ID: 1195471253

View in Genome Browser
Species Human (GRCh38)
Location X:105232991-105233013
Sequence AAAAAGCTGAATAGTTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 737
Summary {0: 1, 1: 0, 2: 3, 3: 65, 4: 668}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195471248_1195471253 16 Left 1195471248 X:105232952-105232974 CCCAAAATTCAACACCTGGCACA 0: 1
1: 0
2: 1
3: 14
4: 224
Right 1195471253 X:105232991-105233013 AAAAAGCTGAATAGTTGGCCAGG 0: 1
1: 0
2: 3
3: 65
4: 668
1195471250_1195471253 2 Left 1195471250 X:105232966-105232988 CCTGGCACATCTTAGTGAGTACC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1195471253 X:105232991-105233013 AAAAAGCTGAATAGTTGGCCAGG 0: 1
1: 0
2: 3
3: 65
4: 668
1195471249_1195471253 15 Left 1195471249 X:105232953-105232975 CCAAAATTCAACACCTGGCACAT 0: 1
1: 0
2: 2
3: 18
4: 217
Right 1195471253 X:105232991-105233013 AAAAAGCTGAATAGTTGGCCAGG 0: 1
1: 0
2: 3
3: 65
4: 668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195471253 Original CRISPR AAAAAGCTGAATAGTTGGCC AGG Intronic
900293173 1:1933474-1933496 AAATACCTGAATAGTTGGGCCGG - Intronic
902667606 1:17950597-17950619 AAAAAAATGGATAGCTGGCCGGG - Intergenic
903119936 1:21209305-21209327 AAAAAGGTGGAGAGTTGGCCAGG - Intergenic
903521486 1:23954020-23954042 AAAAATCTAAAAAGTTAGCCAGG + Intergenic
903542174 1:24102683-24102705 AAAAAATTGAAAAGTTAGCCAGG + Intronic
904051485 1:27642169-27642191 AAAAAAATGAACAGTTAGCCGGG - Intergenic
905084073 1:35354427-35354449 TAAAAGTTGAATTGTTGGGCTGG + Intronic
905086179 1:35379529-35379551 AGAAAGCGCAACAGTTGGCCGGG - Intronic
905406832 1:37739367-37739389 AGAAAGTAGAATAGTAGGCCAGG + Intronic
905616542 1:39404642-39404664 AAAAAGTTAAAAAATTGGCCAGG - Intronic
906177687 1:43789709-43789731 AAAAAATTGAAAAGTTAGCCAGG + Intronic
906199808 1:43952463-43952485 AAAAAAATGAACAGTTGGCCAGG - Intronic
906328895 1:44868101-44868123 AGAAAGCTGTAGTGTTGGCCGGG + Intronic
906347105 1:45023261-45023283 AAAAAGATCAATAGTTGCCAGGG - Intronic
906578848 1:46917715-46917737 AAAAATCTGAATAGATAACCAGG - Intergenic
906750671 1:48256545-48256567 AAAAAGCTGAATAGAGGGCAGGG + Intergenic
907105009 1:51874784-51874806 AAAAAGCATAATAGGTGTCCTGG + Intronic
907151537 1:52293081-52293103 AAAAATATGATTAATTGGCCGGG + Intronic
907227845 1:52965938-52965960 ATAAAACTCAATAGCTGGCCAGG - Intronic
907296264 1:53457506-53457528 AAAAATATGATTAGTGGGCCGGG - Intergenic
908149023 1:61280651-61280673 AAAAAGCAGACTAGTTGGACAGG - Intronic
908233660 1:62130171-62130193 AAAAAGTTAAAAAGTTAGCCCGG + Intronic
908238852 1:62172268-62172290 GAAAATCTGAATATTGGGCCAGG - Intergenic
908545645 1:65159672-65159694 AAAAAGAAAAAAAGTTGGCCGGG + Intronic
908744582 1:67363194-67363216 AAAAATAAGAATAATTGGCCAGG - Intronic
909693819 1:78441420-78441442 AAAAAGCTCAAGAGCTAGCCAGG - Intronic
909755277 1:79218633-79218655 AAAAATATAAATAATTGGCCAGG + Intergenic
910755533 1:90686108-90686130 AAAAGACTTAAAAGTTGGCCGGG - Intergenic
911166476 1:94728987-94729009 AAATAACTAGATAGTTGGCCGGG - Intergenic
911652436 1:100404863-100404885 AAAAAACTAAATAGTAGGACTGG + Intronic
913094696 1:115505044-115505066 AAGAAGCTGCATAGTTGGGGAGG - Intergenic
913204566 1:116525212-116525234 AAAAAGATTAGTAGTTGGCAGGG - Intronic
913970603 1:143412829-143412851 AAAAAAAAGAAAAGTTGGCCGGG - Intergenic
914000133 1:143686911-143686933 AAATAGCTGAAAAGAAGGCCGGG + Intergenic
914064979 1:144238440-144238462 AAAAAAAAGAAAAGTTGGCCGGG - Intergenic
914114172 1:144727914-144727936 AAAAAAAAGAAAAGTTGGCCGGG + Intergenic
914312257 1:146477218-146477240 AAAAAGTTGAAGAATTAGCCAGG + Intergenic
914374337 1:147060431-147060453 AAATAGCTGAAAAGAGGGCCCGG - Intergenic
914502094 1:148256118-148256140 AAAAAGTTGAAGAATTAGCCAGG - Intergenic
914503679 1:148269810-148269832 AAAGAGCTGAAAAGAAGGCCGGG - Intergenic
915215182 1:154335529-154335551 AAAAAACTGAAAAATTAGCCAGG + Intronic
917604663 1:176614437-176614459 GAAAACCTGAAAAGTTGGCCAGG + Intronic
917954611 1:180081161-180081183 AAAAAGCAGTACAGTGGGCCGGG - Intronic
919891450 1:201978270-201978292 AAAAAGCAAAAAACTTGGCCGGG - Intergenic
921120638 1:212133723-212133745 AAAAAGCTTAACATTGGGCCAGG + Intergenic
921224724 1:213006931-213006953 AAAAAATTAAATAATTGGCCGGG + Intronic
921521364 1:216158392-216158414 AAAAAGCTGAAAAATTAGCTGGG - Intronic
922357563 1:224790827-224790849 AAAAAGCGCATTAGTTGGCCGGG + Intergenic
922487765 1:225989001-225989023 AAAATAATAAATAGTTGGCCGGG + Intronic
923180433 1:231513092-231513114 AAAAATCTTAAAAGTCGGCCAGG + Intergenic
923846887 1:237744358-237744380 AAAAAGCTTTTTAGGTGGCCAGG + Intronic
923887938 1:238179233-238179255 AACAATCTGCATAGTTGGCCAGG - Intergenic
924239247 1:242025383-242025405 AAAAAGATGAATAATAGGCTGGG - Intergenic
924883259 1:248186737-248186759 AGAAACCTGAATACTTGACCAGG - Intergenic
924885344 1:248209845-248209867 AGAAACCTGAATACTTGACCAGG - Intergenic
1063059658 10:2538154-2538176 AAAAAGAGAAATAATTGGCCAGG + Intergenic
1063608728 10:7545131-7545153 AAAAATGTAATTAGTTGGCCGGG + Intergenic
1063642540 10:7844669-7844691 AAAAAGAAGAAAAGCTGGCCAGG - Intronic
1064461418 10:15538215-15538237 AAAAAGTTCTATAGTTGGCCAGG + Intronic
1064472229 10:15647755-15647777 TAAAAACTGAATAATTGGCCGGG - Intronic
1064683298 10:17833358-17833380 AAAAAGTTAAAAAGTTAGCCAGG + Intronic
1065243632 10:23734582-23734604 AAAAAGTTTAAAACTTGGCCAGG - Intronic
1065595950 10:27311596-27311618 TAAAAACTTGATAGTTGGCCGGG + Intergenic
1065817847 10:29498255-29498277 AAAAAGATGAAAAATTAGCCAGG + Intronic
1066600962 10:37106751-37106773 AAAAAGCCGGATAGCAGGCCAGG + Intergenic
1067345071 10:45431865-45431887 AAATAACTTTATAGTTGGCCGGG - Intronic
1067485203 10:46642478-46642500 AAAAAGATGAAAAATTAGCCAGG - Intergenic
1067609555 10:47699185-47699207 AAAAAGATGAAAAATTAGCCAGG + Intergenic
1067781580 10:49211318-49211340 AAAAATCTTAATAATTGGCTGGG + Intergenic
1068655263 10:59567961-59567983 AAAAAGATCAGTAGTTGGCTAGG - Intergenic
1068764138 10:60744598-60744620 ACATAGCTGAATAGAAGGCCTGG + Intergenic
1068924020 10:62516161-62516183 AGAAAGGTGAAAAGATGGCCGGG - Intronic
1069424980 10:68280569-68280591 AAAAACATGAAAAGCTGGCCAGG + Intergenic
1069437128 10:68394922-68394944 AAAAATATGAAAAGTTGGCTAGG - Intronic
1069450950 10:68517534-68517556 AAAAAGGTGAATAACAGGCCAGG + Intronic
1069463521 10:68617317-68617339 AAAAAGTTTAAAAATTGGCCAGG - Intronic
1069497289 10:68917162-68917184 AAAAAACTCATTTGTTGGCCAGG + Intronic
1069550923 10:69363537-69363559 AAAAAGCTTAAAAATTAGCCAGG - Intronic
1069594303 10:69660688-69660710 TAAAAGCTGGATCTTTGGCCTGG + Intergenic
1070269178 10:74935596-74935618 AAAAAGATGTATTTTTGGCCAGG - Intronic
1070516952 10:77217001-77217023 CAAAAACTGAATTTTTGGCCAGG + Intronic
1070623496 10:78032168-78032190 AAAAAGAAAAATAGTCGGCCGGG + Intergenic
1071625145 10:87160828-87160850 AAAAAGATGAAAAATTAGCCAGG + Intronic
1071848340 10:89542720-89542742 AATTAGCTGTATAGTTGGGCGGG - Intronic
1072589760 10:96818686-96818708 AAAAAGTAAAATAGTTGGCCAGG - Intergenic
1073239829 10:102049714-102049736 AAAAATATGAAAAGTTAGCCAGG - Intronic
1073249243 10:102111688-102111710 AAATAATTGAAAAGTTGGCCGGG + Intronic
1073369524 10:102974692-102974714 AAAAATTTTAAAAGTTGGCCAGG - Intronic
1073963441 10:108960677-108960699 AAAAATCAGAATTTTTGGCCAGG + Intergenic
1075369493 10:121923302-121923324 AAAAAACTGAAAAATTAGCCAGG + Intronic
1075373139 10:121954647-121954669 AGAAAATTCAATAGTTGGCCAGG + Intergenic
1076988229 11:254624-254646 AAAAATGTAAATAGATGGCCAGG - Intergenic
1077002662 11:332187-332209 AAAAAGCTTTATTGCTGGCCAGG + Intergenic
1077879257 11:6335246-6335268 AAAAAACTGAAAAATTAGCCAGG - Intergenic
1078097009 11:8305071-8305093 AAAAAGCAAAACAGTTGGGCTGG + Intergenic
1078245188 11:9567833-9567855 AATAAACTGAACAATTGGCCAGG + Intergenic
1078673755 11:13389866-13389888 AAAAAGCTGTACAGCTGTCCAGG + Intronic
1078829400 11:14965187-14965209 AAAATGCTGAACAGTGTGCCTGG - Intronic
1079649356 11:22907664-22907686 AAAAAGCTGTATAGTTTGCATGG + Intergenic
1080623945 11:34011519-34011541 AAAAAGTTGAGTGCTTGGCCGGG - Intergenic
1080706402 11:34699112-34699134 AAAAATATGAAAAGTTAGCCAGG + Intergenic
1080809778 11:35691966-35691988 AAAAAGCAGAATAGTTGTATAGG + Intronic
1081259782 11:40945314-40945336 GAAAAACTGCAAAGTTGGCCCGG - Intronic
1081409899 11:42745620-42745642 AAAAAGGTGCACAGTCGGCCAGG + Intergenic
1082177483 11:49078010-49078032 TAAAAGATAAATATTTGGCCAGG - Intergenic
1083182190 11:60994143-60994165 AAAAGGCTGAATTTCTGGCCGGG + Intronic
1083458234 11:62793370-62793392 AAAAAACCTAATAGTTGGCTGGG - Intronic
1083484721 11:62976207-62976229 AAAAAGGACAATAGCTGGCCAGG - Intronic
1084115185 11:67039006-67039028 AAATAAATAAATAGTTGGCCAGG + Intronic
1084663777 11:70564417-70564439 AAAAATATGAAAAGTTGGCTGGG - Intronic
1085373145 11:76030541-76030563 AAAAAAGTAAATAGTGGGCCAGG - Intronic
1085487222 11:76875409-76875431 AAAAAAATGAAATGTTGGCCGGG - Intronic
1086543367 11:87939560-87939582 AAAGAGCAGCACAGTTGGCCAGG + Intergenic
1086688227 11:89757830-89757852 TAAAAGATAAATATTTGGCCAGG + Intergenic
1086781827 11:90916507-90916529 AAAAAACTAAATAATTAGCCAGG + Intergenic
1086905586 11:92414713-92414735 AAAAATCTGAAGAATAGGCCGGG + Intronic
1087163080 11:94969992-94970014 AAAGAGCTGAAGAGCAGGCCAGG - Exonic
1088311056 11:108461018-108461040 AAAAAGCAGACTTTTTGGCCGGG - Intronic
1089427891 11:118395030-118395052 AAAAAGATGAATTTTTGGCCAGG + Intronic
1089727358 11:120493968-120493990 AAAAAGTTTAAAAGTTAGCCAGG - Intergenic
1089964593 11:122645455-122645477 AAAAAGATGAAAAATTAGCCGGG - Intergenic
1090218733 11:124996124-124996146 TAAAAGGTGAAAAGATGGCCAGG - Intronic
1090328230 11:125907311-125907333 TAAAAGTTGAAGTGTTGGCCGGG + Intronic
1090933477 11:131320750-131320772 AAAAATATGAATACCTGGCCAGG - Intergenic
1091732964 12:2894598-2894620 AAAAAGCTCAATAATAGGCTAGG + Intronic
1092256968 12:6931736-6931758 AAAAAGAAAACTAGTTGGCCGGG + Intronic
1093036332 12:14335668-14335690 CAAAAGGGGAGTAGTTGGCCAGG - Intergenic
1093679557 12:21986052-21986074 AAAAACCTTAAAAGTTAGCCAGG - Intergenic
1095315741 12:40759197-40759219 TAAAACCTGAATACTTGACCAGG - Intronic
1095469988 12:42526362-42526384 AAAATGCTGAGGAGTTGGCGGGG + Intronic
1095505657 12:42895373-42895395 AAAAAACTCAATAGTTGGCTGGG - Intergenic
1095522999 12:43090370-43090392 GAAAAGCTGAATAGTTTTACAGG - Intergenic
1095925156 12:47570861-47570883 AAAAAGTACAAAAGTTGGCCAGG + Intergenic
1095972001 12:47908496-47908518 AACAAACTGAAAAGATGGCCTGG - Intronic
1096091866 12:48907392-48907414 GGGAAGCTGAGTAGTTGGCCAGG + Intronic
1096097349 12:48944852-48944874 AAATATCTAAATAGCTGGCCAGG + Intronic
1096265764 12:50121326-50121348 AAAAATTTGAAAAGTTAGCCAGG + Intergenic
1096291431 12:50346952-50346974 AAAAAGATGTATAATTGGCTTGG + Intronic
1096314948 12:50556368-50556390 AAAAAGATGAGGAGTCGGCCGGG - Intronic
1096829363 12:54302071-54302093 AAAAAGATGAATAAGTGGGCTGG - Intronic
1097001021 12:55876759-55876781 AAAAAATTAAAAAGTTGGCCAGG + Intergenic
1097037820 12:56135465-56135487 AAAATGCTGAATGTTGGGCCGGG - Intronic
1097643699 12:62211282-62211304 AAAAAGCAGAAAAATGGGCCAGG + Intronic
1097680577 12:62645429-62645451 AGACAGCTGAGTACTTGGCCTGG + Exonic
1097821344 12:64131879-64131901 CAAAAGGAGAGTAGTTGGCCAGG + Intronic
1098190737 12:67945725-67945747 AAGAAGCTGGATTTTTGGCCGGG - Intergenic
1098330230 12:69345136-69345158 AAAAATTTAAAAAGTTGGCCAGG + Intergenic
1098633481 12:72753148-72753170 AAAAAGCTGAATAGCTTAGCTGG + Intergenic
1100219609 12:92490369-92490391 AAAAATATGAATCTTTGGCCAGG + Intergenic
1100525712 12:95417765-95417787 AAGAAAGTGATTAGTTGGCCGGG + Intergenic
1101747753 12:107556713-107556735 TAAAAGTGGAATAGTGGGCCGGG + Intronic
1101942194 12:109107818-109107840 CAAAAATGGAATAGTTGGCCGGG - Intronic
1102117285 12:110412389-110412411 AAAAATTGGAATACTTGGCCAGG - Intergenic
1102667385 12:114586881-114586903 AAAAAGATGAAAACTTAGCCAGG + Intergenic
1103043922 12:117719489-117719511 CAAGACCTGAATTGTTGGCCAGG - Intronic
1103818614 12:123679090-123679112 AGAAAGCTGAATTATCGGCCAGG - Intronic
1104482608 12:129121390-129121412 AATCAGCTGACTAGTGGGCCAGG - Intronic
1104886566 12:132112906-132112928 AAAAAGCTGAAAATTTAGCTGGG - Intronic
1106001716 13:25729725-25729747 AAAAAGCTGAAATGTTGATCAGG + Intronic
1107571302 13:41661157-41661179 AGAAAACTGAATTCTTGGCCAGG - Intronic
1107586601 13:41856038-41856060 AAAAATCTTACTTGTTGGCCAGG + Intronic
1107901730 13:45022878-45022900 AAAAAGGTGAAAAATTAGCCAGG + Intronic
1108315281 13:49230870-49230892 AAAAAACTAAAAAGTTAGCCAGG + Intergenic
1108397958 13:50008199-50008221 TAAAAAGTGAATACTTGGCCGGG - Intronic
1108646263 13:52432055-52432077 AAAAACCTAATTAGTTGGCTGGG + Intronic
1108820665 13:54345784-54345806 TAAAAGTTTAATAATTGGCCGGG - Intergenic
1109308475 13:60664688-60664710 AAAAAGATCAATAGTTGTCAGGG - Intergenic
1109437838 13:62329827-62329849 AAAAACCCTAATAGTTGGCTGGG - Intergenic
1109437892 13:62330161-62330183 AAAAATACTAATAGTTGGCCGGG - Intergenic
1110106228 13:71679687-71679709 TAAAACATGAAAAGTTGGCCAGG + Intronic
1110672039 13:78191877-78191899 AGAAAGCTGAACAGTAGGTCTGG + Intergenic
1111833379 13:93357548-93357570 AAAAATGTAAATAATTGGCCGGG + Intronic
1111851027 13:93574996-93575018 GAAAAGGTGAATTGTTGGCCAGG + Intronic
1112014517 13:95320526-95320548 AAAAAGCTGAACTCATGGCCGGG + Intergenic
1112177117 13:97036816-97036838 AAAAAGTTAAAAAGTTGGCCAGG + Intergenic
1112249594 13:97767532-97767554 AAAAAACTGAATAAATGGACAGG + Intergenic
1112281636 13:98067979-98068001 AAAAAGCTGTCTAGTAGGCCAGG + Intergenic
1112291787 13:98150030-98150052 AAAAAAGTAAATATTTGGCCGGG - Intronic
1112403140 13:99093637-99093659 AAAAATATGAAAAGTTAGCCGGG + Intergenic
1112932275 13:104756211-104756233 AAAAATCTCAGAAGTTGGCCTGG - Intergenic
1113168407 13:107470036-107470058 AAAAAGATACATAGTTGGTCGGG - Intronic
1113171414 13:107508473-107508495 AACAAGCTGAATTGCTTGCCTGG + Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1115681592 14:35745468-35745490 AAAAAGCAGAAAATCTGGCCGGG + Intronic
1116794583 14:49376047-49376069 CAAAAGTAAAATAGTTGGCCGGG + Intergenic
1117122820 14:52587000-52587022 AAAATGCTGAAGAATTGGGCTGG - Intronic
1118040277 14:61908981-61909003 AAAAAATTAAAAAGTTGGCCAGG - Intergenic
1118279909 14:64419015-64419037 AAAAAGCTTAAAAATTAGCCAGG - Intronic
1118360047 14:65048276-65048298 GAAAATCTAAAAAGTTGGCCAGG - Intronic
1118695523 14:68381378-68381400 AAAAAGCCATAGAGTTGGCCGGG + Intronic
1118801999 14:69198946-69198968 TAAAAGCTAAACAGTGGGCCGGG + Intronic
1119048670 14:71344512-71344534 AAAAACCTGAAAAGTTGGGAGGG - Intronic
1119058404 14:71447862-71447884 AAAAAAATCAATAGTAGGCCAGG - Intronic
1119620528 14:76128487-76128509 TAAAAACAGAAAAGTTGGCCGGG + Intergenic
1119629984 14:76221787-76221809 AAAAAGATGAATTGTTGCCAAGG + Intronic
1120036120 14:79700360-79700382 AAAAAAGTGAATAATGGGCCCGG - Intronic
1120145362 14:80973108-80973130 AAAAATCTGCGTACTTGGCCGGG + Intronic
1120537883 14:85719376-85719398 AAAAAGTTGACAAGTTGGCCAGG - Intergenic
1121206179 14:92169976-92169998 AAAAATCAGAAAAATTGGCCAGG + Exonic
1121224903 14:92314499-92314521 AAAAAGCTGAATAGGAGGCTGGG - Intergenic
1121433905 14:93906331-93906353 AGGATGCAGAATAGTTGGCCAGG - Intergenic
1122761115 14:104027338-104027360 AAAAAGCTGAATAGGAGGCTGGG - Intronic
1123980732 15:25600143-25600165 AAACACATGGATAGTTGGCCAGG + Intergenic
1124611170 15:31209967-31209989 AAAAAGCTGATGGGTCGGCCGGG + Intergenic
1124642675 15:31406124-31406146 AAAAAGCTGAAGAGTCTGACAGG + Intronic
1125214112 15:37250039-37250061 AAAAACCTGAATGGTTGTCAGGG + Intergenic
1125250087 15:37691456-37691478 AAAAAGCTGAGTTTTTGGCCAGG + Intergenic
1126264604 15:46738763-46738785 AAAACACTGAATATTTGGCATGG + Intergenic
1126633365 15:50759197-50759219 AAAAATAGGAAAAGTTGGCCAGG - Intronic
1126837735 15:52684374-52684396 AAAAAGTTAAAAAGTTAGCCAGG + Intronic
1127126297 15:55815550-55815572 AAAAAACTTATTAGTAGGCCGGG + Intergenic
1127675659 15:61235923-61235945 AAAAAGATCAATGGTTGCCCAGG - Intergenic
1127813137 15:62581746-62581768 AAAAGAGTGAATAGTGGGCCGGG + Intronic
1127919535 15:63482324-63482346 AAAATGTAGGATAGTTGGCCAGG - Intergenic
1128038698 15:64550549-64550571 AAAAAGAGGAATAGATGACCAGG + Intronic
1128829507 15:70754325-70754347 AAAAAACAGAATAGTTGTACGGG - Intronic
1129487270 15:75886410-75886432 CTAAAGCACAATAGTTGGCCAGG - Intronic
1129528639 15:76242128-76242150 AAAAATTTTGATAGTTGGCCAGG - Intronic
1129553651 15:76481024-76481046 AAAAAGTAGAATAGTGGGCCGGG - Intronic
1129804902 15:78447743-78447765 GAAAAGCAGAATAATGGGCCGGG - Intronic
1130623332 15:85487025-85487047 CAAAAACTGAACAATTGGCCAGG - Intronic
1130646139 15:85729003-85729025 TAAAATCTGATCAGTTGGCCAGG + Intronic
1131042230 15:89280313-89280335 AAAGAGCTGACAATTTGGCCAGG - Intronic
1131232442 15:90669488-90669510 AAAAAGTTAAAAAGTTAGCCAGG - Intergenic
1131355379 15:91741486-91741508 AAAAAGGTGCAAAGGTGGCCGGG + Intergenic
1132005565 15:98223440-98223462 AAAAAGCTGAATTATAGTCCTGG + Intergenic
1132145780 15:99428624-99428646 AAAAACCACAAAAGTTGGCCGGG + Intergenic
1132152627 15:99473469-99473491 AGAAAGGAGAAGAGTTGGCCGGG - Intergenic
1132522026 16:395883-395905 ACAAAGCTCAATTGTTGGCCAGG + Intergenic
1133138028 16:3725747-3725769 AAATAGCTGAATACTTGGTTTGG - Exonic
1133894698 16:9915229-9915251 AGAATTCTGTATAGTTGGCCGGG - Intronic
1134222454 16:12365745-12365767 CAAAAGCAGAACAGTGGGCCGGG + Intronic
1134386613 16:13779395-13779417 AAAAAGATGAAAATTTGGCCAGG - Intergenic
1134760942 16:16714558-16714580 AAAAAGAGGGATATTTGGCCAGG - Intergenic
1134985116 16:18644616-18644638 AAAAAGAGGGATATTTGGCCAGG + Intergenic
1135378856 16:21975895-21975917 AAAAAGCTAAAAAATTAGCCAGG + Intronic
1135461259 16:22645239-22645261 AAAAAGCACAAAAATTGGCCAGG - Intergenic
1135506728 16:23044279-23044301 AAACAGATGAGTAGTTGTCCAGG - Intergenic
1135512637 16:23100475-23100497 ACAAAGCAGAATAGTGGGCCGGG + Intronic
1136373877 16:29853427-29853449 AAAGAGTTAAAGAGTTGGCCAGG - Intergenic
1136633506 16:31504057-31504079 AAAAAACTCAAAAATTGGCCAGG - Intronic
1138365666 16:56474613-56474635 AAAAAGTTGAATTTTGGGCCGGG - Intronic
1138483999 16:57324163-57324185 AAGAAAGTGAAAAGTTGGCCAGG + Intergenic
1138680877 16:58682919-58682941 AAAAATTTAAAAAGTTGGCCAGG - Intronic
1139613003 16:68072355-68072377 AAAAAGCTGGATAGCTGACCTGG - Intronic
1139720122 16:68845676-68845698 AAAAAACTAAAAAATTGGCCAGG + Intronic
1139779023 16:69335528-69335550 AAAAAGCTTAAAACCTGGCCAGG + Intronic
1139837369 16:69850089-69850111 TAAAAGATGAAAAGTCGGCCGGG + Intronic
1139861834 16:70028331-70028353 AAAAAACTGTATTGTGGGCCGGG + Intergenic
1140171229 16:72607231-72607253 CAAAAACTGAATTTTTGGCCAGG + Intergenic
1140346118 16:74214668-74214690 AAAAAACAGATTACTTGGCCAGG - Intergenic
1140426642 16:74866718-74866740 AAAAACCTGAAAAGATGGCCAGG + Intergenic
1140557263 16:75936277-75936299 AAAAAGCTGCTCATTTGGCCAGG + Intergenic
1140863037 16:79035888-79035910 AAGAAGCTGAATTCTTGGCTGGG - Intronic
1142326033 16:89415247-89415269 AAAAAAAAGAATAGCTGGCCAGG - Intronic
1142391362 16:89802696-89802718 AAAAAAAAGAATAGCTGGCCGGG - Intronic
1143443459 17:6993489-6993511 AAAAATCTGAAAAGCTGGCTGGG + Intronic
1143526094 17:7473540-7473562 AAAAAGATAAATAATTGACCAGG - Intronic
1143558707 17:7678747-7678769 AAAAAACTCAAAAATTGGCCGGG - Intronic
1143638146 17:8178412-8178434 AAAAAGTTAAAAAGTTAGCCAGG + Intergenic
1143800195 17:9372806-9372828 AAAATACTGAAAAGTGGGCCAGG + Intronic
1143896672 17:10141931-10141953 AAAAAGTTACATAGTAGGCCGGG + Intronic
1144059212 17:11567528-11567550 AAAAAGTTTAATAGAAGGCCGGG + Intergenic
1144303616 17:13947132-13947154 AAAAATATCAATAATTGGCCAGG - Intergenic
1144463847 17:15480845-15480867 CAAAAGAGGAAAAGTTGGCCGGG + Intronic
1145025712 17:19466481-19466503 AGAAAGCTAATTACTTGGCCAGG + Intergenic
1145098909 17:20057144-20057166 AAAAAACAGAAAGGTTGGCCGGG + Intronic
1146222883 17:31040718-31040740 AAACAAATGAATAGCTGGCCGGG + Intergenic
1146223080 17:31043094-31043116 ATTAAACTGAATATTTGGCCAGG - Intergenic
1146229963 17:31098636-31098658 AAGAATCTTAAGAGTTGGCCGGG + Intronic
1146341917 17:32026893-32026915 ATTAAACTGAATATTTGGCCAGG + Intronic
1146342116 17:32029291-32029313 AAACAAATGAATAGCTGGCCGGG - Intronic
1146350691 17:32090301-32090323 AAACAAATGAATAGCTGGCCGGG + Intergenic
1146350892 17:32092746-32092768 ATTAAACTGAATATTTGGCCAGG - Intergenic
1146716823 17:35093162-35093184 AAAACACTGAATAGTTTTCCAGG - Intronic
1147202856 17:38815073-38815095 AAAAAGAAGAAAAGTTGGACTGG - Exonic
1147223036 17:38951184-38951206 AAAAAAATAAATAGTGGGCCAGG - Intronic
1147240817 17:39089497-39089519 GAAGAGCTGAATAGTGGGGCAGG - Intronic
1147488320 17:40840324-40840346 ACAAAGCTGTAGAGGTGGCCAGG - Intergenic
1147683150 17:42267661-42267683 AAAAAAGTAAACAGTTGGCCGGG + Intronic
1148112979 17:45157369-45157391 AAAAAACTGATTAACTGGCCAGG + Intergenic
1148362518 17:47024059-47024081 ATTAAACTGAATATTTGGCCAGG + Intronic
1148475227 17:47924294-47924316 AAAAAACTAAAAAATTGGCCGGG - Intronic
1148717355 17:49725175-49725197 AAGAATGGGAATAGTTGGCCGGG - Intronic
1149234957 17:54578663-54578685 AAAAAGCTTAAAAGTCTGCCTGG - Intergenic
1149310466 17:55387988-55388010 GAAATGTTGAATATTTGGCCAGG + Intergenic
1149672683 17:58429548-58429570 AAAAAACTAAATGTTTGGCCAGG + Intronic
1149895231 17:60423759-60423781 AGAAAGCTGAAAATTAGGCCAGG - Intronic
1150354119 17:64468787-64468809 AAAAAAATGAAAAGATGGCCGGG + Intergenic
1150447997 17:65242566-65242588 AAAAAGGTGATTTGGTGGCCAGG - Intergenic
1151465839 17:74284705-74284727 GAAAAGGTGAATAATTGGCCGGG - Intronic
1151895946 17:76981100-76981122 GAAAAGGTGAGTACTTGGCCAGG - Intergenic
1152819680 17:82430546-82430568 AAAAAGATAAAAAGTTAGCCGGG - Intronic
1152849755 17:82626240-82626262 AAAATGCAGGAAAGTTGGCCGGG + Intronic
1153118361 18:1688788-1688810 AAAGACCTGAATAGGTGGTCTGG + Intergenic
1153224248 18:2885811-2885833 AAAAAGATGAAGTGATGGCCAGG - Intronic
1153297032 18:3556438-3556460 AAAAAGATGACTAGTTGCCAGGG - Intronic
1154472613 18:14719718-14719740 AAAGACTTGAATAGTAGGCCAGG - Intergenic
1154509578 18:15082286-15082308 AAAAACCTAAATATTTGGCCAGG + Intergenic
1155503012 18:26505715-26505737 AAAAATGTTATTAGTTGGCCAGG - Intronic
1155719887 18:28998536-28998558 AAAAAATTGAAAATTTGGCCGGG - Intergenic
1156001512 18:32390004-32390026 AAAAAATTGACAAGTTGGCCGGG + Intronic
1156060746 18:33072900-33072922 TAAAAAATGTATAGTTGGCCAGG - Intronic
1156073134 18:33237492-33237514 ACAAAGCTGATCAGCTGGCCTGG - Intronic
1156218126 18:35023215-35023237 AAAAATATAAATTGTTGGCCGGG + Intronic
1156330270 18:36115144-36115166 AAAAAACTGAAGAGGGGGCCGGG + Intronic
1156377345 18:36526696-36526718 AGAAAGCTGAATTATGGGCCAGG - Intronic
1156434032 18:37106946-37106968 TAAAAACTGAATTCTTGGCCAGG + Intronic
1157375889 18:47164619-47164641 AAAAAGTTAAAAAGTTAGCCAGG + Intronic
1157987086 18:52450264-52450286 AAGAGGCTGAAAAGTTGGTCAGG + Intronic
1158364613 18:56719266-56719288 AAAAAACAGAATTGCTGGCCGGG + Intronic
1158482873 18:57837325-57837347 AAAAAGCTAAACACTTGGCCAGG + Intergenic
1158488944 18:57892983-57893005 TAAAAGCCAAATAGTAGGCCGGG - Intergenic
1158674013 18:59502094-59502116 AAAATGCTGACTCGTAGGCCAGG - Intronic
1158683478 18:59590947-59590969 AAAAAGCTGCTAAGTAGGCCGGG + Intronic
1158954963 18:62528863-62528885 AAAAAGATGATTTTTTGGCCAGG + Intronic
1160800646 19:966539-966561 AAAAAGGGGAATTGGTGGCCAGG - Intronic
1161197101 19:2993048-2993070 AAAAAACAGAATAATTAGCCAGG + Intronic
1161372357 19:3920181-3920203 AAAAAGTTTAAAAGTTAGCCAGG + Intronic
1161702008 19:5800752-5800774 AAAAAGCTGCAAAGTGGGGCTGG - Intergenic
1161758343 19:6151466-6151488 AAAAAGTGGAAAAGTTCGCCGGG - Intronic
1162233415 19:9285465-9285487 AAAAATTTTAACAGTTGGCCGGG + Intergenic
1162468224 19:10855821-10855843 AAAAATATAAATAATTGGCCAGG - Intronic
1162855448 19:13464841-13464863 AAAAATAGGAAAAGTTGGCCGGG - Intronic
1163052786 19:14697030-14697052 TAAAAGGTGATTAGGTGGCCGGG - Intronic
1163064243 19:14781470-14781492 AAAAAAGTGAAAAGTTAGCCAGG - Intergenic
1163295723 19:16411266-16411288 AAAAAGATGAGTAGTTGCCAGGG + Intronic
1163482596 19:17566816-17566838 AAAAAGTAAAATAGTAGGCCAGG + Intronic
1163877915 19:19890816-19890838 AAAAAATTAAATTGTTGGCCAGG - Intronic
1164439428 19:28261494-28261516 AAAAACCTATATAATTGGCCAGG + Intergenic
1164655692 19:29919847-29919869 AACAATATGAATAATTGGCCGGG + Intergenic
1165232790 19:34397665-34397687 AAAAAGTTTAACAGTTAGCCAGG - Intronic
1165537848 19:36464619-36464641 AAAAATATGAAAAGTTAGCCGGG + Intronic
1166005980 19:39906835-39906857 AAAAATTTGAACAGTTAGCCAGG - Intronic
1166221904 19:41370698-41370720 AAAAAAATAAATAGGTGGCCAGG - Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166527739 19:43523571-43523593 AAAAAAATGAATTGTTAGCCTGG - Intronic
1167161173 19:47768176-47768198 AAAAAGCTGAGTGATTGGCTGGG + Intergenic
1167253122 19:48411668-48411690 AATAAGAAGAATAGTTGGTCAGG + Intronic
1167727739 19:51228813-51228835 AAAAACCTAAAGACTTGGCCAGG - Intronic
1168143726 19:54407179-54407201 TAAAAGTAGAATTGTTGGCCGGG + Intergenic
1168303607 19:55421261-55421283 AAAAAGCTTAAAAATTAGCCAGG + Intergenic
1168394926 19:56039615-56039637 AAAAAGCTGCTTAAATGGCCAGG + Intronic
1168527599 19:57101205-57101227 AAAAAGTTAAAAAATTGGCCGGG + Intergenic
1168550514 19:57289705-57289727 AAAAATTTCAAGAGTTGGCCAGG + Intronic
925613709 2:5725355-5725377 AAAAAGATTAAAAGTTAGCCAGG - Intergenic
926103214 2:10133880-10133902 AAAAAGTTAAATAGGTGGGCCGG + Intergenic
926368145 2:12152410-12152432 AAAAATATGAAAAGTTAGCCAGG + Intergenic
926709486 2:15866784-15866806 AAAAAGATGAATGGTTGCCAGGG + Intergenic
926715773 2:15922373-15922395 GAAAAGATTAATAGTTGGCTGGG + Intergenic
927123820 2:19994927-19994949 AAAAAGTAAAATAGTTAGCCAGG + Intronic
927140057 2:20123901-20123923 AAAAACCTAAAAAGTTAGCCAGG - Intergenic
927205452 2:20606604-20606626 AAGACGCTGGAAAGTTGGCCAGG - Intronic
927406717 2:22778695-22778717 AAATAGCAGAATATTTGACCAGG - Intergenic
927628297 2:24747488-24747510 AAAAAATAGAATAGTTAGCCGGG - Intronic
928299407 2:30112185-30112207 AAAAAGCTGTAGAGCAGGCCAGG + Intergenic
928549173 2:32355084-32355106 AAAAATAGGAATACTTGGCCGGG - Intergenic
928908236 2:36391103-36391125 AAAAAAATCAAAAGTTGGCCAGG - Intronic
928963510 2:36954213-36954235 AAAAAGCTCCAAATTTGGCCAGG + Intronic
929220760 2:39462871-39462893 TAAAAACTAGATAGTTGGCCAGG + Intergenic
931295434 2:60919718-60919740 AAAAAACAGAAAAATTGGCCAGG - Intronic
931367471 2:61631351-61631373 AAAAAACAGAAGAGTTAGCCAGG - Intergenic
931833338 2:66074597-66074619 GAAAAACTGAATCGTGGGCCGGG - Intergenic
932223873 2:70023510-70023532 TAAAAGATGCATTGTTGGCCAGG + Intergenic
932248221 2:70216045-70216067 AAAAAGTTGAAATTTTGGCCGGG - Intronic
934285614 2:91648115-91648137 AAAAAAAAGAAAAGTTGGCCGGG - Intergenic
934718376 2:96556168-96556190 AAAAACCAGAATTTTTGGCCAGG + Intergenic
935274610 2:101465215-101465237 TCAAAACTGAATAGGTGGCCGGG + Intronic
936234245 2:110730107-110730129 AAAAATCTTAGTGGTTGGCCGGG + Intergenic
936613134 2:114021014-114021036 CAAAATCTGAATAGTTTGTCCGG - Intergenic
936691151 2:114890540-114890562 AAAAATTTGAAAAGTTGGCTTGG - Intronic
936816406 2:116466373-116466395 AAAAATATCAATAGTTGGCCTGG - Intergenic
936867804 2:117095807-117095829 AAAAAACTGAGTAACTGGCCGGG - Intergenic
937352684 2:121176161-121176183 AGAAAACTGAGTTGTTGGCCGGG - Intergenic
937700445 2:124857677-124857699 AAAAAAATGAATAGTTAGCTGGG + Intronic
938000379 2:127729788-127729810 TAAAAAATGAATAGTTGGCCGGG - Intronic
938647888 2:133350250-133350272 AAAAAGCTTAAAAGTTAGCTGGG + Intronic
938821279 2:134962632-134962654 AAAAAGCTGAAGTTTTGGCCAGG - Intergenic
938845573 2:135205428-135205450 AAAAACCTGAAAAATTAGCCAGG - Intronic
939080703 2:137658004-137658026 AAAAATCTCAAAAATTGGCCGGG - Intronic
939184886 2:138848525-138848547 AAAAAGCCTTATATTTGGCCAGG - Intergenic
939330499 2:140753054-140753076 AAAAAGATCAATGGTTTGCCAGG - Intronic
939921784 2:148124415-148124437 AAAAATCTAAAAAGTTAGCCGGG + Intronic
941568413 2:167138767-167138789 AAAAATCTGATTCGTTGGGCTGG + Intronic
941741857 2:169044059-169044081 AAAAAGCTGTTTTGTGGGCCAGG + Intergenic
942175985 2:173335127-173335149 AAAAAACAAAACAGTTGGCCAGG - Intergenic
942274770 2:174312517-174312539 AAAAAGTTAAAAATTTGGCCAGG - Intergenic
942682727 2:178494889-178494911 AAAAAGATGAGAAGTTGGCTAGG - Intronic
943289198 2:186046805-186046827 AAAAATAATAATAGTTGGCCAGG - Intergenic
943760468 2:191602288-191602310 TAAAATCAAAATAGTTGGCCGGG - Intergenic
944087685 2:195868377-195868399 AAAAAGATGAATAATAGGCCAGG - Intronic
944233960 2:197424862-197424884 AAAAAGCTTACTTGCTGGCCGGG + Intronic
944767221 2:202876640-202876662 AAAAATCTGTATTTTTGGCCAGG + Exonic
944838930 2:203607032-203607054 ATAAAAATGTATAGTTGGCCGGG - Intergenic
944854255 2:203751384-203751406 AAAAAACTGAAAAATAGGCCAGG - Intergenic
945026809 2:205627399-205627421 AAAAAACTGAAAAATTAGCCAGG + Intergenic
945086459 2:206137046-206137068 AAAAAACTAAGGAGTTGGCCGGG - Intronic
946305472 2:218854659-218854681 AAAAATCAGGAGAGTTGGCCTGG - Intergenic
946323122 2:218965274-218965296 GAAAAGTTGCCTAGTTGGCCGGG + Intergenic
946664906 2:222038958-222038980 AAAAAGATGCACAGCTGGCCGGG + Intergenic
947000789 2:225453970-225453992 AAAAAAATTAATAGATGGCCAGG - Intronic
947433243 2:230049373-230049395 AATAAGCTAAATAATAGGCCAGG - Intronic
947750928 2:232531651-232531673 AAGAAGGTGAGTACTTGGCCCGG + Exonic
1169441524 20:5637765-5637787 AAAAATTTTAAAAGTTGGCCAGG - Intergenic
1171007880 20:21485427-21485449 AGAAAGCAGACTAGTGGGCCAGG + Intergenic
1171050014 20:21849125-21849147 AAAAACCAGAAAAGTGGGCCAGG - Intergenic
1171224729 20:23432469-23432491 AAAAAGAAGAATATTTGGTCGGG - Intergenic
1171381998 20:24741225-24741247 AAAAATATGAAAAATTGGCCAGG - Intergenic
1172214547 20:33225738-33225760 AAAGGGCTGAAAAGTTGGCAGGG - Intronic
1172480100 20:35266371-35266393 AAAAAGTTGGAGAGCTGGCCTGG + Intronic
1173058024 20:39635329-39635351 AAATAGGTGAGTAGTGGGCCGGG - Intergenic
1173530373 20:43764948-43764970 AAAAAGCTTAAAATTAGGCCGGG + Intergenic
1173862415 20:46292780-46292802 AAAAAGATGAATAGTTCTCCAGG - Intronic
1174785703 20:53430398-53430420 AAAAAGCTTTATCCTTGGCCGGG - Intronic
1174796059 20:53523426-53523448 AAAAAGATGAAAACTGGGCCGGG + Intergenic
1174856684 20:54052032-54052054 AAAAATCAGCATAGTTGGCTGGG - Intronic
1175121562 20:56719917-56719939 GAAAGTCTGAATATTTGGCCTGG - Intergenic
1176157815 20:63631134-63631156 CAAAAGCTAAAAAGTTAGCCAGG + Intergenic
1176788496 21:13289497-13289519 AAAAAGCTAAATATTTGGCCAGG - Intergenic
1176801875 21:13438173-13438195 AAAGACTTGAATAGTAGGCCAGG + Intergenic
1176950802 21:15044112-15044134 AAACAGATGAGTAGTGGGCCGGG - Intronic
1177057960 21:16333132-16333154 AAAAAGTTCTATAGTTGGACTGG + Intergenic
1177856157 21:26402883-26402905 GAAAAGATGAATAATTGGTCAGG + Intergenic
1177987646 21:27997699-27997721 AAAAAGCTAAATATTTGGCCAGG - Intergenic
1178613612 21:34110165-34110187 TAAAAGCTGCGTAGTTGGCTGGG + Intronic
1179550183 21:42138868-42138890 AAAAATCTCAAAATTTGGCCGGG - Intronic
1180653864 22:17402278-17402300 AAAAAGTTAAAATGTTGGCCAGG - Intronic
1181154474 22:20910335-20910357 AATATTCTGAAAAGTTGGCCGGG + Intergenic
1181295972 22:21839388-21839410 AAAAAACTCAATAATAGGCCAGG + Intronic
1181526251 22:23490181-23490203 AAAATGTTGGATAGCTGGCCAGG + Intergenic
1181568956 22:23756617-23756639 AAAAAGAAAAAGAGTTGGCCAGG - Intergenic
1181752567 22:24999389-24999411 AAAAAATTGAAAAGTTAGCCAGG - Intronic
1181752607 22:24999721-24999743 AAAAAACTGAACAGTTAGCCAGG - Intronic
1182822382 22:33228383-33228405 AAGAAGCAGAATAGTTGTGCTGG - Intronic
1183221975 22:36520757-36520779 AAAAATATGAAGAGCTGGCCTGG + Intronic
1183251894 22:36736184-36736206 AAAAAGATGAAAAGGTGGCCAGG - Intergenic
1184181713 22:42832688-42832710 AAAGGGCTAAATAGTAGGCCCGG + Intronic
1184198351 22:42947341-42947363 AAGAAGCTGAAGCGTTGACCTGG - Intronic
1184642615 22:45880417-45880439 GAAAAGCAGAAAAGGTGGCCGGG + Intergenic
1185237214 22:49721219-49721241 AAAAAACTGGACACTTGGCCGGG - Intergenic
949183272 3:1160112-1160134 TAAAAACTGAATGATTGGCCGGG - Intronic
949990892 3:9578210-9578232 AAAAAGAACCATAGTTGGCCCGG - Intergenic
950387172 3:12669320-12669342 AAAAAGATGTACCGTTGGCCAGG + Intergenic
951893316 3:27586888-27586910 AAAAAGCAGACAAGTTGGCCTGG + Intergenic
951930214 3:27957134-27957156 AAAAAGCAGAAGAGTTAGCAAGG - Intergenic
951948233 3:28166822-28166844 AGAAAAATGAATATTTGGCCAGG - Intergenic
952046655 3:29330008-29330030 AAAGATTTGAATAGTTGCCCAGG - Intronic
952347025 3:32497562-32497584 AAAAAGTGTAAAAGTTGGCCGGG + Intronic
952480914 3:33760963-33760985 AAAAAATAAAATAGTTGGCCAGG - Intergenic
953489539 3:43337045-43337067 AAAAACATGTATATTTGGCCAGG - Intronic
953577464 3:44124484-44124506 AAAAAGATGAATGGTTGCCAGGG - Intergenic
954166148 3:48759680-48759702 GAAAAGCAGGATACTTGGCCGGG - Intronic
954727941 3:52631687-52631709 AAAAATATCAAAAGTTGGCCAGG - Intronic
955992598 3:64643758-64643780 AAAAATCTAATTAGTAGGCCAGG - Intronic
956426058 3:69136615-69136637 AAAAAACAGAAAAATTGGCCTGG + Intergenic
956765873 3:72484048-72484070 ATAAAGGTTAATAGCTGGCCAGG - Intergenic
956961446 3:74407248-74407270 AAAAAATAGAATATTTGGCCTGG - Intronic
956973289 3:74551646-74551668 AAAAAGATTAATAGTTGCCAAGG - Intergenic
957035133 3:75287288-75287310 TAAAAGATGAAAAGTTAGCCAGG - Intergenic
958980709 3:100715865-100715887 AAAAATCTGAATTGTAGGCTGGG - Intronic
959168738 3:102817105-102817127 AAAAAGATCAGTAGTTGGCCAGG - Intergenic
959734767 3:109646655-109646677 AAAATGTTGAATTTTTGGCCAGG + Intergenic
959767788 3:110053449-110053471 AAAAAGAAGCTTAGTTGGCCAGG - Intergenic
960116997 3:113905127-113905149 AAAAAACTGAAGTGTTGGCCGGG - Intronic
960280502 3:115776462-115776484 AAAAAGTTAAATAGTGGGTCAGG + Intergenic
960379842 3:116946437-116946459 AAAATGCTTAATACTTGGTCAGG - Intronic
960792373 3:121447456-121447478 AAAAAGTTAAAAAGTGGGCCAGG - Intronic
961079019 3:124008893-124008915 TAAAAGATGAAAAGTTAGCCAGG - Intergenic
961304459 3:125947579-125947601 TAAAAGATGAAAAGTTAGCCAGG + Intergenic
962568375 3:136687537-136687559 CAAAATCTGAATAGTTGCACTGG + Intronic
963619416 3:147586738-147586760 ATAAAACTGAAGTGTTGGCCAGG - Intergenic
963872618 3:150434437-150434459 AGAAAGCTGAATATTTGGGTTGG - Intronic
964014166 3:151926367-151926389 AAAAAGGTGTATATTTGGACAGG - Intergenic
964079180 3:152730534-152730556 AAAAAGCTGCAGAGCTGACCAGG + Intergenic
964139992 3:153386733-153386755 AAAAAGCAAAAATGTTGGCCAGG - Intergenic
964217105 3:154297763-154297785 AAAAAGTTTAAAAGTTAGCCAGG + Intronic
964428701 3:156580934-156580956 AAAATGAAGAATAGTTGACCAGG - Intergenic
965362610 3:167760149-167760171 AAGAAGATTAAAAGTTGGCCAGG + Intronic
965594998 3:170401777-170401799 AAAAAACTAAATAATAGGCCGGG + Intergenic
965970948 3:174555593-174555615 AAAAAACTGAATTTTTGGCCAGG - Intronic
966202966 3:177376605-177376627 AAAAAGAAAAATACTTGGCCGGG - Intergenic
966436835 3:179895599-179895621 ATAATGCTGAAGTGTTGGCCAGG - Intronic
966673758 3:182562002-182562024 TAAAAGATAAAAAGTTGGCCAGG + Intergenic
966803028 3:183782402-183782424 AAAAAACTCAAGAATTGGCCAGG - Intronic
967031375 3:185610455-185610477 CAAAAGCTAGATAGTAGGCCGGG - Intronic
967357605 3:188590275-188590297 AAAAAGATGTATTCTTGGCCAGG + Intronic
968535904 4:1129080-1129102 AAAAAAATTAAAAGTTGGCCAGG + Intergenic
968839035 4:2987643-2987665 CAGAAGCAGAATTGTTGGCCAGG + Intronic
969043468 4:4319523-4319545 TAAAAGCTGAATACAGGGCCAGG + Intronic
970279856 4:14442983-14443005 AAAATACTAAATAGTTGGCCTGG - Intergenic
970492788 4:16592008-16592030 AATCAGCTGATTAGTTGGCATGG + Intronic
970785095 4:19785591-19785613 AAAATGATTAATAGTTGGCCAGG - Intergenic
970885361 4:20982075-20982097 TAAAAGCTGAATCGTTGCCCGGG + Intronic
971087862 4:23299682-23299704 AAAAAGTTAAATAATTGGTCGGG - Intergenic
971849385 4:31964197-31964219 AAAAAGCTGTAAAATAGGCCAGG + Intergenic
972316396 4:37930480-37930502 AAAAATCCAAAAAGTTGGCCAGG - Intronic
972395383 4:38654949-38654971 AAAAAGCCAAAGAGTCGGCCGGG + Intergenic
973265512 4:48206644-48206666 TAAAATATGAAAAGTTGGCCAGG + Intronic
973618504 4:52704292-52704314 TAAATGCTGAATCTTTGGCCAGG + Intergenic
973676018 4:53263807-53263829 AAAAACCTGAATACTTAACCAGG - Intronic
974157686 4:58095293-58095315 CAGAAGCTGAACAGATGGCCAGG - Intergenic
974624779 4:64411195-64411217 AAAAAAAGGAATAGTTGGCTGGG + Intergenic
974656303 4:64827044-64827066 AAAAATACAAATAGTTGGCCAGG - Intergenic
975641450 4:76504452-76504474 AAAAAACTGATAAGTCGGCCGGG - Intronic
975875765 4:78835328-78835350 AAAAAGTCAAATAGTTGGCCTGG + Intronic
975930263 4:79512942-79512964 AAAATACAGAAAAGTTGGCCGGG - Intergenic
976103941 4:81596257-81596279 AAAATGCTAAGTAGATGGCCTGG - Intronic
976248654 4:83028441-83028463 AAAAAGTTGAAAAATTAGCCAGG + Intergenic
976632473 4:87253130-87253152 AAAAAGGACAGTAGTTGGCCGGG - Intergenic
976799295 4:88970911-88970933 AAAAAGCACAGAAGTTGGCCGGG + Intronic
978978320 4:114909363-114909385 AGAAAGCTAAATTATTGGCCGGG + Intronic
980008607 4:127569856-127569878 AAAAGGCAGAATAGGTGACCGGG + Intergenic
980038327 4:127910455-127910477 AAAAAGCTGATTGGTTGGGCCGG - Intergenic
980424804 4:132614805-132614827 AAAAAGATGAATATTTGGGAAGG - Intergenic
980736784 4:136900447-136900469 ATGAAGATGAATAGTTGGCCAGG + Intergenic
980741130 4:136950465-136950487 AACAAGCAGCATACTTGGCCAGG - Intergenic
980761403 4:137238758-137238780 AAAAACCTGAATACTTAGCCAGG - Intergenic
981033195 4:140146166-140146188 AAAAATCTCAAAAGGTGGCCGGG - Intronic
981322119 4:143404588-143404610 AAAAAATTGAAAAGTTAGCCAGG + Intronic
981524356 4:145694743-145694765 AAAAAACTAAAAACTTGGCCGGG - Intronic
982041221 4:151398993-151399015 AAACACTAGAATAGTTGGCCGGG + Intergenic
982149851 4:152441509-152441531 AAAAATCTGAATAGTTGGATTGG - Intronic
983026780 4:162747389-162747411 TAAAAACTCAATAGTCGGCCGGG - Intergenic
983307733 4:166014539-166014561 AGAAAGCTGTATAGATGTCCAGG + Exonic
983468185 4:168122133-168122155 AAAAAGCTGAAAAACTGGCCGGG - Intronic
984116591 4:175689011-175689033 AAAAAGTAGAATAATTAGCCAGG - Intronic
986647377 5:9930598-9930620 AAGAAGAGGAAGAGTTGGCCGGG - Intergenic
986689160 5:10299686-10299708 AAAAAGCAGAAAAATTAGCCAGG + Intronic
987042379 5:14075113-14075135 AAAATGCTGAAAAGGTGGGCAGG + Intergenic
988680462 5:33480154-33480176 AAACAGCAGAATAGTTGCCCAGG + Intergenic
989073155 5:37533515-37533537 AAAAACCTGAATACTTAACCAGG - Intronic
989754289 5:44934192-44934214 AAAAAGATGAATTGTTGGTTGGG - Intergenic
990009113 5:50974659-50974681 AAAAATCTGAGTATTTGGGCTGG + Intergenic
990035541 5:51313627-51313649 AAAAAGCTGAATAATTAGATTGG - Intergenic
990081616 5:51922727-51922749 AAAAATTTGAAAAATTGGCCAGG - Intergenic
990641692 5:57792616-57792638 AGAAAGCTTATTAATTGGCCAGG + Intergenic
990680897 5:58242966-58242988 AATAAGCTGAGGAGTTGCCCAGG + Intergenic
991356411 5:65773645-65773667 AAGAAACTCAATATTTGGCCAGG + Intronic
991454327 5:66786027-66786049 AAAAAGTTAAAAAGTTAGCCAGG - Intronic
991777859 5:70102984-70103006 CAAAAGCTTCATTGTTGGCCAGG - Intergenic
991857147 5:70978442-70978464 CAAAAGCTTCATTGTTGGCCAGG - Intronic
992095241 5:73357110-73357132 AAAAAACTGAAAAATTAGCCAGG - Intergenic
992462920 5:76979344-76979366 AAAAAACTTTATTGTTGGCCGGG - Intronic
993582882 5:89684952-89684974 TAAAAAATAAATAGTTGGCCAGG + Intergenic
993645539 5:90456331-90456353 AGAAAGCTGAAAACTAGGCCAGG - Intergenic
994174297 5:96694340-96694362 ATAAAGCTTTATACTTGGCCAGG + Intronic
994622254 5:102177351-102177373 AAAAAACCGAAAAGCTGGCCGGG - Intergenic
995043970 5:107622724-107622746 CAAAAGTTGAATACTCGGCCGGG + Intronic
995196861 5:109380510-109380532 TAAAAGAAGAAAAGTTGGCCGGG + Intronic
995241708 5:109892194-109892216 AAAAATCTGAACTTTTGGCCAGG - Intergenic
996106927 5:119516384-119516406 TAAAAGCTGAATAGTTTCCAAGG + Intronic
996606260 5:125327306-125327328 AAAAAGATGTAGAGATGGCCAGG + Intergenic
997514217 5:134474976-134474998 AAAAAACTGATTAATTGGCTGGG - Intergenic
997539941 5:134653408-134653430 AAAAAACTGTTTAGTTAGCCAGG - Intronic
998519664 5:142788294-142788316 AAAGAACTGATTAATTGGCCGGG - Intronic
999535288 5:152509935-152509957 AAAAAATTGAAAAGTTAGCCAGG - Intergenic
1000766238 5:165294070-165294092 AAAAAACTGAATAGATGGCCAGG + Intergenic
1000865696 5:166512242-166512264 AAAAATATGAATAATTAGCCAGG - Intergenic
1001636948 5:173217117-173217139 AAAAAGATCCATGGTTGGCCAGG - Intergenic
1002337764 5:178492028-178492050 TAAAAATTGAATAATTGGCCTGG - Intronic
1002489651 5:179565844-179565866 AGAAAGTTGCACAGTTGGCCAGG + Intronic
1003519479 6:6846120-6846142 AAAAAGATGAGTGGTTGGCAGGG - Intergenic
1003687408 6:8317991-8318013 AAAAATCCAAAAAGTTGGCCAGG + Intergenic
1004379192 6:15117616-15117638 AAAAAACTTAAAAGTTAGCCAGG + Intergenic
1004938206 6:20528798-20528820 AAAAAACTGTTCAGTTGGCCAGG + Intergenic
1004938316 6:20529547-20529569 GAAAAACTGTTTAGTTGGCCAGG + Intergenic
1005157920 6:22828727-22828749 AAAAAGCAGACTGGGTGGCCAGG - Intergenic
1005234074 6:23739726-23739748 AAAAATATGAAAAGTTAGCCAGG + Intergenic
1005679463 6:28191625-28191647 AAAAAACTGAACATGTGGCCGGG - Intergenic
1006111218 6:31746744-31746766 CAAAAACTCAATAGCTGGCCGGG - Intronic
1006287318 6:33106652-33106674 AGGAAGCTGACAAGTTGGCCTGG + Intergenic
1006532279 6:34666262-34666284 AAAAAGCTATATACTTGGCCGGG + Intronic
1006663103 6:35665843-35665865 AAAAAGCAGAATAGTTGTATGGG - Intronic
1007613771 6:43168133-43168155 AAAAATCTGAATGTCTGGCCGGG - Intergenic
1007962562 6:45973641-45973663 CAATAGCAGAATAGGTGGCCGGG + Intronic
1008161372 6:48080228-48080250 AAAAGGCTGAATATTTGCCAAGG - Intergenic
1008290100 6:49705021-49705043 AAAAACCTGAATACTTATCCAGG - Intronic
1008831891 6:55774637-55774659 TAAAAGCCGAATACTTGGCAGGG + Intronic
1008860504 6:56143493-56143515 AAAAAATTGTATAGTCGGCCGGG - Intronic
1009311370 6:62156978-62157000 AAAAAGCTACAAAATTGGCCGGG - Intronic
1009700255 6:67168005-67168027 AAAAAAATAAATAGTTAGCCGGG + Intergenic
1009965458 6:70573557-70573579 AAAAGGCCAAATAGCTGGCCGGG - Intronic
1010347427 6:74827687-74827709 AAAAAACTGTATAGCTGGCCGGG - Intergenic
1011836629 6:91439251-91439273 GAAAAGCTGAGCAGATGGCCAGG - Intergenic
1012347851 6:98213671-98213693 AAAAAGCCAGATAGTGGGCCAGG + Intergenic
1013478902 6:110535564-110535586 AAATAGGGGAATAGATGGCCAGG + Intergenic
1013523087 6:110950517-110950539 AAAAAACTGAAGAATTAGCCAGG + Intergenic
1015102475 6:129497528-129497550 AAAAAGCTAAATTCTGGGCCAGG - Intronic
1015318538 6:131845324-131845346 AAAAACATGAAGAATTGGCCAGG - Intronic
1015844774 6:137508808-137508830 AAAAAGCAAAAAAGTTAGCCAGG + Intergenic
1016037471 6:139397781-139397803 AATAAGCTTAATATTGGGCCAGG - Intergenic
1017051317 6:150396577-150396599 AAAAAGTTTAAGACTTGGCCAGG + Intronic
1017118657 6:151003234-151003256 TAAAAACAGAAAAGTTGGCCGGG + Intronic
1017326382 6:153145839-153145861 AGAAACCTGAATACTTAGCCAGG - Intergenic
1017461663 6:154656624-154656646 AAAAAACTGAAAAATTAGCCAGG + Intergenic
1018416462 6:163606236-163606258 AAAAAGTTAAAAAGTTAGCCAGG - Intergenic
1018735794 6:166686358-166686380 AAAAAGCAGAAAAGTTGCTCAGG - Intronic
1019389176 7:776042-776064 AAAAAGCAGAAAACGTGGCCGGG + Intronic
1019792155 7:3022621-3022643 TAAAACCTGAGAAGTTGGCCGGG + Intronic
1019988513 7:4675960-4675982 AAAAAGAAGCATAGCTGGCCAGG - Intergenic
1020544756 7:9512992-9513014 AAAAAGATCAATAGTTGTCAAGG - Intergenic
1021119349 7:16780393-16780415 AAAAAAATGAATATTGGGCCAGG - Intronic
1021480206 7:21107142-21107164 AAAAATATGAAAAATTGGCCAGG - Intergenic
1021838004 7:24699633-24699655 AAAAAACGACATAGTTGGCCAGG - Intronic
1021918380 7:25458026-25458048 AAAAAAATTAATAGTGGGCCAGG + Intergenic
1022118661 7:27285537-27285559 AAAAAGTTGAAAAATTAGCCAGG - Intergenic
1022420793 7:30221436-30221458 AAAAAGATGAATGGTTGTCAGGG + Intergenic
1022599221 7:31740906-31740928 AAAAAACTGAAAAATTAGCCAGG + Intergenic
1023435481 7:40136666-40136688 AGAAAGGTGAATTTTTGGCCAGG - Intronic
1023503164 7:40872216-40872238 AAAAAGATGAATAGATGGGACGG - Intergenic
1023904244 7:44510803-44510825 AAAAAGTTTAAAAGTTAGCCAGG - Intergenic
1024356076 7:48414792-48414814 AAAAATCAGAACAGTTTGCCTGG + Intronic
1024872163 7:53976559-53976581 AAAAAGCAGAAAAATTAGCCAGG - Intergenic
1025062765 7:55825308-55825330 AAAAAGATCAATAGTTGCCAAGG + Intronic
1025732082 7:64116065-64116087 AAAAAACACAAAAGTTGGCCAGG - Intronic
1025773607 7:64537630-64537652 AAAAAACAGAATAGACGGCCAGG + Intronic
1025779616 7:64588616-64588638 AAAAAGTTAAAAAGTGGGCCCGG - Intergenic
1025930228 7:65987556-65987578 AAAATGTTGAATGGCTGGCCAGG - Intergenic
1026797377 7:73375087-73375109 AAAAATAAGAATAATTGGCCAGG + Intergenic
1027122076 7:75528997-75529019 AAAAAGAACAGTAGTTGGCCGGG - Intergenic
1027261749 7:76469686-76469708 AAAAATTGGAATATTTGGCCGGG - Intronic
1027313128 7:76967785-76967807 AAAAATTGGAATATTTGGCCGGG - Intergenic
1027390641 7:77700088-77700110 AAAAATCTAAAATGTTGGCCAGG - Intronic
1027590796 7:80116447-80116469 AAGAACATGAATAGTGGGCCAGG + Intergenic
1028230366 7:88300538-88300560 AAAAACCTGAAAACTAGGCCAGG - Intronic
1028408023 7:90497581-90497603 AAAAAGTTAAAAAGTTAGCCAGG + Intronic
1028822604 7:95229748-95229770 AGAAACCTGAATACTTGACCAGG + Intronic
1028859061 7:95627426-95627448 AGAAATCTAAAAAGTTGGCCGGG + Intergenic
1029172816 7:98642890-98642912 AAAAAAAAAAATAGTTGGCCAGG + Intergenic
1030484691 7:110150636-110150658 TAAAGACTGAATAGTTCGCCAGG + Intergenic
1030748843 7:113204273-113204295 AAAAAGGAGAATAGTAGGCAAGG + Intergenic
1031239972 7:119225049-119225071 GAAAAGCTGAGTAGTTGGTATGG - Intergenic
1031260931 7:119519665-119519687 TAAAAATTCAATAGTTGGCCGGG + Intergenic
1031600403 7:123700731-123700753 AAGAGGTAGAATAGTTGGCCGGG - Intronic
1031725084 7:125228346-125228368 AAAAACCTTAAAATTTGGCCAGG - Intergenic
1032061456 7:128728647-128728669 AAAAATCAGAATATTTGGCCTGG - Intronic
1033209244 7:139448289-139448311 AAAAAGGAGAAATGTTGGCCAGG - Intergenic
1033811684 7:145021086-145021108 ACTAAGCTGAATAGCTGGGCTGG + Intergenic
1034287306 7:149895671-149895693 AAAAAGCTAAAAAATTAGCCAGG + Intergenic
1034503283 7:151465732-151465754 TAAAAGGTGATTATTTGGCCAGG + Intergenic
1034600194 7:152244381-152244403 AAAATGCTGAAAAATGGGCCAGG + Intronic
1034604698 7:152301207-152301229 AAAAAAAAGAAAAGTTGGCCGGG + Intronic
1034663818 7:152797240-152797262 AAAAAGCTAAAAAATTAGCCAGG - Intronic
1034757471 7:153635912-153635934 ACAAAGTAGAATAGTTGGCTGGG - Intergenic
1034951920 7:155304122-155304144 AAAAAGCAAAAAAGTTAGCCGGG - Intronic
1036508226 8:9375971-9375993 AACAAGCTGTCAAGTTGGCCAGG - Intergenic
1036516358 8:9447727-9447749 AAAAAGCACAGCAGTTGGCCGGG + Intergenic
1036642845 8:10594769-10594791 AAAAAGCAAAATAATTAGCCAGG + Intergenic
1036748795 8:11430039-11430061 AAAAGCCTGAAAAGCTGGCCAGG + Intronic
1036797559 8:11767291-11767313 AAAAGGCTGAATAATCTGCCTGG - Intergenic
1037059605 8:14490159-14490181 AAAAGGCAGGAGAGTTGGCCGGG - Intronic
1037272329 8:17143782-17143804 AAAAAACATAAAAGTTGGCCAGG - Intergenic
1037581445 8:20248157-20248179 AAAAAAATGAAAAGTTAGCCAGG + Exonic
1038479245 8:27890505-27890527 TAAATGCTGAATAGATGGCGTGG + Intronic
1039062487 8:33582642-33582664 AAAAAGCTGAAAGGGAGGCCAGG - Intergenic
1039935526 8:42040917-42040939 AAAAATCTGCACAGTTGGCCAGG + Intronic
1039961208 8:42249206-42249228 AAAAAACTGAAAAATTGGCCAGG + Intergenic
1040002739 8:42592913-42592935 AAAAACATGAGTTGTTGGCCGGG - Intergenic
1040025796 8:42780894-42780916 AAAAAGAAGAAAAGATGGCCAGG - Intronic
1040101337 8:43509423-43509445 TAAAAACTAAAGAGTTGGCCAGG - Intergenic
1040393840 8:46975790-46975812 AAAACACTGAATACTAGGCCAGG - Intergenic
1040933863 8:52763600-52763622 AAAAAGCTGAAAAGTGGGACTGG + Intergenic
1041262474 8:56033727-56033749 AGAAAGCTGAATAGTTTTCCCGG + Intergenic
1041634772 8:60130517-60130539 GAAAAGCTCAATATTTGGGCGGG + Intergenic
1041751240 8:61263122-61263144 ATCAAGCTGAATACTTAGCCGGG - Intronic
1041991099 8:63992525-63992547 AAACAACTGAAAAGTTAGCCAGG + Intergenic
1043172660 8:76985003-76985025 AAGAAGCTGAATGGTTAGCTAGG + Intronic
1043862827 8:85340847-85340869 AAAAAGATTAATACTTGGCTGGG + Intronic
1044560778 8:93609986-93610008 AAAAAGCCTAAAAGTTGGCCAGG - Intergenic
1045162856 8:99568584-99568606 AAAAAATGAAATAGTTGGCCAGG - Intronic
1045262222 8:100586214-100586236 TGAAATCTGAATTGTTGGCCAGG - Intronic
1045359731 8:101421827-101421849 AAAAAGTTAAAAAGTTGGCCGGG + Intergenic
1045359769 8:101422128-101422150 AAAAAGTTAAAAAGTTAGCCAGG + Intergenic
1045660874 8:104436312-104436334 TAAAAACTGAAAAATTGGCCAGG + Intronic
1046503402 8:115107979-115108001 AAAAAGCTGAATTTTAGGCCAGG + Intergenic
1048065925 8:130968464-130968486 AAAAAGCAGAATAACTGGCCGGG - Intronic
1048336784 8:133508324-133508346 ACAAACCTGAAAATTTGGCCTGG - Intronic
1048456427 8:134582695-134582717 CAAAGGCTGAATACTTGGCTGGG - Intronic
1049127529 8:140805263-140805285 AAAAAGCATCATATTTGGCCGGG + Intronic
1049590042 8:143454384-143454406 AAAATTATGAATTGTTGGCCAGG - Intronic
1050425342 9:5507498-5507520 AAAAAGTTAATAAGTTGGCCGGG + Intergenic
1050498880 9:6273113-6273135 AAAAAGATGACTTTTTGGCCAGG - Intergenic
1050611886 9:7361906-7361928 AAAAAGCTGGTATGTTGGCCAGG - Intergenic
1051265262 9:15303530-15303552 AAAAATATGAATAGTTAGCTGGG - Intronic
1052157367 9:25209241-25209263 ACAAAGCAGAATAGTTGAACTGG + Intergenic
1052310330 9:27060661-27060683 AAAAAGCTGAAAATGGGGCCGGG + Intronic
1052518915 9:29518143-29518165 AAAAATATGTATAGTTGGCCAGG - Intergenic
1052713370 9:32085239-32085261 ATAAAGCAGAATAATTGGGCTGG - Intergenic
1052714318 9:32097424-32097446 AAAAAGCTCAACAGGTGGGCAGG - Intergenic
1052744846 9:32430486-32430508 GAGAGGCTAAATAGTTGGCCCGG - Exonic
1052848396 9:33358417-33358439 AAAAAAATTAAAAGTTGGCCAGG - Intronic
1052914620 9:33915140-33915162 AAAAAATCAAATAGTTGGCCAGG + Intronic
1053345564 9:37375781-37375803 AAAAATCTCAATAGAAGGCCTGG + Intergenic
1053436368 9:38077542-38077564 AAAAACTTAAAAAGTTGGCCAGG - Intergenic
1054742952 9:68827045-68827067 AAAAAGTGGAATTTTTGGCCGGG - Intronic
1054763079 9:69020748-69020770 AGAGAGATGAAGAGTTGGCCAGG - Intergenic
1054875330 9:70090321-70090343 AAAAAGTTTAAAAATTGGCCTGG + Intronic
1054876589 9:70103684-70103706 AAAAAGGTGAAAAGACGGCCAGG + Intronic
1054880088 9:70135607-70135629 AAAAAGCTTAAAAGTAAGCCAGG - Intronic
1055055314 9:72018263-72018285 TAAAAGCTTAATATGTGGCCGGG + Intergenic
1056560350 9:87724383-87724405 AAAAAGAGGAATAATCGGCCGGG + Intergenic
1057101431 9:92364326-92364348 TAAAAGCAGAATATTAGGCCAGG - Intronic
1057115773 9:92520121-92520143 AAAAAGTTAAAAAGTTAGCCAGG + Intronic
1057454855 9:95198896-95198918 AAAAAGTTTAAAAGTTAGCCAGG - Intronic
1057986110 9:99715601-99715623 AAAAATCTGCTGAGTTGGCCAGG - Intergenic
1058249955 9:102681023-102681045 AAAAAGTTGAAAAATTAGCCAGG - Intergenic
1058437744 9:104978894-104978916 AAAAAATAAAATAGTTGGCCAGG + Intergenic
1059654807 9:116347853-116347875 AAAAAAGTGAGTAGCTGGCCTGG + Intronic
1060638614 9:125220157-125220179 AAAAATCTGAAAAATTAGCCGGG - Intronic
1060923631 9:127440155-127440177 AAAAAGTAGATTAGTGGGCCGGG - Intronic
1061827080 9:133265214-133265236 AAAAAGTAGAATAATTAGCCGGG - Intronic
1062487927 9:136790174-136790196 AAAAAGATGAAATCTTGGCCAGG - Intergenic
1186291082 X:8099851-8099873 AAAAAGAAGAATAATTGGGCTGG + Intergenic
1186320164 X:8415584-8415606 AAAAAGCTTAATACTTGGAGAGG - Intergenic
1186400403 X:9253426-9253448 AAAAATCAGAATAGTTACCCTGG + Intergenic
1188232293 X:27679591-27679613 CAAAGGCTGAATATTTGGCCCGG - Intronic
1188492261 X:30750011-30750033 AAAAAGTTAAAAAGTTAGCCAGG - Intergenic
1189397660 X:40637763-40637785 AAAAGGCCGAATTGTTGCCCAGG - Intronic
1189832863 X:44992516-44992538 AAAAAGCAGTATTGCTGGCCAGG - Intronic
1190428354 X:50353611-50353633 AAAAAGTTAAAAAGTTAGCCAGG + Intergenic
1190813796 X:53910187-53910209 AAAAAGATGATTGGTTGGCAGGG - Intergenic
1191805104 X:65127535-65127557 AAAAACCTGAATACTTAACCAGG - Intergenic
1191939545 X:66463258-66463280 AAAAACCTGAAACGTTGGCTGGG + Intergenic
1192406404 X:70890494-70890516 GAAAAGCAGAGTAGTTGGGCAGG - Intronic
1192586031 X:72318830-72318852 AAAAACCTGAACAGCTAGCCAGG - Intergenic
1194401739 X:93445904-93445926 CAAAGGCTGAATAGTTGTCTTGG - Intergenic
1195040146 X:101006505-101006527 CTAAAGATGAAGAGTTGGCCGGG + Intergenic
1195471253 X:105232991-105233013 AAAAAGCTGAATAGTTGGCCAGG + Intronic
1195499872 X:105583427-105583449 AAAAAATTGAATTCTTGGCCGGG - Intronic
1195931695 X:110084206-110084228 AAAATCAAGAATAGTTGGCCAGG + Intronic
1195988339 X:110657162-110657184 AAAAAGCACAATAATTGGTCAGG - Intergenic
1196150341 X:112366528-112366550 AAAGAGCAGAACAGTTGTCCAGG - Intergenic
1196854885 X:119973449-119973471 AAAATGCTTAATTGTGGGCCGGG - Intergenic
1197381452 X:125747276-125747298 AAAAAACACAATAATTGGCCGGG - Intergenic
1197622054 X:128761787-128761809 AAAAAGCTAGAGAATTGGCCGGG - Intergenic
1200593744 Y:5111391-5111413 AAAAAACTAATTATTTGGCCAGG - Intronic
1202193937 Y:22276199-22276221 AAAAAGCTGAATATTCAGCCGGG + Intergenic