ID: 1195468901

View in Genome Browser
Species Human (GRCh38)
Location X:105211350-105211372
Sequence GCCAGCACCAGCTCCAGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195468901_1195468903 1 Left 1195468901 X:105211350-105211372 CCTCGCCTGGAGCTGGTGCTGGC No data
Right 1195468903 X:105211374-105211396 TCCTCTGTATGTAGCCCTGAAGG No data
1195468901_1195468905 12 Left 1195468901 X:105211350-105211372 CCTCGCCTGGAGCTGGTGCTGGC No data
Right 1195468905 X:105211385-105211407 TAGCCCTGAAGGATTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195468901 Original CRISPR GCCAGCACCAGCTCCAGGCG AGG (reversed) Intronic