ID: 1195463350

View in Genome Browser
Species Human (GRCh38)
Location X:105152782-105152804
Sequence CAGAATGTGCTTCTTATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 477}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195463348_1195463350 7 Left 1195463348 X:105152752-105152774 CCATTATAGTGGGAGTGAGTATG 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1195463350 X:105152782-105152804 CAGAATGTGCTTCTTATAAAAGG 0: 1
1: 0
2: 3
3: 37
4: 477
1195463345_1195463350 30 Left 1195463345 X:105152729-105152751 CCTCATAGTGGGTATATATAACA 0: 1
1: 0
2: 0
3: 5
4: 123
Right 1195463350 X:105152782-105152804 CAGAATGTGCTTCTTATAAAAGG 0: 1
1: 0
2: 3
3: 37
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195463350 Original CRISPR CAGAATGTGCTTCTTATAAA AGG Intronic
903560953 1:24226869-24226891 GAGAAGTTGCTTCTTAAAAATGG - Intergenic
904561836 1:31403783-31403805 CAGGATGTCCTTCTTTTTAAAGG + Intergenic
907264038 1:53244532-53244554 CACAATTTGTTTCTTGTAAAGGG + Intergenic
909581128 1:77236404-77236426 AAGAGTGTTCTCCTTATAAAAGG + Intergenic
909678803 1:78268254-78268276 CAGCATCTGCTTCTTGAAAATGG + Intergenic
909707167 1:78599423-78599445 CACAATATGCTTCTTATAAAAGG + Intergenic
910563381 1:88617157-88617179 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
910566775 1:88652560-88652582 CAGGATTTCCTTCTTTTAAAAGG - Intergenic
910763852 1:90761411-90761433 CAGATTATGGTTCTCATAAAAGG + Intergenic
911364232 1:96917265-96917287 CAGAATTTCCTTTTTTTAAAAGG - Intergenic
912339132 1:108893751-108893773 CAAAATGTGATTTTTATTAAAGG - Intronic
912624818 1:111198220-111198242 CAGAGGGTGCTTCTTATTCAAGG + Intronic
912662954 1:111550260-111550282 CAGAAGTTGGTTCTTTTAAAAGG - Intronic
913227966 1:116716912-116716934 CAGAATTTCCTTCTTTTCAAAGG - Intergenic
913474156 1:119220651-119220673 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
914696349 1:150084587-150084609 GGAAATGTGCTTCTTATAAGTGG - Intronic
914751184 1:150536139-150536161 CAGTATGTGCTTCTTGGAAGAGG + Intergenic
915015268 1:152727249-152727271 GAGAATCTGCTTCCTATCAAAGG + Intergenic
915177364 1:154027144-154027166 CTGAATGTATTTCATATAAATGG - Intronic
915772186 1:158438174-158438196 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
916490595 1:165298834-165298856 CAGAAGGTGCTTATTTTATAAGG + Intronic
916805739 1:168259417-168259439 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
917759900 1:178145126-178145148 CAGAATGAGTTTTTTACAAATGG + Intronic
918972556 1:191438515-191438537 CAAACTATGCTTCTTACAAATGG + Intergenic
919017931 1:192064733-192064755 CAGAATTTATTTCTTTTAAAAGG - Intergenic
920153663 1:203930707-203930729 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
921817036 1:219575940-219575962 TTGAATGTGCTTATTGTAAATGG + Intergenic
922092670 1:222411841-222411863 CAGAATTTTCTTCTTATTTAAGG + Intergenic
923076627 1:230615189-230615211 GGGAATGGGCTTATTATAAAAGG - Intergenic
923618803 1:235560341-235560363 GGGAATGGGCTCCTTATAAAAGG + Intronic
924611732 1:245579235-245579257 CAGAATGTTCTTCGTTTAACTGG - Intronic
924651799 1:245935700-245935722 CAGAATTTCCTTCTTTTTAAGGG - Intronic
1063862042 10:10321230-10321252 CAGAATGTCCTTCCTGTATAGGG - Intergenic
1063877252 10:10493095-10493117 CAGAATGTCCTTCCTTTAGAGGG - Intergenic
1064821709 10:19343085-19343107 CAGAATGACCGTCCTATAAAGGG - Intronic
1065024893 10:21532856-21532878 CTAAATGTTCTTCTGATAAAGGG - Intergenic
1065176793 10:23084863-23084885 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
1066706030 10:38178968-38178990 GAGAATTTGCTTCTTATCATGGG + Intergenic
1067009764 10:42700117-42700139 CAGAAGTGGCTTCTTATTAAAGG + Intergenic
1067445579 10:46341609-46341631 GAGAATGTGCTTATTATCATGGG + Intergenic
1068134039 10:52933337-52933359 GAGAAAGTGCTTCCTTTAAAGGG - Intergenic
1068357363 10:55927159-55927181 AAGAATGAGCTTATGATAAATGG - Intergenic
1068706181 10:60078641-60078663 CAGAAATTCCCTCTTATAAAGGG - Intronic
1068797878 10:61104134-61104156 GAGTATGTGCTTCGTCTAAAGGG - Intergenic
1068877622 10:62013752-62013774 CAGAATTTGCTTCTTTTTTAAGG + Intronic
1069335861 10:67349370-67349392 CAGAATTTCCTTCTTTTTAAAGG - Intronic
1069765345 10:70852653-70852675 CAGAATCTGTTTCTGAAAAATGG - Intronic
1070363149 10:75710483-75710505 TAGAATGAGCTTGTTATAAATGG - Intronic
1071393894 10:85202614-85202636 CAGAATGGGCTTCTCAGAAGAGG - Intergenic
1071844913 10:89511969-89511991 CAGAATGTCCTTCCTTTATAAGG - Intronic
1072441129 10:95456404-95456426 CAGAGTGGGCTCCTCATAAAAGG + Intronic
1072515134 10:96174374-96174396 CAAAATTTGGTTCTTATCAAAGG + Intronic
1072584299 10:96767709-96767731 CAGAATGTCCTTCCTTTTAAAGG - Intergenic
1072593076 10:96845419-96845441 CAAAGTTTGCCTCTTATAAATGG + Intronic
1072865073 10:99050677-99050699 CATAATTTCCTTCTTTTAAATGG - Intronic
1073156129 10:101348208-101348230 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
1074656404 10:115593168-115593190 GAGAATGGGCTTATTATAAAAGG - Intronic
1075415579 10:122260120-122260142 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
1075577230 10:123586136-123586158 CACCATGTGCTTCTTTTGAATGG - Intergenic
1075866478 10:125725596-125725618 CAGATTGTAGTTTTTATAAACGG + Intronic
1076234299 10:128851826-128851848 AAGAATGTGCTTCTTGTCACAGG - Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077617429 11:3687580-3687602 CAGAAGGTGGTTCTTTGAAAAGG + Intronic
1079878717 11:25894893-25894915 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
1080438631 11:32269731-32269753 CTGAATGAGATTCTTATACAAGG - Intergenic
1081071097 11:38609267-38609289 CTTAATATGCCTCTTATAAATGG + Intergenic
1081422645 11:42889564-42889586 CAGGATCTACTTCTTATCAATGG - Intergenic
1082230112 11:49753672-49753694 AAGAATGTGCTTTTTTGAAATGG + Intergenic
1082640082 11:55648917-55648939 CAGAATGTGCATCCTAGTAAAGG - Intergenic
1082682628 11:56195365-56195387 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
1085538298 11:77241246-77241268 CAGAATTTCCTTCTTTTTAAAGG - Intronic
1086542149 11:87925795-87925817 GGTAATGTGCTTCTTATAAGTGG + Intergenic
1086733512 11:90277848-90277870 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
1086752170 11:90510718-90510740 AAGAATGCTCTTTTTATAAATGG + Intergenic
1086916293 11:92533478-92533500 CCAAATCTGCTTCTCATAAATGG - Intronic
1087366408 11:97225357-97225379 CTGAATGTGGGTCTCATAAAGGG + Intergenic
1087594159 11:100232796-100232818 CAAAATGTGCTGCTCATACATGG - Intronic
1087704592 11:101475800-101475822 CAGGATTTTCTTCTTTTAAAAGG + Intronic
1088562759 11:111132574-111132596 CAGAATTTCCTTCTTTTATAAGG + Intergenic
1089906971 11:122049958-122049980 CAGAATTTCCTTCCTTTAAAAGG + Intergenic
1090885316 11:130870992-130871014 CAGACAGTGCTTCTTGAAAATGG + Intergenic
1091126122 11:133099818-133099840 CAAACTGTGCTTCTGACAAAGGG - Intronic
1091364110 11:135002969-135002991 CAAAATGTCCTTCTTTTTAAAGG + Intergenic
1091547452 12:1511330-1511352 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
1092866356 12:12765137-12765159 CAGCATCTGCTTCTGATGAAGGG + Intronic
1092994001 12:13930686-13930708 CAGAGGGAGCTGCTTATAAAAGG + Intronic
1093160210 12:15738526-15738548 AAGAATGTTCTTATTATAGAAGG - Intronic
1093640508 12:21522063-21522085 TAGAATGTGTTACTTCTAAAAGG - Intergenic
1093940710 12:25050793-25050815 CAGAATTTCCTTCTTTTTAAAGG - Intronic
1094004979 12:25739721-25739743 CAGAATTTCCTTCTTTTTAATGG - Intergenic
1095428017 12:42099331-42099353 CAGAAATTGCTGCTTTTAAAAGG - Intronic
1096757339 12:53810885-53810907 TAGCATGTGCTTATAATAAAAGG + Intergenic
1097462858 12:59884704-59884726 CAGAATCTGCTTCTTTTTTAAGG + Intergenic
1097649332 12:62276663-62276685 CAAAATGTGATTCTGATATACGG - Intronic
1097714112 12:62947320-62947342 GGGAGTGTGTTTCTTATAAAAGG - Intergenic
1098518568 12:71408441-71408463 CAGGATTTCCTTCTTTTAAAAGG - Intronic
1098963060 12:76759562-76759584 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
1099043265 12:77682326-77682348 CAGAATTTCCTTCTTTTCAAAGG + Intergenic
1100071344 12:90723073-90723095 CAGAATCTGCTTCTTTTTAAAGG - Intergenic
1100669708 12:96797756-96797778 TAAATTTTGCTTCTTATAAAAGG + Intronic
1101031977 12:100669543-100669565 AAGAATGTCCTTGTTATTAAGGG - Intergenic
1101111328 12:101489419-101489441 CAGAATGTCCTTCTTTTTAAAGG - Intergenic
1101207173 12:102500140-102500162 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
1101521905 12:105491631-105491653 CAGAATTTCCTCCTTTTAAAAGG + Intergenic
1104158696 12:126157906-126157928 CAGAATTTCCTTCTTTTATAAGG + Intergenic
1104357124 12:128097038-128097060 CACGATGTGCATCTTAGAAATGG - Intergenic
1105470198 13:20686901-20686923 AAGAAAGTGAGTCTTATAAAAGG - Intronic
1105540896 13:21315801-21315823 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
1105601732 13:21893666-21893688 CAGAAAGTGCTCCTTATCCATGG + Intergenic
1105727282 13:23177039-23177061 CAGGATTTCCTTCTTTTAAAAGG - Intergenic
1106233474 13:27840965-27840987 GAGAATGTGCCCCTTCTAAAAGG - Intergenic
1106357069 13:28993061-28993083 CAGAATTTTCTTCTTTTTAAAGG + Intronic
1106510269 13:30407043-30407065 TAGAATATGTTTCTTATAATGGG - Intergenic
1106646653 13:31641738-31641760 CAGAATTTTCTTCTTTTTAAAGG - Intergenic
1107270839 13:38614150-38614172 AAAAATGTGCTTCATATATATGG + Intergenic
1109144044 13:58755175-58755197 CAGAATTTTCTTCTTGTATAAGG + Intergenic
1109318693 13:60782747-60782769 CAGAATTTGCTTCTTTTATAAGG + Intergenic
1109418889 13:62083619-62083641 CAGTGTGTGCTTCTTATAATTGG - Intergenic
1109639307 13:65166918-65166940 TAGTCAGTGCTTCTTATAAATGG + Intergenic
1111282385 13:86043725-86043747 CAGAATGTTCTGCTTTTTAATGG - Intergenic
1111366698 13:87256423-87256445 CAGAATTTCCTTCTTTTATAAGG - Intergenic
1112295877 13:98186593-98186615 CAGAATTTCCTTCTTTTTAAAGG + Intronic
1112410333 13:99157435-99157457 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
1114748709 14:25179670-25179692 CAGAATTTCCTTCTTTTAAAAGG - Intergenic
1114856998 14:26459658-26459680 CATAAAGTGTTTTTTATAAATGG - Intronic
1116463550 14:45206603-45206625 CAGAATGTACTTTTTAAAGATGG - Intronic
1116907366 14:50417092-50417114 AAGGATGTGCTTCATAAAAAGGG - Intergenic
1117981378 14:61345165-61345187 CAGAAAGTGCTTGCTAGAAAAGG - Intronic
1118117172 14:62792962-62792984 CAGAATTTTCTTCTTTTCAAAGG - Intronic
1119451441 14:74714464-74714486 CCCCATATGCTTCTTATAAAGGG - Intronic
1120079211 14:80196519-80196541 GAGAGTGGGCTTCTAATAAAAGG - Intergenic
1120217561 14:81696356-81696378 TAAAATGTGCATCTTCTAAATGG + Intergenic
1120478019 14:85013213-85013235 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
1121149240 14:91615618-91615640 CAGACTTTCCTTCTTTTAAAAGG + Intronic
1122245149 14:100397301-100397323 CAAAATCTGTTTCTTTTAAAAGG + Intronic
1124010823 15:25837337-25837359 CAGGATTTCCTTCTTTTAAAAGG - Intronic
1125061348 15:35428894-35428916 CAGAAATTGCTTTTTGTAAAAGG - Intronic
1125178575 15:36854859-36854881 CAGAATTTACTTCTTTTTAAAGG - Intergenic
1125990525 15:44102429-44102451 AAGAATGTACTTCTGGTAAACGG + Intronic
1127214172 15:56806964-56806986 CAAAATGTGCTTCTTTTTTAAGG - Intronic
1127943298 15:63723317-63723339 CAGAAAGTGCTACTTCTAACAGG + Exonic
1128140619 15:65298052-65298074 GAGAACCTGCTTCTTATAACTGG + Intronic
1128624187 15:69182701-69182723 CAGAGTGTGATACTTAAAAATGG + Intronic
1129080700 15:73037399-73037421 TAGAATGTGCTTTTAATAAGTGG - Intergenic
1130109493 15:80953066-80953088 CAGACTCTGCCTCTTACAAAAGG - Intronic
1130203836 15:81857459-81857481 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
1130972274 15:88742232-88742254 CGGAATGTGCTTCTAATACAGGG + Intergenic
1131637482 15:94251960-94251982 CAGAATTTCCTTCTTCTTAAAGG + Intronic
1131668603 15:94596126-94596148 CAGAATGGGTATCTTATAAACGG - Intergenic
1131778449 15:95827816-95827838 CAGCATTTGCTTCTCTTAAATGG + Intergenic
1132005599 15:98223692-98223714 CAGAAACTCCTTCTTTTAAAAGG + Intergenic
1132424880 15:101707505-101707527 CAGAATGTCCTTCCTTTATAAGG - Intronic
1134144172 16:11746764-11746786 CAGAATGGGCTTTCTAGAAATGG + Intergenic
1134179002 16:12032506-12032528 CAGAATTTTCTTCTTTTTAAAGG + Intronic
1134235028 16:12458949-12458971 CAGAATGTTTTACTTATATAAGG - Intronic
1135247006 16:20865713-20865735 CAGAAGGTGTTTTTTATGAAAGG + Intronic
1136302490 16:29345398-29345420 CAGAATTTTCTTCTTTTTAAAGG + Intergenic
1137324517 16:47420750-47420772 CAGCATTTGCTTCTGGTAAAAGG - Intronic
1137534781 16:49311771-49311793 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
1137872188 16:51961021-51961043 TAGAAGGTGGTTCTTATCAATGG + Intergenic
1139080299 16:63509810-63509832 CAGAATTTCCTTTTTATTAAAGG - Intergenic
1139171537 16:64635916-64635938 AAAAAGGTGCTTATTATAAAAGG + Intergenic
1141384055 16:83603213-83603235 CAGAATGTGCTTAGTGCAAATGG - Intronic
1141587810 16:85046635-85046657 CAGAATGTGCTTGTCAGGAAGGG + Intronic
1142990810 17:3729599-3729621 TAGCAAGTGCTTCTTAAAAAGGG + Intronic
1143725469 17:8842118-8842140 CAGCATCTGCTTCTGATAAGGGG - Intronic
1144345220 17:14343660-14343682 CAGAATTTCCTTCTTTTTAAAGG + Intronic
1144516396 17:15920131-15920153 CTGAATGTTCTCATTATAAATGG + Intergenic
1145864592 17:28232630-28232652 CAGAATGTGGTTCTCTTAACTGG - Intergenic
1146234015 17:31140775-31140797 CAGAATATCCTTCTTTTTAAAGG - Intronic
1146577725 17:34009659-34009681 CAGCATGTGCTTGGGATAAATGG - Intronic
1146732578 17:35207150-35207172 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
1148101311 17:45093559-45093581 CAGAATGTTCTTCAGATAGAGGG + Intronic
1149269489 17:54961094-54961116 AAGAATGTGCTTCTTCCATAGGG - Intronic
1149520916 17:57317813-57317835 CAGAATGTGCCTCTTGGGAAGGG + Intronic
1150954224 17:69838444-69838466 CAGAATTTCCTTCTTTTATAGGG - Intergenic
1152382840 17:79951128-79951150 CTGTATGTGCTTATTAGAAATGG - Intronic
1153030416 18:708620-708642 CTGAATGTGCTTCTTGAAGAGGG + Intronic
1154226110 18:12505726-12505748 CAAAATATGTTGCTTATAAAGGG + Intronic
1154325130 18:13384809-13384831 CAGAATTTTCTTCTTTTTAAAGG + Intronic
1155496592 18:26448765-26448787 CAGATTGTGCTTGTCAGAAAAGG - Intergenic
1156020766 18:32597344-32597366 CAGCAAGTGCTTCTTTCAAAGGG - Intergenic
1156282659 18:35656179-35656201 CACCATGAGCTTATTATAAATGG - Intronic
1156798444 18:41077674-41077696 TAGAATGTGCTGATGATAAAGGG + Intergenic
1157397951 18:47358891-47358913 CAGAATTTATTTCTTTTAAAAGG + Intergenic
1157703754 18:49783109-49783131 CAGAATTTCCTTCTTTTTAAAGG - Exonic
1157865295 18:51178180-51178202 CAGTATCTGTTTCTTTTAAATGG - Intronic
1157892531 18:51431668-51431690 CAGAATTTTCTTCTTTTTAATGG + Intergenic
1158062900 18:53367856-53367878 CAGAATTTCCTTCTTTTTAAAGG + Intronic
1158355743 18:56617068-56617090 CACATTGTGTTTCTTGTAAATGG - Intronic
1158580880 18:58681620-58681642 GAGAATGTCCTTTTTTTAAAAGG + Intronic
1159192488 18:65065006-65065028 CAGAATTTTCTTCTTCTTAAAGG + Intergenic
1159237044 18:65689410-65689432 CAGAATGTCCTTCTTTTTGAAGG + Intergenic
1159438810 18:68451253-68451275 CAGAAGATGCTTCTCATACAAGG - Intergenic
1159691952 18:71499598-71499620 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
1162214608 19:9122948-9122970 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
1163966063 19:20748600-20748622 CAGATTCAGCTCCTTATAAAAGG + Intronic
1165220528 19:34312618-34312640 CAGAATTTCCTTCTTTTTAAAGG + Intronic
1166051181 19:40261220-40261242 CAGAGTGGGTTCCTTATAAAAGG + Intronic
1166718514 19:44984444-44984466 CAGAATGTCCTTCTTCCACAGGG - Intronic
1167813984 19:51862657-51862679 CAGAAAGTTCTTCATAGAAAAGG - Intronic
1168036278 19:53722179-53722201 CAGAAAGTGCTTCCTCTAGAGGG - Intergenic
1168038930 19:53742525-53742547 CAGAAAGTGCTTCCTCTAGAGGG - Intergenic
925299694 2:2802352-2802374 GAGAAGTTGCTTCTTATGAATGG - Intergenic
926239914 2:11077556-11077578 CAGCAGGTGCTACTTCTAAATGG - Intergenic
926937631 2:18102348-18102370 CAGAATTTGCTTATTTTTAAAGG + Intronic
927256416 2:21044094-21044116 CAGCCTGGGCTTCCTATAAATGG - Intergenic
929126988 2:38531249-38531271 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
929422974 2:41813895-41813917 TAGAATGTGCTAATTATATATGG + Intergenic
930820316 2:55639880-55639902 CTAAATGTGCTTTTTAAAAAAGG - Intronic
930996029 2:57719546-57719568 CAGAATGTCATTCTTTTTAAGGG - Intergenic
931095955 2:58941681-58941703 TAAAATGTGCTTCTTGTAAATGG + Intergenic
931579928 2:63761192-63761214 CAGAGTGGGTTTCTGATAAAAGG + Intronic
932902617 2:75716609-75716631 AGAAATGCGCTTCTTATAAACGG + Intergenic
933732348 2:85466867-85466889 AGGAATATGCTACTTATAAAAGG - Intergenic
935188776 2:100758832-100758854 CAGAATTTGCTTCTTTTTTAAGG - Intergenic
935604029 2:104951789-104951811 CAGAATTTCCTTCTTTTCAAAGG + Intergenic
935608646 2:104997599-104997621 TAGAATATGGTACTTATAAAGGG + Intergenic
935621464 2:105134003-105134025 CTGAATTTTCTACTTATAAATGG + Intergenic
935804561 2:106732928-106732950 CAGAATGGGCTGATTATGAATGG + Intergenic
935954381 2:108361188-108361210 CAGAATGAGCTTATTCTATATGG + Intergenic
936022897 2:109008544-109008566 CAGAATGTGGTGCTAATGAATGG + Intergenic
936391571 2:112079437-112079459 CAGAATTTTCTTCTTTTTAAAGG + Intronic
936690769 2:114885355-114885377 GGGAGTGTGTTTCTTATAAATGG - Intronic
936943372 2:117908535-117908557 CTGAATGTGCATTTTATGAAGGG - Intergenic
937739180 2:125329469-125329491 CAGCATGTTCATCTTTTAAATGG - Intergenic
938188316 2:129252908-129252930 CTGTGTGTGTTTCTTATAAAAGG + Intergenic
939017953 2:136923273-136923295 CAGAATTTCCTTCTTTTTAAAGG + Intronic
939107729 2:137969098-137969120 CAGAGTGTACTACTTAAAAAAGG - Intronic
939668166 2:144976471-144976493 CAATATGTGATTCTTATAAAAGG - Intergenic
940698167 2:157006519-157006541 TCTAATGTACTTCTTATAAATGG + Intergenic
940742547 2:157526168-157526190 CAAAATGTGCTACTTTTGAAAGG + Intergenic
940782224 2:157944914-157944936 TAGTATGTGTTTCTTAAAAATGG + Intronic
941222227 2:162797013-162797035 CAGATTGTACTTCTTCTAGATGG - Intronic
941352206 2:164450851-164450873 GAGATTGTGCTGCTTTTAAACGG - Intergenic
942146109 2:173028381-173028403 GAGAGTGTGCTTCTTCTAACGGG - Intronic
943378139 2:187107021-187107043 CAGAAAATTCATCTTATAAATGG - Intergenic
943592297 2:189813422-189813444 CAAAATGTGCATCTTAGAATTGG - Intronic
943764850 2:191649375-191649397 AGGAATGGGTTTCTTATAAAAGG + Intergenic
944293301 2:198033095-198033117 TAAAATGTGATTCTTATAAATGG + Intronic
944603983 2:201332882-201332904 CAGAATTTCCTTCTTTTTAAAGG + Intronic
945074980 2:206029649-206029671 GAGAATGTGCTTCTTAGGAGAGG - Intronic
946623504 2:221585300-221585322 CAGAATTTCCTTCTTTTTAAGGG + Intergenic
946797177 2:223367679-223367701 CAGAATTTGATTCTCACAAAAGG - Intergenic
1169784184 20:9341195-9341217 CAGAACGTGGTTCTTAGAATGGG - Intronic
1170085220 20:12524192-12524214 AAGAGTGGGTTTCTTATAAAAGG + Intergenic
1170619526 20:17983229-17983251 CAGAATTTCCTTCTTTTTAAAGG + Intronic
1170792500 20:19519483-19519505 GAGAGTGTGCTTTTTAAAAAAGG + Intronic
1171077161 20:22139425-22139447 CAGAATTTCCTTCCTTTAAAAGG + Intergenic
1171318360 20:24216075-24216097 AAAAATGTGTTTTTTATAAAAGG - Intergenic
1172171993 20:32942149-32942171 CAGAGTGTCTTTCTTATAGAAGG + Intronic
1172261710 20:33572359-33572381 AAGAAAGTGATTTTTATAAATGG + Intronic
1173762113 20:45571803-45571825 CAGAATTTCCTTCTTTTTAAAGG + Intronic
1173776443 20:45712106-45712128 CAGAATTTCCTTTTTTTAAAAGG - Intergenic
1174643008 20:52061409-52061431 CAAAATGTTCTTTTTATTAAGGG - Intronic
1174943039 20:54953097-54953119 CAGAATCTGCTTCTTTTTTAAGG - Intergenic
1175047798 20:56123745-56123767 CAGGTTGTGGTTCTTAGAAAGGG + Intergenic
1175634392 20:60568574-60568596 TAGAATGTGCTTATTAGACAGGG + Intergenic
1176917409 21:14643531-14643553 CAGACTGTATTTCTTATAAAGGG - Intronic
1177039316 21:16087203-16087225 AAGAATGTAATTCTAATAAATGG + Intergenic
1178191663 21:30289183-30289205 CAGCATGTTCTTCTAAGAAATGG + Exonic
1178529456 21:33363212-33363234 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
1179268998 21:39834127-39834149 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
1182731541 22:32499356-32499378 CAAAATGTTCTTCAAATAAAAGG - Intergenic
1182850330 22:33468490-33468512 CAGAATGTGCTGCCTAAAGATGG - Intronic
1182930381 22:34167824-34167846 CAGAATTTCCTTCTTCTATAAGG + Intergenic
1183029096 22:35088840-35088862 CAGAATGTGTTCCTTATAAAAGG + Intergenic
950735043 3:15000340-15000362 CAGAATTTCCTTCTTTTTAAAGG + Intronic
950930906 3:16788089-16788111 AGGAATGTGCTCCTCATAAAAGG - Intergenic
951458946 3:22928175-22928197 CAAACTGTGCTTCTTATAAGGGG + Intergenic
951631266 3:24723603-24723625 CAGAATGTCCTTCTTCTTAAAGG + Intergenic
952311974 3:32198723-32198745 CAGATTGTGCTTCCAAAAAATGG + Intergenic
953862160 3:46553810-46553832 AAGAATGTGCTCCCTATAAATGG + Intronic
953964505 3:47292953-47292975 CAGAATTTTCTTCTTTTTAAAGG - Intronic
954491340 3:50909425-50909447 CAGCATTTGCTTCTTTGAAAAGG + Intronic
954585855 3:51735737-51735759 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
954770209 3:52960833-52960855 CAGAATTTCCTTTTTTTAAAAGG - Intronic
955007939 3:54987173-54987195 CAGAAAGTGATTCTGAGAAAGGG + Intronic
955923692 3:63984955-63984977 CAGAATTTCCTTCTTTTTAAGGG + Intronic
956290225 3:67653644-67653666 CAGACTGTGCTTTCTTTAAAAGG + Intronic
956518501 3:70078134-70078156 CAGAAGTTCCTTCTAATAAAGGG - Intergenic
956984630 3:74684441-74684463 CAGAAAACGCTTCTTATCAAGGG + Intergenic
957082140 3:75645525-75645547 CAGAATGTGCTTTGTTAAAAAGG + Intergenic
957169217 3:76716020-76716042 CAAAATGATATTCTTATAAAGGG + Intronic
957276629 3:78097947-78097969 CACATTGTCCTTCTTAGAAAAGG - Intergenic
957739940 3:84252195-84252217 CAAAATGCGCTCCTTACAAATGG - Intergenic
957889522 3:86337951-86337973 CAGAAGATATTTCTTATAAATGG + Intergenic
958452093 3:94286141-94286163 GATAATGTGTTTCTTACAAATGG + Intergenic
959044378 3:101455883-101455905 CTGAATGTTCTACTTCTAAAAGG - Intronic
960766602 3:121136992-121137014 CTCCATGTGCTCCTTATAAATGG + Intronic
960912740 3:122665601-122665623 CAGAATGTGATGCTTATCACAGG - Intergenic
962175492 3:133149667-133149689 CAGAATTTTCTTCTTTTTAAAGG + Intronic
963537679 3:146548184-146548206 CAGAATTTCCTTCTTTTATAAGG + Intergenic
963624918 3:147659175-147659197 TAGAATGTCCTTCTTTTTAAGGG + Intergenic
963757897 3:149255322-149255344 CAGAATTAGCTTCTTCTAAATGG - Intergenic
964201808 3:154125718-154125740 CAGAAACAGCTCCTTATAAAAGG - Intronic
964323673 3:155524138-155524160 CAGAATTTCCTTCTTCTTAAAGG - Intronic
964725274 3:159808167-159808189 CAGAATATGCTTAATATTAATGG - Intronic
965072752 3:163936660-163936682 CAGCATTTTCTTCCTATAAATGG + Intergenic
965229928 3:166037542-166037564 CAGAAGAAGCTTCTTAAAAAAGG + Intergenic
966295487 3:178416188-178416210 CAAACAGAGCTTCTTATAAATGG + Intergenic
966894669 3:184434880-184434902 CAGAATGTCCTTCTTTTTAAAGG + Intronic
968092032 3:195904348-195904370 CAGAATTTTCTTCTTTTTAAAGG - Intronic
968173926 3:196532725-196532747 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
968840734 4:3003551-3003573 CAGAATTTCCTTTTTTTAAAAGG + Intronic
969965071 4:10985598-10985620 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
970561522 4:17286174-17286196 CACAATGTACTTCTTAGAAATGG + Intergenic
970789518 4:19840176-19840198 TAGAATGAGTTTCTGATAAAAGG + Intergenic
971032015 4:22648551-22648573 CAGAATTTTCTTCTTGTTAAAGG + Intergenic
971092810 4:23364447-23364469 CATAAAGTGTTTCTTACAAATGG + Intergenic
971269059 4:25121267-25121289 CACAATGTGTTACTTATACATGG - Exonic
971782186 4:31050686-31050708 AAAGATGTGCTTCTTAGAAATGG - Intronic
972069689 4:35001695-35001717 CAGAATGTACCTCTTATAAAAGG - Intergenic
973224655 4:47769091-47769113 CTGAATGTGCTTATTCTAACAGG - Intronic
973558765 4:52112930-52112952 CATGATATGCTTCTTAAAAAAGG + Intergenic
973913850 4:55612733-55612755 GAGAATTGGCTTCTTGTAAAGGG - Intronic
974223680 4:59010408-59010430 CATAATTAGCTTCTTATCAAGGG - Intergenic
975153936 4:71050191-71050213 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
975549095 4:75592008-75592030 CAGTATGTACTTATTATAACAGG + Intronic
975868671 4:78753438-78753460 CTGAATCTGATTCTTAAAAATGG + Intergenic
975913880 4:79299529-79299551 CAGAATTTGATTATTAAAAAAGG + Intronic
975968674 4:80007319-80007341 CACAATGTGCTTATAATAAAAGG + Intronic
977504142 4:97880116-97880138 CAGAATTTCCTTCTTTTAGAAGG - Intronic
977730401 4:100344297-100344319 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
977822821 4:101495498-101495520 AAGAATTTGGTTCTTTTAAAAGG + Intronic
978007992 4:103641791-103641813 CAGAATCTCCTTCTTTTTAAAGG - Intronic
978731728 4:112035650-112035672 CAGAATTTGCTTCTTTTTAATGG - Intergenic
978864906 4:113495765-113495787 TAGAATCTGCTTGTTGTAAAGGG + Intronic
979481776 4:121227544-121227566 CAGAATGACTTTCTTAAAAAAGG - Intergenic
980091783 4:128450587-128450609 CAGAAAGTGCTTCTGTAAAATGG + Intergenic
980338062 4:131501176-131501198 CAGAATGTTCTCCATAAAAAAGG + Intergenic
981393674 4:144220839-144220861 CTGACTGGGTTTCTTATAAAAGG - Intergenic
981606216 4:146543974-146543996 CAGCATTTGCTTGTCATAAATGG + Intergenic
982290821 4:153780840-153780862 GTTAATGTGCTTCTAATAAATGG + Exonic
983485540 4:168327926-168327948 CTTAATGGGCTTCTCATAAAAGG + Intergenic
983702516 4:170615184-170615206 CAGAGTGAGATTCTTATAAAAGG - Intergenic
983704956 4:170645960-170645982 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
984047288 4:174816062-174816084 CAGAATGTGCATTTTATCAAGGG - Intronic
985020356 4:185682419-185682441 GGGAATTTACTTCTTATAAAAGG + Intronic
985314281 4:188638083-188638105 TATAATATGTTTCTTATAAATGG + Intergenic
985987119 5:3525143-3525165 CAGGATGTCCTTCTTTTTAAAGG - Intergenic
986537647 5:8807907-8807929 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
987645477 5:20666108-20666130 CAGAATTTTCTTCTTTTTAAAGG + Intergenic
989081011 5:37621475-37621497 GAGAATGTGTCTTTTATAAATGG - Intronic
989531710 5:42514978-42515000 CAGTCTGTGCTCCTGATAAAAGG - Intronic
990512566 5:56501931-56501953 CAGACTGTGGTTCTTATCTAGGG + Intergenic
991152749 5:63390223-63390245 CAGACTCTGCTTTTTATAATAGG - Intergenic
991556982 5:67906586-67906608 CAGAATTTTCTTCTTATTTAAGG - Intergenic
991679224 5:69122090-69122112 CAGAATGTCCCTCTTTTTAAAGG - Intronic
992084358 5:73264710-73264732 CAGAATGTGCTTCCTTTTAATGG - Intergenic
992306219 5:75441734-75441756 CAGAATTTCCTTCTTTTTAAAGG + Intronic
992948043 5:81828991-81829013 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
993131729 5:83906905-83906927 AAGACTTTGCTTCTTGTAAATGG - Intergenic
993155989 5:84223440-84223462 CAGAATCTCCTTCTTTTATAAGG - Intronic
993472792 5:88326406-88326428 CAGAATTTCCTTTTTTTAAAGGG + Intergenic
993540529 5:89144951-89144973 CAGTATGTCCTTCTTTTTAAAGG + Intergenic
993758194 5:91758388-91758410 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
993869454 5:93234560-93234582 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
996394161 5:122995882-122995904 CAGAATGCCCCTCTTATAACAGG + Intronic
996767727 5:127051434-127051456 CAGAACCTTCTTCCTATAAATGG + Intronic
997026735 5:130072809-130072831 CAGAATTTCCTTCTTTTTAAAGG - Intronic
997631745 5:135373995-135374017 CTGAATATACTTCTCATAAAAGG - Intronic
999085167 5:148881809-148881831 CACAAAGTCCTTCTTGTAAATGG + Intergenic
999216153 5:149937162-149937184 TAGAATGTGCTTCATATACCTGG - Intronic
999716176 5:154362103-154362125 CAGAAGGAGCTTCTTATATTTGG - Intronic
999885186 5:155914759-155914781 CATAATTTGTTTCTTACAAAAGG + Intronic
1000135766 5:158349056-158349078 CAGAATATGCTTATTAGAATGGG + Intergenic
1001011746 5:168105104-168105126 TAAAATGTGCGTGTTATAAATGG + Intronic
1001386808 5:171346249-171346271 CAGAATTTTCTTCTTTTTAAAGG + Intergenic
1001958534 5:175865301-175865323 CAGAGTGTGCTGGTTCTAAATGG + Intronic
1002653448 5:180722390-180722412 CAGAATTTCCTTCTTTTGAAAGG - Intergenic
1002763942 6:223642-223664 CAGCTTGTGCTTCTCAGAAAAGG - Intergenic
1003014013 6:2453345-2453367 CAGAATGTCCTTCCTTTATATGG + Intergenic
1003410825 6:5861466-5861488 CAGAATGTCCTTCTTTTTAAAGG - Intergenic
1003601207 6:7519117-7519139 CTGATTGTGCTTCTTGTAATGGG + Intergenic
1004091878 6:12511851-12511873 CAGAATTTTCTTCTTTTTAAAGG - Intergenic
1004455403 6:15787242-15787264 CAGAATTTCCTTCTTTTCAAAGG - Intergenic
1004713797 6:18197358-18197380 CAGAATGTGTTTCTCCTGAAAGG + Intronic
1004751614 6:18567693-18567715 TAGAATGTCCTTCTTTTTAAAGG + Intergenic
1005054098 6:21713719-21713741 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
1005388254 6:25307520-25307542 TCCAATGTGCTTCTTGTAAATGG - Intronic
1005734921 6:28736819-28736841 CAGAATTTCTTTTTTATAAAAGG - Intergenic
1008187868 6:48416698-48416720 CAGAATTTTCTTCTTTTATATGG - Intergenic
1008488031 6:52056124-52056146 CAGAATGAGTTTCTTATAGCTGG - Intronic
1008685519 6:53921975-53921997 CAGCATGTACATCTTTTAAATGG - Intronic
1008874216 6:56308001-56308023 CAGAATTTCCTTCTTTTTAAAGG - Intronic
1010468317 6:76194914-76194936 CAGAATTTTCTTCTTTTTAAAGG + Intergenic
1012061467 6:94489025-94489047 TTTAATGTGTTTCTTATAAAAGG + Intergenic
1012156699 6:95827759-95827781 GGGAAAGTGTTTCTTATAAATGG - Intergenic
1012354160 6:98292267-98292289 CAGAATATTCTTCTGATATATGG - Intergenic
1013975366 6:116071631-116071653 CAGAGTGTGCTTCCTTTAATTGG - Intergenic
1014425839 6:121304961-121304983 CAGAATGTACTTATTTAAAAAGG + Intronic
1014495257 6:122113829-122113851 CAGAATATTCTTCTTTTTAAAGG + Intergenic
1015208981 6:130674329-130674351 CAGAATTTTCTTCTTATTAAAGG - Intergenic
1015418307 6:132975929-132975951 ATGAATTTGCTCCTTATAAATGG + Intergenic
1016235688 6:141862654-141862676 CAGAATTTACTTCTTTTAAAAGG - Intergenic
1016271773 6:142298396-142298418 CAGAATGTGCTTGTTCTGAATGG + Intergenic
1016285761 6:142471075-142471097 CAGAATTTCCTTTTTTTAAAGGG + Intergenic
1016478654 6:144457137-144457159 CACAATTTACATCTTATAAAAGG - Intronic
1016495609 6:144658507-144658529 CAGAATATGCATCTCCTAAAGGG - Intronic
1016524082 6:144980353-144980375 CAGAATTTGCTTCTTTTTTAAGG + Intergenic
1017095377 6:150800208-150800230 CAGTTTGTGCATCATATAAAAGG + Intronic
1018108280 6:160509892-160509914 CAGAAAGTGGTACTTTTAAAAGG - Intergenic
1018168846 6:161127658-161127680 CAGAATTTGATTCTTTGAAAAGG - Intergenic
1018559734 6:165089196-165089218 CAGAGTGTGCTGATTAGAAAAGG - Intergenic
1019629148 7:2037387-2037409 GATACTGTGCTTCTTACAAATGG + Intronic
1020989435 7:15178967-15178989 AGGAATGGGCTCCTTATAAAAGG - Intergenic
1021007076 7:15411093-15411115 AAGAATGGGCTCCTGATAAAAGG + Intronic
1021184144 7:17543158-17543180 GAGAATGTGCTGCTAAGAAAGGG + Intergenic
1021484335 7:21150179-21150201 CAGAAAGTGTTTATTATCAAAGG - Intergenic
1021556633 7:21925928-21925950 CAGTTTGTGCTTCATATAATGGG + Intronic
1024614154 7:51094045-51094067 CAGAATTTTCTTCTTTTTAAAGG - Intronic
1024861474 7:53847547-53847569 GAGATTTTGCTTGTTATAAATGG + Intergenic
1026486205 7:70823800-70823822 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
1028112445 7:86958231-86958253 CCTAATCTGCTTTTTATAAAGGG + Intronic
1028810885 7:95084651-95084673 CATATTGTACTTGTTATAAATGG + Intronic
1029678026 7:102085018-102085040 GAGAATTTCCATCTTATAAACGG - Intronic
1029801587 7:102953462-102953484 CTGAGTGTTCTTATTATAAAAGG - Intronic
1030183312 7:106733242-106733264 CAGGATTTCCTTCTTTTAAAAGG - Intergenic
1030547247 7:110911927-110911949 CAGAATTTTCTCCTTTTAAAAGG + Intronic
1030670636 7:112332080-112332102 CAGATTGTGCTGCTCATACAGGG + Intronic
1030800473 7:113844038-113844060 CAGGCTGTGCTTATTATAGAGGG + Intergenic
1030831628 7:114230672-114230694 CTGAATGTTCTTATTGTAAAAGG - Intronic
1031745637 7:125494375-125494397 CAGAATTTTCTTCTTTTAAAAGG - Intergenic
1031803473 7:126277874-126277896 CAGAATTTTTTTTTTATAAAAGG + Intergenic
1032503896 7:132421266-132421288 CAGAATGTCCTTCTTTTTAAAGG + Intronic
1032650314 7:133871043-133871065 CAGAATTTGCTTTTTAATAATGG - Intronic
1033763531 7:144462869-144462891 CAGCATGTTCTACTCATAAAAGG + Intronic
1037451202 8:19016846-19016868 GAGAATGGGCTTCTGACAAAAGG - Intronic
1037846267 8:22285396-22285418 CAGGATGTACTTCTTTTTAAAGG + Intronic
1038884537 8:31648728-31648750 CAGAATTTCCTTCTTTTGAAAGG + Intronic
1039987843 8:42463004-42463026 CAGAATTTTCATCTTAAAAAAGG - Exonic
1039997755 8:42549110-42549132 CAGAATGTCCTTCCTTTTAAGGG - Intronic
1040862553 8:52014887-52014909 CAGAATTTTCTTCTTTTTAAAGG + Intergenic
1041096819 8:54358576-54358598 CAGAATGTCCTTCCTTTTAAAGG + Intergenic
1041121924 8:54594449-54594471 AATAATGTGCTTCTAACAAAAGG - Intergenic
1041662947 8:60416440-60416462 CCAGATGTGCTTCTTATAAAGGG + Intergenic
1041986990 8:63933546-63933568 CAGAATTTTCTTCTTTTTAAAGG + Intergenic
1042425807 8:68646787-68646809 CAGAATTTTCTTCTTTTTAAAGG + Intronic
1043659453 8:82718144-82718166 CAGAATTTTCTTCTTTTATAAGG - Intergenic
1043782751 8:84356550-84356572 AAAAATTTGCTTATTATAAAAGG - Intronic
1045633654 8:104157635-104157657 CAGAATTTGCTTCTTTTTTAAGG + Intronic
1045883351 8:107066426-107066448 CAGAATTTCCCTCTTTTAAAAGG - Intergenic
1045888943 8:107131561-107131583 CTGAATGTGCTTCTGATATGAGG + Intergenic
1046381379 8:113454712-113454734 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
1047057336 8:121180551-121180573 CAGGATTTGCTTCTTCTAAAAGG - Intergenic
1047383048 8:124382049-124382071 CAGAAAGTGCTCATTAGAAATGG + Intergenic
1047713182 8:127572059-127572081 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
1048221209 8:132543757-132543779 CAGAATGGGCTTCTTAGGGAAGG - Intergenic
1048767627 8:137862187-137862209 CAGAATTGGCTCCTTAGAAATGG - Intergenic
1048814421 8:138318653-138318675 CAAAATGTGCTTCCTATGAGGGG - Intronic
1050031425 9:1390323-1390345 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
1050172966 9:2842058-2842080 CAGAATGGCATTCTTATACATGG + Intronic
1051664226 9:19453229-19453251 CAGAATGTGCTTCTAGAAACTGG + Intergenic
1052010439 9:23401514-23401536 CAGAATTTTCTTCTTTTTAAAGG - Intergenic
1052024276 9:23557404-23557426 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
1052132974 9:24872659-24872681 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
1052183602 9:25562640-25562662 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
1052395403 9:27932143-27932165 CAAAGTGTGCTTCATGTAAAAGG + Intergenic
1052662444 9:31451941-31451963 TAGAATTTCCTTCTTATTAAAGG - Intergenic
1052702622 9:31956593-31956615 CAGAATATCCTTCTTTTTAAAGG - Intergenic
1052702733 9:31958470-31958492 CAGAATTTTCTTCTTTTGAAAGG - Intergenic
1052808183 9:33032061-33032083 CAGATTTTGCTGTTTATAAATGG + Intronic
1052968176 9:34358317-34358339 CAGTATTTCCTTCTTTTAAATGG + Intergenic
1053132625 9:35626035-35626057 CAAAATGTGTTTCTTAAATAAGG - Intronic
1056384340 9:86082954-86082976 CATAATGTGCTACTAAAAAAGGG - Intronic
1056509907 9:87294614-87294636 CAGTAGCTGCTTTTTATAAATGG + Intergenic
1057637637 9:96785580-96785602 GTGAAAGTGCTTCTTATATAAGG + Intergenic
1058422243 9:104843095-104843117 GAGAAGGTGCTTTTTTTAAAGGG - Intronic
1058591997 9:106575193-106575215 CAGAATTTCCTTCCTTTAAAAGG - Intergenic
1058718320 9:107741444-107741466 GAGCATGTGCTTCATCTAAAGGG - Intergenic
1059781833 9:117537639-117537661 GAGAATGTTCTTCTAATGAAGGG - Intergenic
1059857617 9:118417567-118417589 CAAAGTGTGTTTCTTATAAAAGG + Intergenic
1059882808 9:118710420-118710442 AAGAATGGACTTCTAATAAATGG - Intergenic
1059915765 9:119098203-119098225 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
1060319651 9:122545280-122545302 AAGAATGTGCATTTTATAAGTGG + Intergenic
1060384602 9:123213323-123213345 CAGAATGTGTAACTGATAAATGG + Intronic
1061527639 9:131180018-131180040 CAAAAGGTGCTTCTCATACATGG - Intronic
1185534289 X:848427-848449 CAGAAAGTGTTTCTTGTAAGAGG - Intergenic
1187570675 X:20497652-20497674 CAGAATTTTCTTCTTTTTAAAGG + Intergenic
1187571074 X:20502687-20502709 CAGGATTTCCTTCTTTTAAAAGG + Intergenic
1188076711 X:25785691-25785713 CAGAATTTCCTTATTATATAAGG - Intergenic
1188460686 X:30423484-30423506 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
1188735759 X:33713128-33713150 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
1189517919 X:41734056-41734078 CTGAGTGTGCTTCCTTTAAATGG - Intronic
1189535660 X:41932948-41932970 CAGAATGTCCTTCTTTTTTAAGG - Intergenic
1189855547 X:45221297-45221319 CAGAATTTCCTTCTTTTTAAAGG + Intergenic
1190068205 X:47257753-47257775 CAGAATGTGCAACTTTTAAAAGG - Intergenic
1190582327 X:51901397-51901419 CAGAATTTCCTTCTTTTTAAAGG + Intronic
1190924169 X:54887088-54887110 CAGAATTTCCTTCTTTTGAAAGG + Intergenic
1191051784 X:56201276-56201298 CAGAATTTACTTCTTTTTAAAGG - Intergenic
1191733097 X:64358668-64358690 CATGTTGTACTTCTTATAAATGG + Intronic
1192983569 X:76372346-76372368 CAGAATATGCTCCTTATCCAAGG + Intergenic
1193254278 X:79328006-79328028 CAGAATTTGCTTCTTTTTTAAGG + Intergenic
1193610702 X:83628754-83628776 CAGCATTTGCTTATTTTAAAAGG + Intergenic
1193758613 X:85439016-85439038 CAGTATTTGCTTGTTTTAAAAGG + Intergenic
1194573443 X:95581581-95581603 CAGAATTTCCTTCTTTTCAAAGG - Intergenic
1194583649 X:95706647-95706669 CAAAATGTGCATCTTATGTAAGG + Intergenic
1194983955 X:100470152-100470174 CAGAATTTCCTTCTTTTTAAAGG - Intergenic
1195071864 X:101289222-101289244 CAGAATTTCCTTCTTTTTAAAGG + Intronic
1195090661 X:101455569-101455591 CACAATGTGCATCTTAACAAAGG + Intronic
1195114648 X:101684741-101684763 CAGCATGAGCTTATTATAAGTGG + Intergenic
1195247712 X:103010562-103010584 CTAAATGGGCTTCCTATAAAGGG - Intergenic
1195463350 X:105152782-105152804 CAGAATGTGCTTCTTATAAAAGG + Intronic
1196504046 X:116419614-116419636 GAGAGTGTGTTTCTTATAAAAGG - Intergenic
1196757064 X:119167360-119167382 CAGAATGTGCCTCTGATGCATGG - Intergenic
1196933880 X:120709785-120709807 CAGAATTTCCTTCTTTTATATGG + Intergenic
1197420892 X:126235792-126235814 CAGAATCTGTTTCTTATAGAAGG - Intergenic
1198137547 X:133769050-133769072 CAGGATGTTCTTCTTTTAAAAGG - Intronic
1198346277 X:135762849-135762871 CAGAATGTGTTTGATATAACAGG - Intronic
1198348183 X:135780134-135780156 CAGAATGTGTTTGATATAACAGG - Intergenic
1198353903 X:135831938-135831960 CAGAATGTGTTTGATATAACAGG - Intronic
1198359640 X:135883749-135883771 CAGAATGTGTTTGATATAACAGG - Intronic
1198366494 X:135945527-135945549 CAGAATGTGTTTGATATAACAGG - Intergenic
1199568356 X:149242106-149242128 CAGGATTTTCTTCTTTTAAAAGG - Intergenic
1199752585 X:150834905-150834927 CAGAATTTCCTTCTTTTTAAAGG - Intronic
1201360263 Y:13139069-13139091 CAGAAAGTGTTCTTTATAAAAGG + Intergenic
1202238172 Y:22736661-22736683 CAGAATGTCCTCCTTTTATAAGG + Intergenic