ID: 1195471855

View in Genome Browser
Species Human (GRCh38)
Location X:105239392-105239414
Sequence ATGCCTTTCTAGAAGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 7, 2: 24, 3: 73, 4: 235}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195471851_1195471855 20 Left 1195471851 X:105239349-105239371 CCATCTTTTACTCCACACCATGG 0: 1
1: 0
2: 2
3: 15
4: 194
Right 1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG 0: 1
1: 7
2: 24
3: 73
4: 235
1195471854_1195471855 3 Left 1195471854 X:105239366-105239388 CCATGGAAAAAAGCACTTAACAA 0: 1
1: 0
2: 8
3: 24
4: 370
Right 1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG 0: 1
1: 7
2: 24
3: 73
4: 235
1195471853_1195471855 8 Left 1195471853 X:105239361-105239383 CCACACCATGGAAAAAAGCACTT 0: 1
1: 0
2: 2
3: 24
4: 224
Right 1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG 0: 1
1: 7
2: 24
3: 73
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195471855 Original CRISPR ATGCCTTTCTAGAAGAATGA AGG Intronic
904043236 1:27596078-27596100 ATGCCCCTCTGGGAGAATGAAGG + Intronic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908693626 1:66811297-66811319 ATGCTTTTATAGAAGAAAAATGG + Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910028475 1:82687374-82687396 ATGCTTTTCTATAACAATGATGG - Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
915792257 1:158686062-158686084 ATCCATATCCAGAAGAATGAAGG - Intronic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
917736497 1:177925874-177925896 ATTCTTTTCAAGAAGAAAGAGGG + Intronic
918409248 1:184241382-184241404 ATGCCATTCTCCAAGAAGGAAGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919067081 1:192706097-192706119 ATGCCTTGCAAGATGAAGGAAGG + Intergenic
920238083 1:204522804-204522826 AAGCCTTTTCAGAAGCATGAGGG + Intronic
920565205 1:206967528-206967550 ATTCCTTTTCAGGAGAATGAAGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1063935775 10:11076617-11076639 TTGCCTTTTTAAAAGAATGCTGG + Intronic
1068401266 10:56530710-56530732 ATGACTTTCTTGAAGACTGAGGG + Intergenic
1069282810 10:66676844-66676866 ATGACATTGTAGAAAAATGAAGG - Intronic
1069758761 10:70792934-70792956 ATTCCATTCTAGAAGAAAAAGGG - Intergenic
1071130536 10:82387725-82387747 AAGTCTTTCTAGAACAAAGATGG - Intronic
1071673151 10:87630367-87630389 ATGCCCATCCAAAAGAATGAAGG - Intergenic
1071778629 10:88817627-88817649 AGGCCTTTTGAGAAGAAAGAGGG - Intronic
1072247708 10:93557976-93557998 ATCGCTGTGTAGAAGAATGAAGG + Intergenic
1074025943 10:109635115-109635137 TTTCCTCTCTCGAAGAATGAAGG + Intergenic
1076499821 10:130928792-130928814 AAGTCTTTCTAGAAGGAAGAAGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078969011 11:16384363-16384385 ATGACATCCTAGAAGAATAAAGG + Intronic
1080169316 11:29280466-29280488 ATGCATTTCTAAAGAAATGATGG - Intergenic
1082265280 11:50111194-50111216 ACAACTTTCTATAAGAATGAAGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1085206146 11:74733118-74733140 AGGCCTTTTTTGAAGTATGATGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1087126337 11:94629707-94629729 ATTATTTTCTAAAAGAATGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1087743126 11:101912482-101912504 CTGCCTTTCTATAAGAATCTAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1089902255 11:121999384-121999406 ATGCCTTTCAAGAAAAGAGAAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090858648 11:130633613-130633635 ATGCCTTTCTCTAGGAAAGAAGG - Intergenic
1091261065 11:134234710-134234732 AAGCCTTTGGAGAAGAAGGAGGG + Intronic
1092117103 12:6017177-6017199 ACTCATTTCTAGAAGAATGGTGG - Intronic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1095145838 12:38725205-38725227 ATTGCTTTATAGAAAAATGATGG + Intronic
1097234727 12:57531559-57531581 AGGCATTACTAAAAGAATGAAGG + Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098004862 12:65985580-65985602 ATGCCTCTCTTGAAGAGTGAAGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1099294457 12:80812854-80812876 TTGACTTGTTAGAAGAATGAAGG - Intronic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1101042433 12:100770466-100770488 TAGCCTTTTTAGAAGTATGAAGG + Intronic
1101082476 12:101202890-101202912 ATGCTTTTATAGAATAATCATGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1105540459 13:21311836-21311858 GGGCATTTCTAGAAGAAAGATGG + Intergenic
1106542950 13:30706176-30706198 ATGCCTTTCTAGGAGATTGGTGG + Intergenic
1106836321 13:33639237-33639259 AGGCCTCTCAAGAAGAATTAGGG + Intergenic
1107074272 13:36304958-36304980 CTCCCTTTCTAGAAATATGAGGG + Intronic
1107444324 13:40456982-40457004 ATGTCTTTATAGAAGGAAGAGGG + Intergenic
1108020424 13:46122308-46122330 ATGCTGTCCTAGAAGAATAAAGG - Intergenic
1108074908 13:46669958-46669980 ATTCCAGTCTAGAACAATGATGG + Intronic
1108395336 13:49985960-49985982 AATTCTTTCTGGAAGAATGATGG - Intergenic
1110475391 13:75907546-75907568 ATGGCTGTCGAGAAGAAGGAGGG + Intergenic
1110643427 13:77853004-77853026 ATGCCTTCATATTAGAATGAGGG + Intergenic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1111127359 13:83929014-83929036 CTGTCTTTCTAAAATAATGATGG + Intergenic
1111153606 13:84292892-84292914 ATCTCTTTCTAAAAGAAAGATGG + Intergenic
1111303797 13:86380220-86380242 ATCCCTTTCTACAAAAATGTAGG - Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1111650906 13:91089607-91089629 CTCCCTTTCTAGAAGTAGGATGG - Intergenic
1111855724 13:93634665-93634687 TTGAGTTTCTAGAAGCATGAAGG + Intronic
1111907305 13:94270408-94270430 ATGCTTTCATAGAATAATGAGGG + Intronic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114412153 14:22511233-22511255 ATATCTCTCTAGAAGAAAGAGGG - Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1114914010 14:27239375-27239397 AAGCATCTCTAGAAGAATGAAGG + Intergenic
1115250050 14:31335607-31335629 ATAACTTTCTAAAAGTATGATGG + Intronic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1117228420 14:53688149-53688171 ATCCCTTTCTTGCAGAATGAAGG - Intergenic
1118285466 14:64466595-64466617 AAGTCATTCTAGAACAATGACGG - Intronic
1118299850 14:64605675-64605697 ATGCCATTCTGGATGAATGAGGG + Intergenic
1119220470 14:72902311-72902333 AAGCCTTTCTAGAAACATGGTGG - Intergenic
1119354074 14:73990677-73990699 ATGGCTTTGTTGCAGAATGATGG - Intronic
1119723792 14:76909504-76909526 ATGCCTCTGCAGAAGAAAGAAGG + Intergenic
1120515722 14:85467669-85467691 CTGGCTTTCAAGATGAATGAGGG - Intergenic
1120649792 14:87118438-87118460 ATACCACTCTAGAAGAGTGAAGG - Intergenic
1120681151 14:87482078-87482100 TTGGATTTCTAGAAGAATAATGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1121520221 14:94581200-94581222 ATGCCATTCCAGGAAAATGATGG + Intronic
1124816839 15:33002210-33002232 ATGCCTTTCTAGAATAAGAAGGG - Intronic
1126891091 15:53205076-53205098 GTGATTTTCTAGAAGAATAATGG + Intergenic
1127599405 15:60520333-60520355 TTGCATTTCAGGAAGAATGAGGG + Intronic
1129186376 15:73909636-73909658 ATGCCACCCTAGAAGAAAGAAGG - Intergenic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1202976747 15_KI270727v1_random:303158-303180 ATACATTTTTAGAAGAATGTAGG - Intergenic
1133696686 16:8270764-8270786 ATTCCTTTCTAGAATGAAGAAGG - Intergenic
1139246982 16:65454279-65454301 ACGGTTTTCCAGAAGAATGAAGG + Intergenic
1142118827 16:88375986-88376008 ATTTTTTTCTAGAAGAATGTTGG + Intergenic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1146601782 17:34223551-34223573 ATACATTTCCAGAAGAATGATGG - Intergenic
1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG + Intronic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1148141547 17:45332789-45332811 AGAAGTTTCTAGAAGAATGAAGG - Intergenic
1150752412 17:67877426-67877448 ATGCCTTGTTAGAAGAATTGGGG + Intronic
1153445177 18:5163980-5164002 ATGCCTTTGTAGAAAACTGGCGG + Intronic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155468772 18:26168948-26168970 ATAACTTTCTAGAATTATGAAGG + Intronic
1155590329 18:27420230-27420252 ATGCATTTCAAGAAGACTGAAGG - Intergenic
1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG + Intergenic
1156957428 18:42985348-42985370 ATGCATTTCTAGATCAATTAGGG - Intronic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1157109714 18:44809207-44809229 TTGCCTTTATAGGAGAGTGAAGG - Intronic
1158496471 18:57959611-57959633 TTGCCTTCCTAAAGGAATGAGGG + Intergenic
1159510573 18:69393562-69393584 ATGCTTTTATAGAAGTCTGATGG - Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1162262699 19:9545652-9545674 CTACCTTTCCAGAAGACTGAGGG - Intergenic
1163042299 19:14611546-14611568 ATGCCTTTCTAGAAGTTCCATGG - Intergenic
1164454866 19:28398577-28398599 ATGCCTTTCTAGGAAAAGCAGGG - Intergenic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1164893522 19:31846801-31846823 ATGGCTTTCTATAACAATGATGG + Intergenic
1165412507 19:35670588-35670610 CTGCCTGTCTAGAAAAATGAAGG - Intronic
1166946592 19:46401043-46401065 ATGCCTTCCTATGAGAAGGAGGG - Intergenic
925493616 2:4422700-4422722 ATCACTTTATAGAAGAAAGAAGG + Intergenic
926281540 2:11451946-11451968 ATGGCTGTCTAGAACAAAGACGG - Intronic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
926563056 2:14438732-14438754 AGGGCTTTCTAGATGTATGATGG - Intergenic
928275258 2:29894775-29894797 TTGCTTTTCTAGGAGGATGACGG + Intronic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
928459323 2:31456095-31456117 ATGTCTTTCTATTAGAAAGAGGG - Intergenic
930325763 2:49915161-49915183 ATGTGATACTAGAAGAATGAAGG + Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
934055710 2:88249926-88249948 ATGCTTTCCTAGAAAAATAAAGG + Intergenic
937038359 2:118801371-118801393 ATGCCTGTCCAGAAGAAGGCAGG + Intergenic
937225188 2:120364722-120364744 ATGCTCTTTTTGAAGAATGACGG - Intergenic
938203502 2:129397443-129397465 ATGGCTTTCTTGAAGGAAGAGGG + Intergenic
938705767 2:133924189-133924211 ATGGCTTTCAAGAAGGATGAAGG + Intergenic
939668431 2:144979324-144979346 TTGGGTTTCTACAAGAATGAAGG + Intergenic
939741219 2:145909236-145909258 ATTCTTTGCTAGTAGAATGAAGG + Intergenic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
942835321 2:180288889-180288911 ATGCCTTTGTTGGAGAATGTAGG + Intergenic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944796881 2:203196026-203196048 AGGCCTTTCTGTAACAATGATGG + Intronic
945111840 2:206367387-206367409 ATTGCTTTCTAGAAAAATAAAGG + Intergenic
945382223 2:209154529-209154551 AAGTCTTTCTAGATGAAAGAAGG - Intergenic
945524653 2:210873104-210873126 CTGATTTACTAGAAGAATGAAGG - Intergenic
946097714 2:217290073-217290095 TTGCCTTTCAAGAAGATTAATGG - Intronic
1169435998 20:5590902-5590924 ATGTATTTCTACAAAAATGAAGG + Intronic
1170396390 20:15930578-15930600 AATGCTTTCTAGAAGAATGCTGG - Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1172307776 20:33893764-33893786 GTGCCTCTCTGGAAAAATGAAGG + Intergenic
1172689486 20:36780455-36780477 CTTCCTTTTTAAAAGAATGATGG - Exonic
1172963070 20:38812355-38812377 GTCCCTTTCTAGTGGAATGAAGG + Intronic
1174496664 20:50949283-50949305 ATTCCTTCCTAGAAAAATGTAGG + Intronic
1175759024 20:61548763-61548785 ATTTCTTTTTAGAAGAATAATGG - Intronic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177411374 21:20734352-20734374 ATGGCTTTCTAGTCGAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1177747498 21:25236781-25236803 AAACTTTCCTAGAAGAATGAAGG + Intergenic
1177900957 21:26914504-26914526 ATTCCTTTCTAGAAGATCTAAGG + Intergenic
1178235906 21:30841012-30841034 ATTCTTTTCTTTAAGAATGAAGG + Intergenic
1179180385 21:39039700-39039722 TTCCCTGTCTAGAAAAATGAAGG + Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
949655278 3:6210708-6210730 ATGCTATTTTAGAAGAAAGATGG + Intergenic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
950869221 3:16214143-16214165 ATGCCTTCCTGGAGGAACGAAGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951636933 3:24789648-24789670 ATGCCTTTCTAAAAACATGGTGG + Intergenic
951841564 3:27039463-27039485 ACGCCCTTTTAGAAGAATGAAGG + Intergenic
952822265 3:37495609-37495631 TGGCCTTTCTAGAAGCATGATGG - Intronic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
959034806 3:101348563-101348585 ATGCCTTAGGAGAAGAAAGATGG - Intronic
960044886 3:113187041-113187063 ATCCCTTTGGGGAAGAATGAGGG - Intergenic
962548768 3:136466848-136466870 ATTCTTTTCTTGAAGAATGTTGG - Intronic
962568391 3:136687697-136687719 TTGTCTTTCTAGAAAAATGAAGG + Intronic
962850572 3:139305731-139305753 ATGCCTTTCTTGCAGGGTGACGG + Intronic
963542289 3:146607985-146608007 CTGCCTTCCTAGAAGAACGATGG + Intergenic
964171861 3:153779980-153780002 ATTCCTGTAAAGAAGAATGAGGG + Intergenic
964173989 3:153803471-153803493 CTGCCTTTCTAGGAGAACTAGGG + Intergenic
964284785 3:155106360-155106382 ATGCCTTGGTTGAAGAAAGATGG - Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965428787 3:168561211-168561233 CAACCTTTCTAGAAGACTGAGGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
970162552 4:13203906-13203928 AATCCTTTCTTGAACAATGAAGG + Intergenic
971035019 4:22683553-22683575 TTTCTTTTCTAGAATAATGAGGG - Intergenic
971939436 4:33196389-33196411 ATGCATTTTTAGAAGTAGGATGG + Intergenic
972153471 4:36126131-36126153 ATGACTCTCTATAAGAAAGAGGG + Intronic
972339024 4:38134784-38134806 ATGCCTTTATTGAGGAATGTAGG - Intronic
972670237 4:41208150-41208172 ATGCCATTGTTGAAGAAGGAAGG - Intronic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973714196 4:53658727-53658749 ATGCCTTTTTAAAAGAATTAAGG + Intronic
974176056 4:58326586-58326608 ATGCTTTTCTAGAGTAACGATGG + Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
975062929 4:70025727-70025749 AGGCCATTTTAGAAGACTGATGG - Intergenic
975063007 4:70026720-70026742 AGGCCATTTTAGAAGACTGATGG + Intergenic
975064850 4:70047985-70048007 AAGCCATTTTAGAAGACTGATGG - Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
976330561 4:83826393-83826415 ATGCCTTTATAAAAAGATGAAGG - Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979296245 4:119035331-119035353 CTGCCCTCCTAGAAGACTGAGGG - Intronic
979481014 4:121217544-121217566 ATGCCTTTCTGGATGACTGGAGG + Intronic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981742978 4:148022434-148022456 ATGACTTTATTGAAGAATGAAGG + Intronic
981759279 4:148175469-148175491 AAGCTTTTGTGGAAGAATGATGG - Intronic
982550722 4:156795822-156795844 AATCTTTTCTAGAAAAATGAAGG + Intronic
987535947 5:19187690-19187712 GTGTCTTTATAGAAGAATAATGG - Intergenic
988722329 5:33891515-33891537 TCACCTTTCTATAAGAATGAAGG + Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990633165 5:57693106-57693128 ATGTCTGTCTAGAAGGATTAAGG - Intergenic
991980208 5:72222471-72222493 ATACATTTGTAGAGGAATGAGGG + Intronic
992282248 5:75191619-75191641 ATGCATTTCTAGAATAATTTAGG + Intronic
992689637 5:79230122-79230144 ATGCCTTTTCAGAAGGAAGATGG - Intronic
992834553 5:80627312-80627334 ATAACTTTCTAGAATTATGAAGG + Exonic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
994635698 5:102342488-102342510 ATGCATTTCCAGACAAATGAGGG + Intergenic
996233423 5:121095639-121095661 ATGCCCTGCTGGAAGCATGAGGG - Intergenic
997073982 5:130650221-130650243 ATGCCTATCTAGGACAATAAAGG - Intergenic
997779973 5:136647181-136647203 ATTCCTATCTAGAAGATTGCAGG + Intergenic
998606420 5:143639832-143639854 CTACCTTTCCAGAAGAAAGAAGG - Intergenic
998667745 5:144317624-144317646 ATGCATTCCTAGAAGAAATAAGG - Intronic
998733930 5:145113134-145113156 ATGTATTTCTAGAGGAATCATGG - Intergenic
1000345331 5:160309597-160309619 TCGCCTTTCTTGAGGAATGAGGG - Intronic
1000648984 5:163792444-163792466 ATGACTAGCTAGAAGAAAGATGG - Intergenic
1001724416 5:173885029-173885051 ATCCCTGTCTAGTACAATGAGGG - Intergenic
1004314310 6:14572626-14572648 AGGTGTTTCTAGAACAATGAGGG + Intergenic
1004469705 6:15918519-15918541 TTGCATTTCTAGAAAAATGCGGG - Intergenic
1004873627 6:19933242-19933264 CTGCCTGTTTAGATGAATGAGGG - Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1005877328 6:30021242-30021264 ATGCCTTGCTAGTTGAAAGATGG - Intergenic
1006006923 6:31010139-31010161 AGGCCTTTGTAGAAGAAAGAAGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007322320 6:41036666-41036688 AGGCCTTTCTGGCAGAAGGAGGG - Intronic
1008018899 6:46553429-46553451 ATTCCTTTCTAGAAAAATAAGGG + Intronic
1008881555 6:56385365-56385387 ATTCCTTTCTGGAAGCTTGAGGG + Intronic
1009303280 6:62054565-62054587 ATGTCTTTTTAAAAGAAAGAAGG + Intronic
1009595540 6:65730525-65730547 ATCCCTTGCTAGATGAGTGATGG + Intergenic
1009760106 6:67994492-67994514 GTGCCTTTCTAGCAGCATGTTGG - Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012219468 6:96630877-96630899 ATGCTTTGCAGGAAGAATGAGGG - Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG + Intergenic
1015913343 6:138190124-138190146 CTGCCTTTCTAGTATCATGATGG - Intronic
1017454733 6:154591230-154591252 ATGCCAATCTGTAAGAATGAGGG - Intergenic
1018253684 6:161896898-161896920 ACGCCTTTCTACAACAATGACGG - Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1021811594 7:24407055-24407077 CTGCATTCCTAGAGGAATGAAGG + Intergenic
1025259813 7:57411334-57411356 ATGCATTCCAAGAAGACTGAAGG + Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1027760599 7:82274150-82274172 ATGCCATTCTAGGAAAAGGAGGG - Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1028212934 7:88097487-88097509 ATTCCTTTTTTGAAGAAGGAAGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1031934502 7:127722504-127722526 ATGCCTTTATACAAAAAGGATGG + Intronic
1032938331 7:136759957-136759979 GTGCCTTTCTAGAAAAGGGAGGG + Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1035231017 7:157465540-157465562 AAGCCTTTATATTAGAATGACGG + Intergenic
1037329712 8:17732375-17732397 AAGCCTTTCAAGAAGAAAGGAGG - Intronic
1037429074 8:18790600-18790622 ATGTTTTTATAGAAGAATGTTGG - Intronic
1038811138 8:30845690-30845712 ATGCCTTTCTAGGAAAAGTATGG - Exonic
1039332757 8:36557381-36557403 ATGCTTTTCTAGAAGGATATGGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1042406344 8:68409629-68409651 ATTCCTTTCTTCAAGAATTAAGG - Intronic
1044130413 8:88516701-88516723 ATGTATTTCTAGCAGAATGTTGG + Intergenic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1046362010 8:113172042-113172064 ATGCCATTCTATGAGAATTAGGG + Intronic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1047949260 8:129916165-129916187 AAGCCTTTGTAGAAGAAAGTTGG - Intronic
1049774681 8:144398861-144398883 ATGCTCTTCTAGAATGATGATGG + Exonic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050547634 9:6722168-6722190 AAGCCTTTTTGGAAGAAAGAGGG + Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050686456 9:8175436-8175458 ATGCGTTTCTAGCAGCATGCAGG - Intergenic
1052037469 9:23699056-23699078 ATGTCTTTCTATAGGAGTGAAGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058151393 9:101467370-101467392 ATTCCTTTCTTGAAGAGTAAAGG + Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1059972213 9:119679437-119679459 CTGACTTACTTGAAGAATGAGGG + Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186219531 X:7334620-7334642 GTGGCTTGCTAGAAGAGTGAGGG - Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187014539 X:15313087-15313109 AAGTCTTTCTATAAGAATGTAGG - Intronic
1187794861 X:22992873-22992895 ATGCCCTTTTTGTAGAATGATGG - Intergenic
1188803077 X:34555539-34555561 ATGCCTTTCTAGAAAAGTCAAGG - Intergenic
1189187686 X:39068333-39068355 ATGACTTTCTAGAAAACTGTAGG - Intergenic
1189664623 X:43340546-43340568 ATGCCTATCCAGAAGGGTGAAGG - Intergenic
1189799832 X:44681993-44682015 ATGCATTTATAGAAGCATGGGGG + Intergenic
1190325055 X:49201431-49201453 ATGAATTCCTAGAAGTATGAAGG - Intergenic
1191222146 X:58001022-58001044 ATTCCTTTCTTTAGGAATGAAGG - Intergenic
1192882725 X:75304249-75304271 ATTCCTTCCTAGAGGATTGATGG - Exonic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193343855 X:80383406-80383428 CTTCTTTTCTAGAAGAAAGAAGG - Intronic
1193500002 X:82263694-82263716 ATACTATTCTAGAAGAATAAGGG - Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1195551245 X:106174114-106174136 ATGAGTCTCTGGAAGAATGATGG + Intronic
1195653140 X:107308209-107308231 ATGCCTTTTTATAAGCATAAAGG + Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1197607721 X:128604914-128604936 ATGCATTTTTAAAATAATGAAGG + Intergenic
1197883876 X:131197508-131197530 ATGCCCTTCTGGAAGAATAGAGG + Intergenic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1198735752 X:139783421-139783443 ATGCCTTTCTGACAGACTGAAGG - Intronic
1199441447 X:147872845-147872867 CTATCTATCTAGAAGAATGAAGG - Intergenic
1199522025 X:148746800-148746822 ATTCCTTTCTGGCAGACTGAGGG + Intronic
1199882928 X:151989670-151989692 ATGCTTTTCTAAAAGCATCAAGG - Intergenic
1200407576 Y:2829125-2829147 ATGCCTTTCAGGAAGAGTGAAGG + Intergenic
1200820543 Y:7578185-7578207 ATGCCTATCTACACCAATGAGGG - Intergenic
1201230889 Y:11863235-11863257 ATGCCTATCTACACCAATGAGGG - Intergenic