ID: 1195464398

View in Genome Browser
Species Human (GRCh38)
Location X:105164304-105164326
Sequence GAGAGTGACCAATGTGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195464392_1195464398 26 Left 1195464392 X:105164255-105164277 CCTGAGCTGATCCCAAAACTTAC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1195464398 X:105164304-105164326 GAGAGTGACCAATGTGTTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 164
1195464393_1195464398 15 Left 1195464393 X:105164266-105164288 CCCAAAACTTACCAGACTGAATT 0: 1
1: 0
2: 1
3: 15
4: 216
Right 1195464398 X:105164304-105164326 GAGAGTGACCAATGTGTTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 164
1195464394_1195464398 14 Left 1195464394 X:105164267-105164289 CCAAAACTTACCAGACTGAATTA 0: 1
1: 0
2: 1
3: 32
4: 169
Right 1195464398 X:105164304-105164326 GAGAGTGACCAATGTGTTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 164
1195464396_1195464398 4 Left 1195464396 X:105164277-105164299 CCAGACTGAATTATGGTTAAATG 0: 1
1: 0
2: 0
3: 9
4: 193
Right 1195464398 X:105164304-105164326 GAGAGTGACCAATGTGTTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195464398 Original CRISPR GAGAGTGACCAATGTGTTGA GGG Intronic
901517385 1:9757820-9757842 GTGAGGGCCCAGTGTGTTGAGGG - Intronic
902761593 1:18584311-18584333 GAGAGTGAGCAATTTGAGGAAGG + Intergenic
905101626 1:35528552-35528574 GAGAATGTTCCATGTGTTGATGG + Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
905871221 1:41405644-41405666 GAGAGTGACAAGTGTGGGGAGGG + Intergenic
906841469 1:49144195-49144217 AAGTTTGACCAATGTGTTGCTGG + Intronic
909042018 1:70665863-70665885 GAGGGAGACAAATGAGTTGATGG + Intergenic
909316517 1:74226439-74226461 GAGAATGACCCAAGTGCTGAGGG - Intronic
909674278 1:78221812-78221834 AAGAGTGGCCAATGCTTTGAAGG + Intergenic
911180136 1:94853161-94853183 GGGAGTGACCAGTGGGTCGAAGG + Intronic
912258780 1:108087811-108087833 GAGAGTCAACAATGTGTTTATGG + Intergenic
914317686 1:146529762-146529784 GACAAGGACCAATGTGTGGAAGG - Intergenic
914496671 1:148203598-148203620 GACAAGGACCAATGTGTGGAAGG + Intergenic
915704857 1:157833940-157833962 GAGAGTTTCAAATGTGCTGATGG - Intronic
917605912 1:176629335-176629357 GTGAGTGACCACAGTGATGATGG + Intronic
917910340 1:179638095-179638117 GAGAGTGACTGATGTGATGCTGG + Intronic
918163731 1:181924862-181924884 GAGAGTGGCAAAAGTGTGGAGGG - Intergenic
919931837 1:202226093-202226115 GAGAGTGACCACTGTGGGCAGGG - Intronic
921672583 1:217942528-217942550 GAGAGTCATCAATGTGTAGATGG + Intergenic
922000406 1:221472133-221472155 GAGAGTGATTAATTTGTAGATGG + Intergenic
1064005654 10:11696920-11696942 GGGAGTGACCTGTGTGTGGATGG - Intergenic
1064879691 10:20036823-20036845 GAAATTCACAAATGTGTTGAAGG - Intronic
1068721525 10:60251463-60251485 GAGACTGACCCATGCATTGAAGG + Intronic
1069951677 10:72023197-72023219 GATAGAAACCAAAGTGTTGACGG + Intergenic
1071273598 10:84031511-84031533 GAGAGGGAACAATGGCTTGAGGG - Intergenic
1072054389 10:91740141-91740163 TAGAGGGACCAATGTGTTCCTGG + Intergenic
1073171788 10:101516455-101516477 GAGAGTAACCCATTTGTTAATGG + Intronic
1073637734 10:105216789-105216811 GAGTGTGATCATTGTGTTGCAGG + Intronic
1073973067 10:109066856-109066878 GAGAGTTACCAATGGGTGGGTGG - Intergenic
1075992621 10:126850545-126850567 GAGGATGACCAAGGTGTCGAGGG - Intergenic
1076510953 10:131013204-131013226 GAGAGTGAAAAATGTGTGCAGGG - Intergenic
1077642609 11:3895112-3895134 CAGAGTGACAAATGTATTGCTGG - Intronic
1077985913 11:7350905-7350927 GAGAGTGAGCAATGGGATCAGGG - Intronic
1080561493 11:33467414-33467436 GAGAGTGACCATTGGGCAGATGG + Intergenic
1090918300 11:131186310-131186332 GAAAGTGCCCACTGTTTTGAGGG - Intergenic
1092104386 12:5911078-5911100 GAGAGTGACCGATGGTCTGATGG - Intronic
1092927209 12:13282152-13282174 GAGTGTGAGCAATGTCATGAAGG - Intergenic
1093674858 12:21926751-21926773 CAGAGGGGCCAATGTGTTCAAGG + Intronic
1097670228 12:62527743-62527765 GAGAATGACCAAGGTGAAGATGG + Intronic
1097713135 12:62936385-62936407 GAGAGTGGCCCAGGTGTTGAAGG + Intergenic
1098245122 12:68508998-68509020 TAGAAAGACCAATGTGCTGACGG + Intergenic
1099967013 12:89458483-89458505 GAGGGTAACCAATGAGCTGATGG - Intronic
1102586063 12:113923799-113923821 TAGAGAGACCAATGTGCTGGTGG - Intronic
1102747785 12:115265091-115265113 GAGCATGACCAATGGGTAGATGG + Intergenic
1102868172 12:116390987-116391009 GAGAGTGACCATGGTGCTCATGG - Intergenic
1104082637 12:125444002-125444024 GGGAGTGACTACTGGGTTGAAGG + Intronic
1116339786 14:43707053-43707075 GAGAGTGACCATTATGGGGATGG + Intergenic
1118449075 14:65880915-65880937 GAGAGACACAAATGTGGTGATGG + Intergenic
1122281055 14:100622606-100622628 GTGAGAGACCACTGTGTCGAGGG + Intergenic
1122451708 14:101813896-101813918 CTGAGTCACCAATTTGTTGAAGG + Intronic
1123197535 14:106630845-106630867 GACAGTGATCAATGTGATCAAGG + Intergenic
1127028850 15:54838901-54838923 GAGAGTGAAGGATGTGCTGAAGG - Intergenic
1127705580 15:61544456-61544478 GAAAGAGACCAAAGTGTTAATGG + Intergenic
1129209793 15:74061225-74061247 GAGAATGATCCATGTGCTGAGGG - Intergenic
1129681206 15:77659434-77659456 AAGAGTGTCCATTGTGATGAGGG - Intronic
1130986011 15:88845247-88845269 GATATTGACCAATGAGCTGACGG - Intronic
1132869603 16:2109953-2109975 GAGGGTGACGCTTGTGTTGACGG + Exonic
1134717812 16:16365646-16365668 GAGGGTGACACTTGTGTTGACGG - Intergenic
1134853854 16:17503665-17503687 GGGACTGTCCAATGTCTTGAAGG + Intergenic
1134956938 16:18386513-18386535 GAGGGTGACGCTTGTGTTGACGG + Intergenic
1137523661 16:49214915-49214937 GAGAGAGAGAAAAGTGTTGAAGG - Intergenic
1140897780 16:79340265-79340287 AAGAGACACCAAAGTGTTGAAGG - Intergenic
1140953328 16:79839675-79839697 GGGGCTGACCTATGTGTTGAAGG + Intergenic
1144130117 17:12238591-12238613 GGGAGGGACCACTGTGTTGAAGG - Intergenic
1148197387 17:45724027-45724049 GAGAGTGAGGGGTGTGTTGAGGG - Intergenic
1149636716 17:58176963-58176985 GCGAGTGACCACTGAGGTGAAGG + Intergenic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1155400145 18:25429210-25429232 AAGAGTCTCCAATGTGTAGATGG + Intergenic
1156150599 18:34237224-34237246 TAGAATGACCTATGTGTTCATGG - Intergenic
1156254589 18:35383084-35383106 GACAATGACCAGTCTGTTGACGG + Intergenic
1157220269 18:45824593-45824615 GAGAGTGACCAAGAAGTTGAAGG + Intergenic
1164398924 19:27889505-27889527 GAGAGAGACAAATGGGTTGGGGG + Intergenic
1164941873 19:32257065-32257087 CAGAGTGACAAATGTGTAGGAGG - Intergenic
1165260750 19:34615314-34615336 GTGGGTGTCCAATATGTTGATGG + Intronic
1167310187 19:48733043-48733065 GAGAGTGAGTAATGTGTTATTGG - Intronic
1167960231 19:53099128-53099150 AAGAGTGTCCGATGTGGTGATGG + Intronic
1167964023 19:53128959-53128981 AAGAGTGTCCGATGTGGTGATGG + Intronic
1168683636 19:58334916-58334938 CAGAGTGAGCAATGTGGTCATGG - Exonic
925296981 2:2783759-2783781 GTGAGTGACCAGGGTTTTGAGGG + Intergenic
925723365 2:6849649-6849671 GAGAGGGACCTTTGTGATGACGG + Exonic
929133264 2:38599666-38599688 GTGAGTGATCATTATGTTGAAGG - Intronic
930607368 2:53506330-53506352 GATCGTGACCAAGGTGTTCAAGG + Intergenic
930972400 2:57411858-57411880 GAGAATGATCCATGTGCTGAGGG - Intergenic
931878666 2:66542753-66542775 TAGAGTGGCCAAGGTGGTGAGGG + Intronic
933502572 2:83133776-83133798 CAGAGTGACCATGGTGATGATGG + Intergenic
934110220 2:88735386-88735408 GAGAGGGAGCATTGTGTTCAGGG - Intronic
940048351 2:149434453-149434475 GGGAGTGAGAAATGTCTTGAAGG - Intronic
940333543 2:152501441-152501463 GAGAGCTCCCAATGGGTTGATGG + Intronic
940710389 2:157155602-157155624 GAGCATGACCAGTGTGTTTAGGG - Intergenic
941699768 2:168592176-168592198 GTGAGTGAACAATGTTTTTAAGG + Intronic
942343604 2:174977031-174977053 GACAGTGAACAATGTGTCTAAGG - Intronic
1172979372 20:38929321-38929343 GAGAGTGGACAGTGTGCTGATGG + Intronic
1173127199 20:40349017-40349039 GAGAATGATCCATGTGCTGAGGG - Intergenic
1174669503 20:52293108-52293130 GATAGTGACGAAGGTGATGATGG - Intergenic
1175011133 20:55737634-55737656 AAGATTAACCAATGTGCTGAAGG + Intergenic
1175560943 20:59930127-59930149 GAGAATGAATAATGTGTTCATGG - Intronic
1177062379 21:16392054-16392076 GAGAGTGAGCAAAGTGTGGTGGG + Intergenic
1177834572 21:26173940-26173962 GAGAATGGCCAAGGTGTGGAAGG - Intergenic
1184978917 22:48082212-48082234 TAGAATTACCCATGTGTTGAAGG - Intergenic
949341730 3:3038003-3038025 TAGAGAGGCCAGTGTGTTGAAGG + Intronic
951008056 3:17642210-17642232 GAGGGTGACCATTGTGTTCTGGG + Intronic
951621196 3:24603709-24603731 GAGAGTGAGGAATTTGTAGAAGG - Intergenic
953536101 3:43778041-43778063 GAGAGTGACCAAGGTGGTAATGG + Intergenic
953546741 3:43869086-43869108 GAGAGTGACAAAGGTTGTGAGGG + Intergenic
953664340 3:44915407-44915429 CAGAGAGACCACTGTGTTGCTGG + Intronic
953863065 3:46561752-46561774 TAGAGTCTCCAATGTGTAGATGG + Intronic
955587658 3:60499083-60499105 ATGAGTGACCAAGGAGTTGAAGG + Intronic
958827112 3:99043643-99043665 GAGAATGTTCAATGTGCTGATGG - Intergenic
962236375 3:133710850-133710872 CAGAGTGATCAAAGTGTTGTTGG + Intergenic
967112596 3:186307383-186307405 GAGAGTGCACAATATGTTCAGGG - Intronic
967625731 3:191681625-191681647 GAGAGTGAGCAAGGCATTGAAGG - Intergenic
969910754 4:10443445-10443467 AGAAGTGACCAATGTGATGAAGG - Exonic
975414553 4:74091957-74091979 GAGAGAGTCCAATTTGTTGAGGG - Intergenic
975509675 4:75180703-75180725 GTGAGTGCCCAATGTGTGAAAGG + Intergenic
975735372 4:77375537-77375559 GAGACTAACCCATGAGTTGAGGG - Intronic
975763775 4:77644778-77644800 GAGAATGATCCATGTGCTGAGGG - Intergenic
976523660 4:86060055-86060077 CAGATAGACCATTGTGTTGAAGG - Intronic
978013692 4:103719247-103719269 GAAATTGACCAACGTGTTGAAGG + Exonic
978062197 4:104351997-104352019 GAAAGTGACCCATGAGTTGAGGG + Intergenic
978303351 4:107294656-107294678 GGGAGGGACCAATGTGTAAAAGG + Intergenic
979321765 4:119332908-119332930 GAGAGTGAGAAATGTGGGGATGG - Intergenic
979943100 4:126787820-126787842 TAGAGTGACCCATGTGGTAATGG + Intergenic
980208821 4:129758276-129758298 GAGAGGGACAAAGGAGTTGATGG - Intergenic
981474248 4:145172265-145172287 GGTAGTGACCAGTGTGTAGAAGG + Intronic
983219393 4:165030383-165030405 GAGTCTGACCAATGGGATGAAGG - Intergenic
985545251 5:505812-505834 GAGAGTGACCATTGTGGGGGTGG + Intronic
990184013 5:53193197-53193219 GTGAGTGACCCATGTCCTGAAGG - Intergenic
991614464 5:68481687-68481709 GTGAGTGTCCAATGTCTTAAAGG - Intergenic
993193243 5:84704771-84704793 CAGAATGATCCATGTGTTGAGGG - Intergenic
995430498 5:112069756-112069778 AAAAGTAACCCATGTGTTGAGGG + Intergenic
996118056 5:119640367-119640389 GAGAGGGAGAAAAGTGTTGAGGG - Intergenic
996330982 5:122328667-122328689 GAGAAAGATCAATGTGTTAACGG - Intronic
996945182 5:129058052-129058074 GAGAATGATCCATGTGCTGAGGG - Intergenic
999884962 5:155911958-155911980 TAGAGTGGGCAATGTGGTGAAGG - Intronic
1000444405 5:161302162-161302184 CAGACTGACCCATGTGATGATGG + Intronic
1001304203 5:170559901-170559923 GAGAGTGAGAAATGTGGTCAAGG - Intronic
1003100373 6:3172041-3172063 GGGAGTGACCAACGTGTAGGGGG - Intergenic
1003253725 6:4456406-4456428 GACAGTGATCAACGTGTTGCTGG - Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1007227185 6:40323260-40323282 GAGAATGATCCATGTGTTAATGG + Intergenic
1011827941 6:91332420-91332442 GGGCATGACCAATATGTTGAGGG + Intergenic
1012485591 6:99718793-99718815 GAGAATGATCCATGTGCTGAGGG + Intergenic
1014640217 6:123900022-123900044 GAGAGGGACCATTGGGTTGAGGG - Intronic
1019138091 6:169924326-169924348 GACAGTGATGAATGTGATGATGG - Intergenic
1021290053 7:18832140-18832162 GAGACTGACCATTGTGTTTAGGG + Intronic
1025971819 7:66333901-66333923 GATAGTGACAAATGAGTTTAGGG - Intronic
1026539850 7:71270162-71270184 GAGATTGAGAAACGTGTTGAAGG + Intronic
1029949409 7:104567311-104567333 GAGAATGACCAATGTATCTAGGG - Intronic
1030487101 7:110183105-110183127 GAGTGTGAGCAATCTTTTGAGGG - Intergenic
1031427101 7:121618268-121618290 GAAAGTGACCAGTGTGATGAGGG + Intergenic
1034211957 7:149371739-149371761 GAGAGTGACTACTGTGCTAAGGG + Intergenic
1035310748 7:157966837-157966859 GATAGTGACCATTGTGATGATGG - Intronic
1037757158 8:21718507-21718529 GGGAGTGCCCACTGTGTTGCAGG - Intronic
1037758370 8:21726066-21726088 GAGATAGACCACTGTTTTGAGGG - Intronic
1039557067 8:38484215-38484237 GAGAATCACCAATGTGTTTCAGG - Intergenic
1041393931 8:57373133-57373155 GAGAGGGATGAGTGTGTTGAGGG + Intergenic
1043472150 8:80573663-80573685 GAGAGTGACCATTGGTTAGAAGG - Intergenic
1044635208 8:94317365-94317387 GAGAGTAATCCATGTGCTGAGGG - Intergenic
1045598728 8:103689290-103689312 GAGAATGATCCATGTGCTGAGGG + Intronic
1047126337 8:121965291-121965313 GAAAGAAACCAATGTGTTTAAGG - Intergenic
1048026727 8:130593814-130593836 GAGAGTGTCCCGTGTGTTGCAGG + Intergenic
1048830359 8:138470779-138470801 TAGTGTGACCAGTGTCTTGAGGG - Intronic
1050751082 9:8938142-8938164 CAGGGTAACCAATTTGTTGATGG + Intronic
1051965773 9:22827753-22827775 GAGAATGAGCCATGTGCTGAGGG + Intergenic
1052021170 9:23527149-23527171 GAAAGTGACCAATTTGCTGAAGG + Intergenic
1052710156 9:32044347-32044369 GAGAGTTATAAATGTGTTTAGGG + Intergenic
1055020354 9:71662904-71662926 GGGAGAGACCAAGGTGTTTAAGG + Intergenic
1061772945 9:132941073-132941095 GAGAGTGACCTGTGAGTTGTAGG + Intronic
1186899161 X:14034584-14034606 GAGAATAATCCATGTGTTGAGGG - Intergenic
1188385535 X:29553035-29553057 AAGTGTGATTAATGTGTTGATGG - Intronic
1189100678 X:38186226-38186248 TGGAGTGGCCCATGTGTTGAGGG + Intronic
1190964976 X:55291013-55291035 GAGAATGATCCATGTGCTGAGGG + Intergenic
1192938571 X:75887902-75887924 GGGAGGGGCCACTGTGTTGAAGG + Intergenic
1193624347 X:83797835-83797857 GAGACTATTCAATGTGTTGATGG - Intergenic
1193905675 X:87241176-87241198 GTGAATGATCAATGTGCTGAGGG + Intergenic
1194601174 X:95923631-95923653 GAGAGTGCCCAAAGTGTGTAAGG + Intergenic
1195464398 X:105164304-105164326 GAGAGTGACCAATGTGTTGAGGG + Intronic
1196000794 X:110783405-110783427 GTGATTGTCCAATGTGTTCATGG - Intronic
1196243307 X:113368796-113368818 GAGAGTGACCAGTGTGATTAGGG - Intergenic
1197284404 X:124579135-124579157 AAGAGTAACCAATATGTTAAGGG - Intronic