ID: 1195468905

View in Genome Browser
Species Human (GRCh38)
Location X:105211385-105211407
Sequence TAGCCCTGAAGGATTCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195468902_1195468905 7 Left 1195468902 X:105211355-105211377 CCTGGAGCTGGTGCTGGCATCCT No data
Right 1195468905 X:105211385-105211407 TAGCCCTGAAGGATTCCCTCAGG No data
1195468901_1195468905 12 Left 1195468901 X:105211350-105211372 CCTCGCCTGGAGCTGGTGCTGGC No data
Right 1195468905 X:105211385-105211407 TAGCCCTGAAGGATTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195468905 Original CRISPR TAGCCCTGAAGGATTCCCTC AGG Intronic