ID: 1195470133

View in Genome Browser
Species Human (GRCh38)
Location X:105220707-105220729
Sequence CCCAGAGTAAAAGCCGACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195470133_1195470140 14 Left 1195470133 X:105220707-105220729 CCAACGTCGGCTTTTACTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1195470140 X:105220744-105220766 CAGAGATACCAGGAGTGGAAGGG 0: 1
1: 0
2: 1
3: 20
4: 311
1195470133_1195470143 29 Left 1195470133 X:105220707-105220729 CCAACGTCGGCTTTTACTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1195470143 X:105220759-105220781 TGGAAGGGAGTGAGTGAGGAAGG 0: 1
1: 3
2: 54
3: 903
4: 7064
1195470133_1195470139 13 Left 1195470133 X:105220707-105220729 CCAACGTCGGCTTTTACTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1195470139 X:105220743-105220765 CCAGAGATACCAGGAGTGGAAGG 0: 1
1: 0
2: 2
3: 19
4: 345
1195470133_1195470142 25 Left 1195470133 X:105220707-105220729 CCAACGTCGGCTTTTACTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1195470142 X:105220755-105220777 GGAGTGGAAGGGAGTGAGTGAGG 0: 1
1: 0
2: 14
3: 154
4: 1684
1195470133_1195470135 4 Left 1195470133 X:105220707-105220729 CCAACGTCGGCTTTTACTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1195470135 X:105220734-105220756 TTCCAATTTCCAGAGATACCAGG 0: 1
1: 0
2: 1
3: 39
4: 311
1195470133_1195470137 9 Left 1195470133 X:105220707-105220729 CCAACGTCGGCTTTTACTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1195470137 X:105220739-105220761 ATTTCCAGAGATACCAGGAGTGG 0: 1
1: 0
2: 0
3: 23
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195470133 Original CRISPR CCCAGAGTAAAAGCCGACGT TGG (reversed) Intronic
904943455 1:34181438-34181460 CACAGAGTGAAAGTCGACTTGGG - Intronic
911359659 1:96861721-96861743 CCCAGAATCAAAGCCAAAGTAGG - Intergenic
920971229 1:210745252-210745274 CCATGAGTAAAAGCCAATGTAGG + Intronic
922196358 1:223363641-223363663 CACTGAGTAACAGCCGCCGTGGG + Exonic
1074381786 10:112986798-112986820 CCCAGAGAAAAAGGAGACGGAGG - Intronic
1084521349 11:69664941-69664963 CCCAGTGTAAAAGCTGAGGATGG + Intronic
1085052412 11:73386656-73386678 CCCAGACTCAAAGCCAACGAGGG - Intronic
1086407157 11:86508187-86508209 CCAAGAGTAAAAGCCTATGATGG - Intronic
1100464535 12:94833633-94833655 CCCAGAGAGAACGCCGCCGTGGG + Intergenic
1107679090 13:42829423-42829445 CCCAGAGTTAAAGCCAAAATAGG + Intergenic
1125909091 15:43420459-43420481 CCCAGAGTAAAAGTAGCCATTGG + Exonic
1129264852 15:74388043-74388065 CCCAGCGGAAAGGCCCACGTGGG - Intergenic
1132153380 15:99477895-99477917 ACCAGAGTCTAAGCCCACGTGGG + Intergenic
1132596345 16:752231-752253 ACCAGAGAAACAGCCAACGTGGG - Intronic
1134608229 16:15587610-15587632 CCCAGAGTAGATGCTGACCTGGG + Exonic
1138309357 16:56009966-56009988 CCCAGAGTATTAGCTGACCTGGG + Intergenic
1144865772 17:18334801-18334823 CCCAGAGTTAAAGCAGCTGTGGG + Intronic
1151961704 17:77409149-77409171 CCCAAAGTAAAAGGGGACCTGGG - Intronic
1159740031 18:72155937-72155959 CTCAGAGTAAAAGTAGATGTGGG - Intergenic
1167232713 19:48295576-48295598 CACAGAGAAAAAGCTGACTTTGG - Intergenic
934615339 2:95767228-95767250 TCCAGAGTAAAAGGGGACATGGG + Intergenic
934645567 2:96057331-96057353 TCCAGAGTAAAAGGGGACATGGG - Intergenic
934838971 2:97613420-97613442 TCCAGAGTAAAAGGGGACATGGG - Intergenic
941106450 2:161359775-161359797 CCCAGAATAAAAGTAGACTTGGG + Intronic
1168884432 20:1236931-1236953 CCCAAAGGAAAAGCCAGCGTTGG - Intronic
1171191048 20:23159675-23159697 CCCAGAGGAAAAGCCAACAATGG - Intergenic
956670817 3:71687853-71687875 ACCAGAGTAAAAGCATACATTGG + Intronic
959587068 3:108034592-108034614 GCCAGAGGAAAAGCTGACGAAGG + Intergenic
968446404 4:654386-654408 CCCACAATCAGAGCCGACGTGGG - Intronic
971351708 4:25862230-25862252 CCGAGAGTAAGAGGCGAAGTTGG + Intronic
971947816 4:33304370-33304392 CCTAGAGTAAAAACAGAGGTTGG - Intergenic
977151523 4:93519160-93519182 ACCAGAGAAAAAGCCAACTTAGG - Intronic
981216634 4:142177204-142177226 TCCATAATAAAAGCCAACGTTGG + Intronic
982720395 4:158854177-158854199 CACAAAGTAAAAGCCTACATGGG - Intronic
994148358 5:96420248-96420270 CCCAGAGTAAAGGGTGACCTTGG - Intronic
996381179 5:122863853-122863875 CCCAAAGTAAAAGCCAACATGGG - Intronic
996381190 5:122863922-122863944 CCCAAAGTAAAAGCCAACATGGG - Intronic
1002938158 6:1692040-1692062 GCCAGTGTAAAAGCAGACATGGG + Intronic
1005182205 6:23118612-23118634 CCCAGAGAACAAGCAGAAGTAGG + Intergenic
1008941217 6:57047424-57047446 CCCAGAGTAAAAGACTATGGTGG + Intronic
1008945406 6:57090922-57090944 CCCAGAGTAAAAGACTATGGTGG + Intronic
1011455587 6:87545083-87545105 CCCAGAGTAAGACCTGATGTAGG - Intronic
1016660244 6:146569921-146569943 CTCAGAGTAGAAGCCTACATTGG + Intergenic
1032784536 7:135190109-135190131 CCCATAGTGAAAGCCGGCTTTGG - Intronic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1051198091 9:14586030-14586052 CACAGAGTAAAAGGCCACCTTGG + Intergenic
1055295317 9:74827412-74827434 CACAGAGTAGAGGCCGAAGTTGG - Intronic
1186788980 X:12978591-12978613 CACACAGCAAAAGCCCACGTGGG - Intergenic
1195470133 X:105220707-105220729 CCCAGAGTAAAAGCCGACGTTGG - Intronic