ID: 1195466649

View in Genome Browser
Species Human (GRCh38)
Location X:105186513-105186535
Sequence GAAGTCAGCCTGTCTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195466640_1195466649 28 Left 1195466640 X:105186462-105186484 CCCACAGCATAACTGCTTTCTGA 0: 1
1: 0
2: 1
3: 19
4: 239
Right 1195466649 X:105186513-105186535 GAAGTCAGCCTGTCTAGAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 125
1195466641_1195466649 27 Left 1195466641 X:105186463-105186485 CCACAGCATAACTGCTTTCTGAC 0: 1
1: 0
2: 2
3: 18
4: 181
Right 1195466649 X:105186513-105186535 GAAGTCAGCCTGTCTAGAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195466649 Original CRISPR GAAGTCAGCCTGTCTAGAGC AGG Intronic
900913489 1:5618546-5618568 GGGGTGAGCCTGTCCAGAGCAGG + Intergenic
903653445 1:24934671-24934693 GAGGTCAGCCAGGCTAGAGAGGG + Intronic
905641675 1:39594365-39594387 GAAGGAAGGCTTTCTAGAGCAGG - Intergenic
905915220 1:41679727-41679749 GAATTCAGCCTGCCCAGACCTGG + Intronic
906524160 1:46484968-46484990 GCAGTCAGCCTGCCTAGACGTGG + Intergenic
907158783 1:52356699-52356721 GAAGGCAGCCTTTCCAGAACAGG + Intronic
907854185 1:58285238-58285260 GAAGGCATCCTGTCTTGTGCTGG - Intronic
908392182 1:63693585-63693607 GATGGAAGGCTGTCTAGAGCAGG + Intergenic
910014971 1:82510867-82510889 GAAGTCACCCAGACTAGAGTTGG - Intergenic
914350115 1:146833196-146833218 GAGGTAGGCCTGTCTGGAGCTGG - Intergenic
916389965 1:164320873-164320895 GAAGCCCGCCTGTCGAGAGGGGG + Intergenic
918298288 1:183178633-183178655 GAACTCAGCTTTTCTAGGGCTGG - Intergenic
919771795 1:201165870-201165892 GAAGTTAGACTGTCAGGAGCAGG + Intronic
920728425 1:208459837-208459859 GAAGTCTCCCTCTCTAGAGTCGG - Intergenic
922180794 1:223231293-223231315 GTGGACAGCCTGTCTAGATCTGG + Intronic
1068941996 10:62689513-62689535 GAGGGCAGCCTGGCCAGAGCAGG + Intergenic
1069097825 10:64281341-64281363 GAAGACAGCCTTTGCAGAGCAGG - Intergenic
1073035243 10:100560299-100560321 GAAGACAGCCTGGCTGGAGGGGG - Intergenic
1074589741 10:114801489-114801511 GGAGTCAGCATGTCTATAGGTGG - Intergenic
1075991328 10:126841304-126841326 GGCCCCAGCCTGTCTAGAGCAGG + Intergenic
1077741418 11:4849587-4849609 GAAGTCAGACTGTCTGGGGTTGG - Intronic
1079454765 11:20626765-20626787 GGAGTCACCCTGCCTGGAGCTGG + Exonic
1079518631 11:21298577-21298599 TTAGTCAGCCTTCCTAGAGCAGG + Intronic
1081657638 11:44868046-44868068 GAAGCCAGCCTGTCACCAGCTGG - Intronic
1085105526 11:73839215-73839237 AAGGTCAACCTGTCAAGAGCAGG - Intronic
1087005513 11:93467014-93467036 GAAGTCTGTCTGTCTCCAGCTGG - Intergenic
1089834092 11:121354921-121354943 GAAGTCAGCATCTCTTGAGCTGG - Intergenic
1097916241 12:65023109-65023131 GAAGTCAGACTGCCTAGATTAGG + Intergenic
1101157103 12:101938259-101938281 TAAATTAGCCTGTCTAGAGTAGG - Intronic
1102559996 12:113755033-113755055 CTAGTCAGCCTCTCTAGTGCTGG + Intergenic
1102877489 12:116459222-116459244 GAGGTCTGCGTGTCTAGATCTGG - Intergenic
1104328315 12:127820841-127820863 GAAGTCAGCCAGTCTGAGGCTGG - Intergenic
1106356471 13:28988017-28988039 GAAGTCAGAATGTCTGGAGGAGG + Intronic
1106514008 13:30437364-30437386 GAAGCCAGCCTAGCCAGAGCTGG + Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1109759069 13:66803131-66803153 GATGTCAGCCTCTCTAGAGGGGG + Intronic
1117069319 14:52042380-52042402 GACGTCATCCTGGCTAGAGATGG + Intronic
1124927421 15:34084315-34084337 GTAGTCAGGCCGTCCAGAGCTGG - Exonic
1125560153 15:40624654-40624676 GAAGTAATACTGTCTAAAGCTGG + Exonic
1127579095 15:60320754-60320776 GAAGTCAGCCTGGCTGGAACAGG - Intergenic
1132463077 16:64949-64971 GAAGCCACCCTGGCTAAAGCTGG - Exonic
1137916039 16:52431260-52431282 AAAGTCAGGCTGTCTTGAGTAGG - Intergenic
1138542977 16:57699601-57699623 GAGGTCAGCCTGTCCAGGGAAGG - Intronic
1139983925 16:70882335-70882357 GAGGTAGGCCTGTCTGGAGCTGG + Intronic
1140880721 16:79195666-79195688 TAAGCCAGCTTGTCTAGACCGGG + Intronic
1142735811 17:1898655-1898677 GAAGTCATCCCGTCTAGGGCTGG - Exonic
1143010013 17:3861087-3861109 GCAGTCAGCCTGCTCAGAGCGGG - Intronic
1144058367 17:11560451-11560473 GAAGTGAGTCTGAATAGAGCAGG + Exonic
1145056480 17:19706906-19706928 GAATGCAGCTGGTCTAGAGCTGG + Intronic
1146012004 17:29203111-29203133 GACATCAGACTTTCTAGAGCTGG + Intergenic
1146130255 17:30267054-30267076 GCAGGCTGCCTGTATAGAGCAGG - Intronic
1146130257 17:30267072-30267094 GCAGGCTGCCTGTATAGAGCAGG - Intronic
1147457836 17:40549544-40549566 GAACTGAGCCAGTCCAGAGCTGG + Intergenic
1148384261 17:47222926-47222948 GAAGTCAGGCAGTGTAGAGAAGG + Intronic
1149602801 17:57904149-57904171 GAAGGCAGTCTTCCTAGAGCTGG - Intronic
1150820232 17:68428787-68428809 AAAGACAGCCTTTCGAGAGCTGG - Intronic
1151425857 17:74030660-74030682 GCAGTCACCCTGCCTTGAGCAGG - Intergenic
1153208688 18:2734544-2734566 GAAGTCAGCCTGAACTGAGCTGG + Intronic
1159053898 18:63446494-63446516 GAGGTCTGCCTGCCTGGAGCTGG + Intergenic
1161727150 19:5936156-5936178 GAAGGCAGCCTGGCTGGAGCTGG + Intronic
1162252516 19:9457789-9457811 TAAGTCAGAATGCCTAGAGCAGG - Intergenic
1162998447 19:14351030-14351052 GAAGTCTTCCTGCCTTGAGCTGG - Intergenic
1166688123 19:44808260-44808282 GGAGTCAGACTGGCCAGAGCAGG - Intergenic
1168113403 19:54207684-54207706 GAAGGCTGCATGTTTAGAGCAGG - Intronic
926447326 2:12959121-12959143 CAACTTAGCCTCTCTAGAGCAGG - Intergenic
931695561 2:64868107-64868129 AAAGCATGCCTGTCTAGAGCTGG + Intergenic
934524761 2:95044845-95044867 GAAGTCAGTGTGTGGAGAGCTGG - Intronic
936445517 2:112591529-112591551 GAGGTCAGCTTGTCCAGAGTAGG + Intergenic
937105876 2:119312202-119312224 GAAGTCGGACTGGCCAGAGCTGG - Intronic
941139068 2:161754926-161754948 GAATTTAGCCTGTCAAAAGCAGG + Intronic
942714367 2:178874667-178874689 GGAGTCAGCCTCTCTAGTTCCGG - Intronic
944711417 2:202338081-202338103 GAAGTCATCCTGTGTATAGTAGG - Intergenic
947587046 2:231362806-231362828 GAAGTCAGCCTGACAAGAGATGG - Intronic
1170549983 20:17468460-17468482 GTAGGCTGCCTGTCTACAGCAGG - Intronic
1172492014 20:35346922-35346944 GAAGTCATCCTGTATGGAGATGG - Intronic
1172841427 20:37904596-37904618 GCTGTCAGCCTGTCTAGTGAAGG - Intronic
1173016037 20:39226547-39226569 GAATTCAGCTTTTCTAGCGCGGG + Intergenic
1174179253 20:48664731-48664753 GAATTCAGGCCGTCTGGAGCTGG - Intronic
1174179264 20:48664787-48664809 GAATTCAGGCCGTCTGGAGCCGG - Intronic
1174179270 20:48664815-48664837 GAATTCAGGCCGTCTGGAGCCGG - Intronic
1174179276 20:48664843-48664865 GAATTCAGGCCGTCTGGAGCCGG - Intronic
1174179282 20:48664871-48664893 GAATTCAGGCCGTCTGGAGCCGG - Intronic
1174179326 20:48665093-48665115 GAATTCAGGCCGTCTGGAGCCGG - Intronic
1174179369 20:48665286-48665308 GAATTCAGGCCGTCTGGAGCCGG - Intronic
1179528385 21:41999828-41999850 GAAGTAAGACCGTCTAGGGCTGG + Intronic
1179992920 21:44957948-44957970 GAAGCCTGTCTGCCTAGAGCGGG + Intronic
1180174037 21:46078903-46078925 CAAGTCAGCCTGTCCTGGGCAGG + Intergenic
1181915154 22:26273904-26273926 GAAGTCAGCAGGTGTAGACCTGG + Intronic
1182552169 22:31106412-31106434 GAGGTCTGCCTGTGTAGAGTAGG - Intronic
1184426318 22:44411129-44411151 AGGGTCTGCCTGTCTAGAGCAGG + Intergenic
950767590 3:15284733-15284755 GAAGTCACTTTGTCTAGAGTGGG - Intronic
950896479 3:16456232-16456254 TAAGGCAGCCTGTCGAGTGCCGG - Intronic
954937065 3:54336193-54336215 GAAGTCAGGCTGTGCAGAGCAGG - Intronic
955665207 3:61342945-61342967 GCAGTCAGCCTGTCTACACTTGG - Intergenic
956146534 3:66196270-66196292 GAAGTCAGCATGACCAGGGCTGG - Intronic
956208025 3:66774005-66774027 GAAGGCAGCCTGTCCAGAGTGGG - Intergenic
959558726 3:107754294-107754316 GAATTCAGCATGTCTAGAAAAGG + Intronic
962273902 3:133998061-133998083 GGAGCCTGCCTGTATAGAGCAGG - Intronic
967900530 3:194446425-194446447 GATGGCATCCTGTCTAGGGCTGG + Intronic
978623977 4:110663936-110663958 GAAGTCAACTTGTAAAGAGCTGG + Intergenic
979297782 4:119052653-119052675 GAAGGCAGCCTTTCTGAAGCAGG + Intronic
982264997 4:153530332-153530354 TAATGCAGCCTGTCTAGATCAGG - Intronic
986700852 5:10407033-10407055 GAAGTCTGCCTGTCTTGCACAGG + Intronic
989172550 5:38487112-38487134 GAAGGCATCCAGTCTAGTGCAGG - Intronic
996595111 5:125191776-125191798 GAATTCACCATATCTAGAGCTGG - Intergenic
998692504 5:144602519-144602541 GGAGTCAAACTGTCTAGATCTGG + Intergenic
1000406333 5:160892283-160892305 CAAGTCAGCATGGCTGGAGCAGG - Intergenic
1000750402 5:165088565-165088587 TGAGTCAGCCTGTCTAAAGTTGG - Intergenic
1000803540 5:165759204-165759226 GAAGTCAGTCTGTTTTGAGCAGG + Intergenic
1005086283 6:22010208-22010230 GATGGCAGCCTGTCCAGAGATGG - Intergenic
1005196297 6:23288035-23288057 GAAGTCAGTCTGTCAAAACCAGG + Intergenic
1005436397 6:25816502-25816524 GAAGACAGCCTAGCTAGAGAGGG + Intronic
1013952740 6:115804453-115804475 GAAGTCAGTCTATTCAGAGCAGG - Intergenic
1021248987 7:18300303-18300325 AAAGTCAGTATATCTAGAGCAGG - Intronic
1022215657 7:28258286-28258308 GAAGTCAGCCTTTCTGGGGAAGG + Intergenic
1023353925 7:39348583-39348605 GAAGTCAGACAGACTAGATCTGG - Intronic
1027470596 7:78568895-78568917 GAAGTCAGGCTGCCTGGAGCAGG - Intronic
1030657369 7:112183097-112183119 GAAGGCAGCCTCTCTACAGACGG + Intronic
1033551033 7:142448154-142448176 AAAGTTAACCTGTCAAGAGCTGG - Intergenic
1035061348 7:156071794-156071816 GAAGTCAGCCTGTCAATCCCAGG - Intergenic
1035391677 7:158508539-158508561 GAAGGCAGCCTGTGGGGAGCTGG + Intronic
1035774980 8:2181302-2181324 GAAGGCAGCCAGCCTAGAGAAGG - Intergenic
1041136648 8:54766173-54766195 TAAGTCAGCCTGTCTACAAATGG + Intergenic
1041767220 8:61431755-61431777 GGAGTCTACCTGGCTAGAGCAGG + Intronic
1051344885 9:16143003-16143025 GAAGTCACCCTGCCATGAGCTGG - Intergenic
1055813753 9:80181382-80181404 GAAGACAGCCAGTCTAAGGCTGG - Intergenic
1056891724 9:90500553-90500575 GAAGTCAGCCTGCCTAGGCTTGG + Intergenic
1058816648 9:108689548-108689570 GGAGTCAGGCTGTGTAAAGCCGG + Intergenic
1060245355 9:121941455-121941477 AAAGTCAACCTGTCTAAAACTGG + Intronic
1060971805 9:127742671-127742693 GAAATCAGCCTGTTTAGAGCGGG + Intronic
1061601635 9:131674416-131674438 GCAGTCAGCCTGACTTGAGAAGG + Intronic
1062013487 9:134279813-134279835 GAGCTCAGCCTGGCTGGAGCTGG - Intergenic
1062211946 9:135369766-135369788 GAAATCATTCTGTCTAGGGCTGG - Intergenic
1062311609 9:135940938-135940960 GAAGTCAGCCTGGGTGGTGCTGG - Intronic
1188337377 X:28953620-28953642 GAAGTGAGGCTGTCCAGAGGTGG + Intronic
1195466649 X:105186513-105186535 GAAGTCAGCCTGTCTAGAGCAGG + Intronic
1198389612 X:136161082-136161104 GAACCCAGCCTGTCTATATCTGG - Intronic