTCCCCACGGGGCAGG + Intergenic
1047220725 8:122916259-122916281 TGGCTGCATCCCTGCTGGGCAGG + Intronic
1047337692 8:123952314-123952336 TGGCTGCCTCCCTGCAGTGCGGG + Intronic
1048112872 8:131487253-131487275 CAGCTGCCTCCCCGCAGGGCAGG + Intergenic
1048186867 8:132249793-132249815 CAGCTGCCTCTTTGCGGGGCAGG - Intronic
1048655401 8:136530590-136530612 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1048676943 8:136793937-136793959 TAGCTGCCTCCCTGCGGGGCAGG - Intergenic
1048757479 8:137755257-137755279 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
1048789196 8:138084359-138084381 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1049087616 8:140490651-140490673 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1049387903 8:142353601-142353623 CTGCTCCCTCTCTGCAGGGCTGG + Intronic
1049756730 8:144314113-144314135 CAGCTGCTTCCCTGCGGGGGTGG - Exonic
1049832237 8:144708846-144708868 TATCTGCCTCTCTCTGGGTCTGG - Intergenic
1049857944 8:144875350-144875372 TAGCTGCCTCCCCATGGGGCAGG + Intergenic
1050249963 9:3733991-3734013 TAGCTGCTTCCCTGCGGGGCAGG + Intergenic
1050892024 9:10836179-10836201 CAGCTGCCTCCCCACGGGGCAGG + Intergenic
1051305067 9:15700178-15700200 TAGCTGCCTTCCCGTGGGGCAGG - Intronic
1051383326 9:16480731-16480753 TAGCTGCCTTCCGGCGGGGCAGG + Intronic
1051439879 9:17072827-17072849 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1051449393 9:17178565-17178587 TAGCTGCCTCCCTGTGGGGCAGG - Intronic
1051459413 9:17294970-17294992 TAGCTGCCTCCCTGTGCGGCAGG - Intronic
1051892715 9:21959474-21959496 TAGCTGCCTTCCCGCGGGGCAGG + Intronic
1051929036 9:22363609-22363631 CAGCCGCCTCCCCGCGGGGCAGG - Intergenic
1052014870 9:23452257-23452279 CAGCTGCCTCCCCGTGGGGCAGG + Intergenic
1052056659 9:23914594-23914616 TAGCTGTCTCCCCACGGGGCAGG - Intergenic
1052883813 9:33624057-33624079 CTGCTGCCTCGCTGCGGGGCGGG + Intergenic
1052979565 9:34438148-34438170 TAGCTGCCTTCCTGCGGGGCAGG + Intronic
1052985328 9:34482901-34482923 TAGCTGCCTTCCCACGGGGCAGG - Intronic
1053027265 9:34740373-34740395 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
1053393432 9:37752101-37752123 TAGCTGCCTACCTGCGGGGCAGG + Intronic
1053436103 9:38075547-38075569 TAGCTGCCTCCCCGCAGGGCAGG + Intergenic
1053475256 9:38377753-38377775 TAGCTGCCTCCCCTCGGGGCAGG + Intergenic
1053478026 9:38396035-38396057 TGGATGCCTCTGAGCGGGGCCGG + Exonic
1053547895 9:39042494-39042516 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1053678305 9:40461230-40461252 CAGCCGCCTCGCTGTGGGGCAGG + Intergenic
1053928289 9:43089573-43089595 CAGCCGCCTCGCTGTGGGGCAGG + Intergenic
1054285422 9:63163718-63163740 CAGCCGCCTCGCTGTGGGGCAGG - Intergenic
1054291382 9:63296767-63296789 CAGCCGCCTCGCTGTGGGGCAGG + Intergenic
1054506315 9:65915065-65915087 CAGCCGCCTCGCTGTGGGGCAGG - Intergenic
1054722471 9:68617247-68617269 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1055102555 9:72480381-72480403 TAGCTGCCTCCCCGAGGGGCAGG - Intergenic
1055248573 9:74276080-74276102 TAGCTGCCTCCCGACGGGGCAGG - Intergenic
1055461445 9:76523871-76523893 TAGCTGCCTTCCTGCGGGGCAGG - Intergenic
1055557560 9:77490520-77490542 TAGCTGCCTTCCCGCGAGGCAGG - Intronic
1055651393 9:78410220-78410242 TAGCTGCCTCCCCGTGGGGCAGG + Intergenic
1055654952 9:78442297-78442319 CAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1056080942 9:83093434-83093456 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1056216295 9:84408701-84408723 TAGCTGCCTCCCCGCGGGGCCGG + Intergenic
1056305785 9:85289269-85289291 TAGCTGCCTCCCCACGGGGCAGG + Intergenic
1056677228 9:88686052-88686074 CAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1056735947 9:89209582-89209604 TAGCTGCCTCCCCGCAGGGCAGG + Intergenic
1056743767 9:89282648-89282670 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1056914046 9:90729695-90729717 TAGCTGCCTCCCGGCGGGGCAGG + Intergenic
1057118183 9:92545472-92545494 TAGCTGCCTCCCCGCGGGGCAGG + Intronic
1057300715 9:93880120-93880142 TAGCTGCCTCCCTGCGGGGCAGG + Intergenic
1057383902 9:94591281-94591303 TAGGTGCCTTCCCGCGGGGCAGG - Intronic
1057510043 9:95670325-95670347 GGGCTGCCTCGCTGCGGGCCAGG + Intergenic
1057511152 9:95680554-95680576 TAGCTGCCTTCCCGCAGGGCAGG + Intergenic
1057628613 9:96701025-96701047 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1057689587 9:97271528-97271550 TAGGGGCCTCTCTCTGGGGCTGG - Intergenic
1057726926 9:97574399-97574421 TAGCTGCCTCCCCACGGGGCAGG + Intronic
1058174847 9:101724252-101724274 TAGCTGCCTTCCTGTGGGGCAGG - Intronic
1058379551 9:104363037-104363059 CAGCTGCCTCCCCGTGGGGCAGG - Intergenic
1058585361 9:106501476-106501498 TAGCTGCCTCCCTGCAGGGCAGG - Intergenic
1058727546 9:107818017-107818039 TAGCTGCCTCCCCGCGGGGCAGG + Intergenic
1058786517 9:108393737-108393759 TAGCTGCCTTCCTGTGGGGCAGG + Intergenic
1058799385 9:108530368-108530390 TAGCTGCCTCCCGGCGGGACAGG + Intergenic
1058813295 9:108661538-108661560 CAGTTGCCTCTCTTGGGGGCCGG - Intergenic
1059342016 9:113602591-113602613 AAGCTGCCTCTGTACGCGGCGGG + Intergenic
1059810642 9:117852249-117852271 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1059991545 9:119870419-119870441 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1060091363 9:120746568-120746590 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1060305366 9:122406333-122406355 TAGCTGCCTCCCCCCGGGGCAGG - Intergenic
1060594213 9:124838871-124838893 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1061483846 9:130910345-130910367 TAGCTGCCTTCCCGCGGGCCAGG + Intronic
1062017392 9:134297669-134297691 TTGCTGCCCCTCTGAGGGGCTGG - Intergenic
1062146193 9:134991169-134991191 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1062167667 9:135116051-135116073 TAGCTTCCTCTCTGGGGAGGCGG - Intronic
1062312151 9:135944662-135944684 CGGCAGCCTCTCTGCGGGGTGGG - Intronic
1062578215 9:137218299-137218321 CAGGGGCCTCTCGGCGGGGCTGG - Intergenic
1062582489 9:137234697-137234719 GAGCATCCTGTCTGCGGGGCTGG - Exonic
1062597966 9:137307556-137307578 CAGCTGCTTCTCTGCGGCCCTGG - Intronic
1203460419 Un_GL000220v1:31166-31188 TAGCTGCCTCCCCACGGGGCAGG - Intergenic
1186152575 X:6690644-6690666 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1186293196 X:8121768-8121790 TAGCTGCCTCCCCACAGGGCAGG + Intergenic
1186295635 X:8145110-8145132 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1186323234 X:8452628-8452650 TAGCTGCCTTCCTGCGGGGCAGG - Intergenic
1187005825 X:15231868-15231890 TAGCTGCCTTCCCTCGGGGCAGG - Intergenic
1187139070 X:16575676-16575698 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
1187304627 X:18084026-18084048 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1187557556 X:20366987-20367009 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1188881820 X:35499457-35499479 TAGCTGCCTCCCCGCCGGGCAGG + Intergenic
1189896831 X:45664958-45664980 TAGCTGCCTCCCCCTGGGGCAGG - Intergenic
1190045853 X:47111141-47111163 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
1190413947 X:50163468-50163490 TAGCTGCCTTCCCGCGCGGCAGG - Intergenic
1191618617 X:63192709-63192731 TAGCTGCCTTCCTGCAGGGCAGG - Intergenic
1192186770 X:68952337-68952359 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1192251405 X:69416947-69416969 TAGCTGCCTCCCCGCAGGGCAGG + Intergenic
1192869642 X:75173735-75173757 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1192870550 X:75179655-75179677 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1193040185 X:76996796-76996818 TAGTTGCCTTCCCGCGGGGCAGG - Intergenic
1193271085 X:79530802-79530824 TAGCTGCCTCCCTGCGGGCAGGG + Intergenic
1193804021 X:85972495-85972517 TAGCTGCCTTCCCACGGGGCAGG - Intronic
1193951756 X:87808844-87808866 TAGCTGCCTTCCTGCGGGGCAGG - Intergenic
1194025580 X:88746508-88746530 TAGCTGCCTCCCCAAGGGGCAGG - Intergenic
1194071583 X:89331167-89331189 TAGCTGCCTTCCCGCGAGGCAGG - Intergenic
1194166364 X:90521558-90521580 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1194197664 X:90915078-90915100 CAGCTGCCTCCCCGTGGGGCAGG + Intergenic
1194650805 X:96512389-96512411 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1194890477 X:99372217-99372239 TAGCTGCCTCCCCGCGGGGAAGG - Intergenic
1195256319 X:103094293-103094315 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1195460255 X:105115890-105115912 TAGCTGCCTCTCTGCGGGGCAGG - Intronic
1195896351 X:109749470-109749492 TAGCTGCCTCCCCGCGGGGGAGG - Intergenic
1195909593 X:109876031-109876053 TAGCTGCCTCCCGGCGGGGCAGG - Intergenic
1196197911 X:112855036-112855058 TAGCTGCCTTGCCGCGGGGCAGG - Intergenic
1196319515 X:114270698-114270720 TAGCTGCCTTCCCGCAGGGCAGG - Intergenic
1196582712 X:117394904-117394926 TAGCTGCCTTCCCGTGGGGCAGG + Intergenic
1196616148 X:117769236-117769258 TAGTTGCCTCCCTGTGGGGCAGG + Intergenic
1196662512 X:118282879-118282901 TAGCTGCGTTCCTGTGGGGCAGG - Intergenic
1196705894 X:118717074-118717096 TAGCTGCCTTCCCACGGGGCAGG - Intergenic
1196714631 X:118799179-118799201 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1196728913 X:118922121-118922143 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1196761957 X:119208610-119208632 TAGCTGCCTTCCCGCGAGGCAGG - Intergenic
1196762330 X:119211017-119211039 TAGCTGCCTTCCCGTGGGGCAGG - Intergenic
1196771515 X:119299904-119299926 TAGCTACCTTCCCGCGGGGCAGG + Intergenic
1196775218 X:119332097-119332119 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1196781449 X:119387722-119387744 TAGCTGCCTTCCTGCGGGGCAGG - Intergenic
1196827254 X:119750959-119750981 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1196845079 X:119890814-119890836 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1196860843 X:120025903-120025925 CAGCTGCCTCCCCGCGGGGCAGG - Intergenic
1197000271 X:121431666-121431688 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1197331163 X:125155614-125155636 TAGCTGCCTTCCAGCGGGGCAGG - Intergenic
1197344812 X:125319200-125319222 TAGCTGCCTTCCAGCGGGGCAGG - Intergenic
1197376780 X:125690717-125690739 TAGCTGCCTTCCAGCGGGGCAGG - Intergenic
1197533768 X:127663151-127663173 TAGCTGCCTCCCTGCGGGGCAGG - Intergenic
1197978774 X:132194309-132194331 CAGCTGCCTCCCCGTGGGGCAGG + Intergenic
1198060934 X:133044600-133044622 TAGCTGCCTCCCCGTGGGGCAGG + Intronic
1198333358 X:135642808-135642830 TAGCTGTCCCTCTGGGGGGAGGG - Intergenic
1198468119 X:136921589-136921611 TAGCTGCCTCCCTGTGGGGCAGG + Intergenic
1198664294 X:139004163-139004185 TAGCTGCCTTCCTGCGGGGCAGG - Intronic
1198694465 X:139321025-139321047 TAGCTGCCTCCCCGTGGGGCAGG + Intergenic
1198972574 X:142298383-142298405 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1199009924 X:142745861-142745883 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1199028783 X:142972274-142972296 TAGCTGCCTTCCTGCAGGGCAGG - Intergenic
1199050214 X:143228828-143228850 TAGCTGTCTTCCTGCGCGGCAGG - Intergenic
1199094827 X:143726375-143726397 CAGCCACCTCCCTGCGGGGCAGG - Intergenic
1199134160 X:144231390-144231412 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1199175555 X:144783841-144783863 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1199285089 X:146046337-146046359 TAGCTGCCTCCCAACGGGGCAGG - Intergenic
1199356228 X:146867020-146867042 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1199628122 X:149758748-149758770 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1199831264 X:151551325-151551347 TAGCTGCCTTCCAGTGGGGCAGG - Intergenic
1199831780 X:151555332-151555354 TAGCTGCCTCCCCGCAGGGCAGG - Intergenic
1199833020 X:151562961-151562983 TAGCTGCCTCCCTGTGGGGCAGG - Intergenic
1200423544 Y:2998513-2998535 TAGCTGCCTTCCCGCGGGGCAGG - Intergenic
1200470884 Y:3584235-3584257 TAGCTGCCTCCCGGCGGGGCAGG - Intergenic
1200512633 Y:4099339-4099361 TAGCTGCCTTCCCGCGGGGCAGG + Intergenic
1200544073 Y:4497735-4497757 CAGCTGCCTCCCCGTGGGGCAGG - Intergenic
1200725821 Y:6666896-6666918 TAGCTGCCTTCCCGCGAGGCAGG - Intergenic
1200786339 Y:7263826-7263848 CGGCTGCCTCCCCGCGGGGCGGG + Intergenic
1200829092 Y:7673310-7673332 TAGCTGCCTCCCCGCAGAGCAGG + Intergenic
1200888693 Y:8298840-8298862 TAGCTGCCTTGCCGCGGGGCAGG + Intergenic
1201429197 Y:13888042-13888064 TAGCTGCCTCCCCGTGGGGCAGG + Intergenic
1201430525 Y:13897417-13897439 TAGCTTCCTCTCTGTGGGGCAGG + Intergenic
1201487085 Y:14505873-14505895 TAGCTGCCTTCCCACGGGGCAGG + Intergenic
1201556329 Y:15267477-15267499 TAGCTGCCTCCCCATGGGGCAGG + Intergenic
1201982607 Y:19923854-19923876 TAGCTGCCTTCCCGAGGGGCAGG - Intergenic
1202109857 Y:21407424-21407446 TAGCTGCCTTTCCGCGGGGCAGG + Intergenic
1202137078 Y:21676801-21676823 TAGCTGCCTTGCCGCGGGGCAGG - Intergenic
1202202410 Y:22367295-22367317 CAGCTGCCTCCCTGCAAGGCAGG - Intronic
1202271476 Y:23078477-23078499 TAGCTGCCTCCCCACGGGGCAGG - Intergenic
1202294550 Y:23342205-23342227 TAGCTGCCTCCCCACGGGGCAGG + Intergenic
1202424471 Y:24712221-24712243 TAGCTGCCTCCCCACGGGGCAGG - Intergenic
1202446318 Y:24957864-24957886 TAGCTGCCTCCCCACGGGGCAGG + Intergenic