ID: 1195474995

View in Genome Browser
Species Human (GRCh38)
Location X:105275481-105275503
Sequence CCATCCTGTAAGCTCCTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 3, 3: 67, 4: 359}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195474992_1195474995 -4 Left 1195474992 X:105275462-105275484 CCATTGTTTATTTTTTCAACCAT 0: 1
1: 0
2: 6
3: 126
4: 1115
Right 1195474995 X:105275481-105275503 CCATCCTGTAAGCTCCTTAAGGG 0: 1
1: 0
2: 3
3: 67
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195474995 Original CRISPR CCATCCTGTAAGCTCCTTAA GGG Intronic
901121255 1:6895913-6895935 CCATCCTATTAGCTCTTTTAGGG + Intronic
901782644 1:11604008-11604030 CCATCGTGTAAGCTCCTCGAGGG - Intergenic
902179757 1:14678904-14678926 CTAACCTGTAAGCTCCAAAAAGG - Intronic
902536043 1:17119797-17119819 CGATCCTGGAACCTTCTTAAAGG + Intergenic
902758055 1:18562279-18562301 CCATCCAGCAAACTCCCTAAGGG + Intergenic
903442451 1:23398490-23398512 CTAGACTGTAAGCCCCTTAAGGG - Intronic
903978468 1:27167605-27167627 CTAGACTGTAAGCTCCTCAATGG + Intergenic
904509366 1:30990265-30990287 CCAGATTGTAAGCTCCTTGAGGG - Intronic
904510913 1:31006838-31006860 ACATCATATAAGCTCCTTAATGG + Intronic
904748836 1:32728128-32728150 CCAGACTGTGAGTTCCTTAAGGG - Intergenic
904916156 1:33972056-33972078 CCAGCCTGGAACATCCTTAAGGG - Intronic
906967935 1:50477747-50477769 CTAGCCTGCAAGCTCCATAATGG + Intronic
907231615 1:53004648-53004670 CCATCTTGGAACCTTCTTAAAGG - Intronic
907345964 1:53780449-53780471 ACATCCTGTAAGCTCCCGGAGGG + Intronic
907395226 1:54185129-54185151 CTAGATTGTAAGCTCCTTAAGGG - Intronic
907406772 1:54258588-54258610 CCAGACTGTGAGCTCCTTGAGGG - Intronic
907624689 1:56017828-56017850 CCAGGCTGTAAGCTCCATAAGGG - Intergenic
908082174 1:60592890-60592912 CCCTCCTGAAAGCCCGTTAATGG + Intergenic
908743312 1:67350919-67350941 CCCTCCTGTCAGCTCCTGCAAGG - Exonic
908797022 1:67840289-67840311 TCATGCTGTAAGCTCCATGAGGG + Intergenic
908899915 1:68944706-68944728 TCATACTCTAAGCTCCTTGAAGG + Intergenic
909503994 1:76367320-76367342 CATTCCTGTAAGATCCTTGAGGG - Intronic
910355419 1:86347313-86347335 CTAAACTGTAAGCTCCTTAAGGG - Exonic
910918685 1:92319655-92319677 CTAGACTATAAGCTCCTTAAAGG - Intronic
911139642 1:94485325-94485347 CTAAAATGTAAGCTCCTTAAAGG - Intronic
911195059 1:94986237-94986259 CTACTCTGTAAGCTCCTTATGGG + Intronic
911903396 1:103533098-103533120 CCATCCTCTCATCTCCTCAAGGG - Intronic
911978850 1:104540076-104540098 TCATCCTGTAAGATTCTTAGAGG + Intergenic
912631283 1:111248687-111248709 CCAGGCTGTGAGCTCCTTGAGGG + Intergenic
912730290 1:112096290-112096312 CTAGACTGTAAGCTCCTTGAGGG - Intergenic
913263518 1:117022805-117022827 CCAGACTGGGAGCTCCTTAAGGG - Intronic
914936500 1:151985838-151985860 GCAGACTGTAAGCTCCTTGAAGG + Intronic
915040546 1:152964868-152964890 CCAGAGTGCAAGCTCCTTAAGGG - Intergenic
915374731 1:155383361-155383383 CAATCCTGTAAGCTCCATTCAGG + Intronic
915451912 1:156011292-156011314 CCAGCCTGTAAGATCTTTAATGG + Intronic
917272726 1:173296408-173296430 ACATATTGTAAGCTCCTTGAAGG - Intergenic
917645852 1:177028087-177028109 CCAGACTGTAAGCTTCTTAGGGG - Intronic
917706792 1:177642804-177642826 CAATCCTGTAAGCTGATTATGGG + Intergenic
917927398 1:179800624-179800646 CCCTCCTGTGAGCTCCTTGAGGG + Intronic
918420587 1:184360677-184360699 CTATCCTGTAAGTTCCTTGAAGG + Intergenic
918963353 1:191307222-191307244 CCATCATGCCAGCTGCTTAAGGG - Intergenic
919439054 1:197604440-197604462 GCATGCTGTAATCTTCTTAATGG - Intronic
920489443 1:206401856-206401878 CCAGACTGTAAGCTCCCTGAGGG - Intronic
921715815 1:218416329-218416351 CTATCCTGTAACCTCCTTTAGGG + Intronic
922327297 1:224539911-224539933 CCAGATTGTAAGCTCCTTGAGGG + Intronic
922888224 1:229036970-229036992 CCAAACTGTGAGCTCCTTAGAGG + Intergenic
922900817 1:229135133-229135155 CCATCCTCTAAACTCCAGAATGG + Intergenic
923005686 1:230047699-230047721 CTATCCTGTAAGGTCATGAAGGG - Intergenic
923305437 1:232684007-232684029 GCATACTCTAAGCACCTTAAGGG + Intergenic
923745154 1:236693377-236693399 CTTGGCTGTAAGCTCCTTAAGGG - Intronic
924373778 1:243385057-243385079 CTAGCCTGTAAGCTTCTGAAGGG - Intronic
1063638588 10:7809554-7809576 CCAGACTGTAAGCTCCTGCAAGG - Intergenic
1065152097 10:22832346-22832368 CTAGTCTGTAAGCTCCTTAAAGG - Intergenic
1065222949 10:23514615-23514637 CCATCCTGTAAATTTCTTCAGGG - Intergenic
1066007520 10:31159148-31159170 CCAGTCTCTAAGCTCCTTAAAGG + Intergenic
1067776367 10:49167550-49167572 CCAGCCTGTCTGCCCCTTAAGGG - Intronic
1070050919 10:72888878-72888900 TCAAATTGTAAGCTCCTTAAAGG - Intergenic
1070401580 10:76057468-76057490 CCAAACTGTAAGCTTCTTGAAGG - Intronic
1072555185 10:96509444-96509466 GCATTCTGTAAGCTCCTCAAAGG + Intronic
1072603437 10:96955011-96955033 CCATCCTGTAAGCTTCTTGGAGG - Exonic
1072826216 10:98609264-98609286 CTCTACTGTAAGCTCCTTGAGGG + Intronic
1072925017 10:99609538-99609560 CCAGACAGTAAGCTCCTTGAGGG + Intergenic
1074122639 10:110504519-110504541 CCATCCAGCCTGCTCCTTAAAGG + Intronic
1074163521 10:110854917-110854939 CCAGACCGTAAGCTCCTTGAGGG + Intergenic
1074198116 10:111207228-111207250 CCAGCCTCTAAACTCCTTTAAGG + Intergenic
1074212958 10:111354554-111354576 AGATACAGTAAGCTCCTTAAGGG + Intergenic
1074544419 10:114391596-114391618 GTAGGCTGTAAGCTCCTTAAGGG - Intronic
1074918621 10:117983686-117983708 CTAGACTTTAAGCTCCTTAAGGG + Intergenic
1075095176 10:119466466-119466488 CCTTCCTGTGAGGTCCTTCAGGG + Intergenic
1078171291 11:8930946-8930968 CCAGCTTGAAAGATCCTTAATGG - Intronic
1078489673 11:11757396-11757418 ACTACCTGTCAGCTCCTTAAAGG + Intergenic
1078956275 11:16198945-16198967 CCTACGTGTCAGCTCCTTAAGGG + Intronic
1079089373 11:17469946-17469968 CCAGACTGTAAGCTCCATGAAGG + Intronic
1080074023 11:28126761-28126783 CTAAATTGTAAGCTCCTTAAGGG - Intronic
1080819507 11:35791813-35791835 CTATACTGTGAGCTCCTGAATGG + Intronic
1081780512 11:45707804-45707826 CCAGACTGTAAGCCCCTTGAAGG + Intergenic
1083780547 11:64915240-64915262 CCAACCTGGAAGCTCCTGGAGGG + Intronic
1084521698 11:69667005-69667027 CCATCTTGTGGGCTCCTGAAGGG + Exonic
1085089436 11:73697721-73697743 CCAGAATGTAAGCTCCATAATGG + Intronic
1085114566 11:73919290-73919312 CCTTACTGTGAGCTCCTTTAAGG - Intronic
1085141587 11:74148770-74148792 CCATTCTATCAGCTCCTTACTGG + Intronic
1086114774 11:83237159-83237181 CAATACTGTAAACTCCTTGAGGG - Intronic
1086496701 11:87411369-87411391 TCATACTGTAAGCTCCATGAGGG + Intergenic
1087280745 11:96207269-96207291 CCATCTTTTAAGCCTCTTAAAGG + Intronic
1087906721 11:103706264-103706286 CTATACAGTAAGCTCCTTGAGGG - Intergenic
1088086074 11:105981973-105981995 CTAGACTGTAAGCTCCTTGAGGG + Exonic
1088236579 11:107731521-107731543 CCACACTCTAAGCTCCTTGAAGG + Intergenic
1089430037 11:118415662-118415684 CTAAACTGTAAGCTTCTTAAGGG + Intronic
1089501584 11:118934913-118934935 CCATCTTATAAGCCCCTTGAAGG - Intronic
1090104992 11:123843639-123843661 CTATACTGTAAGCTTCATAAGGG - Intergenic
1091637994 12:2212802-2212824 CCAGACTGTAAGCTCCATGAAGG - Intronic
1092777647 12:11958329-11958351 CCATCTTGTGAGCTCCTTGAAGG + Intergenic
1093478992 12:19585178-19585200 CTAGTCTGTGAGCTCCTTAAGGG + Intronic
1094019570 12:25899941-25899963 TTTTCCTGAAAGCTCCTTAAAGG + Intergenic
1096464901 12:51842886-51842908 ACATCTTGTGAGCTCCTTGAAGG + Intergenic
1096590793 12:52658039-52658061 CCCAACTGTAAGCTCCTTAGGGG + Intergenic
1096600918 12:52728490-52728512 CTAGACTGTAAGTTCCTTAAGGG + Intergenic
1096758868 12:53823111-53823133 CCAACCTGAAAGCACCTAAAAGG - Intergenic
1097067484 12:56331525-56331547 CTGTCCTGTAAACTCCTTGAGGG + Intronic
1097868234 12:64577892-64577914 CCCTACTGTAAGTTCCTTGAAGG - Intergenic
1100352505 12:93797884-93797906 CGATCCTGGAAGCCCCCTAAAGG - Intronic
1100374123 12:93996518-93996540 CCTACTTGTAAGCTCCTTTAGGG + Intergenic
1101074179 12:101111239-101111261 CCAGACTGGGAGCTCCTTAAGGG - Intronic
1101770924 12:107750163-107750185 CCAGACTGTAAGCTCCTTAAAGG + Intronic
1102894488 12:116587809-116587831 CCAAACTGTAAACTCCTTGAGGG - Intergenic
1103493025 12:121337839-121337861 CCAGACTGTAAGCTCCTTCCAGG + Intronic
1104175778 12:126331209-126331231 CCTGGCTGTAAGCTCCTTGAAGG - Intergenic
1104405327 12:128511887-128511909 CCAGCCTCTAGGCTCCTGAAAGG - Intronic
1105798182 13:23878962-23878984 CCAGACTGCAAGCTCCTTGAGGG - Intronic
1106454774 13:29917514-29917536 CCAGATTCTAAGCTCCTTAAGGG + Intergenic
1106491687 13:30230223-30230245 CCAAACAGTAAGCTCCTTGAAGG + Intronic
1107569278 13:41639506-41639528 CTAACCTGTAGGCACCTTAAAGG + Intronic
1108002017 13:45912366-45912388 CCAAGCCGTAAGCTCCATAAGGG - Intergenic
1108696128 13:52904164-52904186 CCAGACTGAAAGCTCCTTAAGGG - Intergenic
1110193520 13:72758759-72758781 CTATACTGCAAGCTCCTTGAAGG + Exonic
1112532128 13:100215364-100215386 CTATAGTGTAAGCTCCTTGAGGG - Intronic
1112590950 13:100762595-100762617 ACATCCTGCAAGCTGCATAAAGG + Intergenic
1112726298 13:102308485-102308507 ACATCCTGTAAGTTTCTTTAGGG - Intronic
1113557610 13:111251116-111251138 CCATCCTGTAAGCTGTCTAGGGG + Intronic
1115902902 14:38174214-38174236 CCAGACTGTAAGCTCCTTCTAGG + Intergenic
1119294426 14:73521445-73521467 ACAGGCTGTAAGCTCCTTAAAGG + Intronic
1119634706 14:76264560-76264582 CCAGACTGTAAGCTTCTTGAGGG - Intergenic
1122195191 14:100079441-100079463 CCAGCCTGTGAGCTCCTTGAAGG - Intronic
1125476887 15:40053814-40053836 CCAGCCTGTGAGCTCCTCCAGGG + Intergenic
1127194308 15:56567962-56567984 CAATCCTGAAAGCCCCATAAAGG - Intergenic
1127656595 15:61061574-61061596 CCAACCTCTAAGCCCCTTTATGG + Intronic
1128325446 15:66721048-66721070 CCAGACTGTAAGCTCCTTGAGGG + Intronic
1128679175 15:69635376-69635398 ACATCCTGTTAGCTCTTGAAGGG - Intergenic
1129224773 15:74162658-74162680 CCATACTGTGAGCTCCATGAAGG + Intergenic
1130548862 15:84876577-84876599 CTAGACTGTAAGCTCCATAAGGG - Intergenic
1130716792 15:86342830-86342852 CTATACTATAAGCTCCTTTAAGG - Intronic
1131279344 15:91008135-91008157 TCAGACTGTGAGCTCCTTAAGGG - Intronic
1131288889 15:91087417-91087439 CTAGACTGTAAGCTCCTTGATGG + Intergenic
1133618439 16:7502319-7502341 CAATGTTGTAAGCTCCTTAAGGG - Intronic
1133705185 16:8347780-8347802 CCATCCTATAAGCTCCATCAAGG - Intergenic
1133930840 16:10230954-10230976 CTAGCCTGTAAGCTCCATGAGGG + Intergenic
1138427031 16:56941948-56941970 CCAGTCTGTAAGGTCCTTGAAGG - Intronic
1139474113 16:67194064-67194086 CCATCTTGTATGCTCCTGACTGG + Intronic
1140680948 16:77384037-77384059 CCCTCCTATTAGCTCCTTAAAGG + Intronic
1142342749 16:89534742-89534764 CCTTCCTGCAAGCTCCCTGAAGG + Intronic
1142432872 16:90039994-90040016 CCACCCTGAAAGCTGCTTCATGG - Intronic
1143297959 17:5885397-5885419 CCATCCTGGGAGGTCCTTCAGGG + Intronic
1143992530 17:10978603-10978625 CTATATTGTAAGCTCCTCAAGGG - Intergenic
1144236217 17:13262857-13262879 CCATCCAGTATTCTCCTGAAAGG - Intergenic
1145974913 17:28978370-28978392 CTAGACTGTGAGCTCCTTAAGGG - Intronic
1146242887 17:31246566-31246588 CTAAACTGTAAGCTCCTTGAAGG - Intronic
1146272120 17:31491380-31491402 CCATCCTGCGAGCTCCTTGAAGG - Intronic
1146720913 17:35122825-35122847 CCAGACTGGGAGCTCCTTAAAGG - Intronic
1146979341 17:37145252-37145274 CAATCATCTCAGCTCCTTAAGGG + Intronic
1147871436 17:43590363-43590385 CCAAACTGTGAGCTCCTTGAAGG + Intergenic
1147954335 17:44123795-44123817 CCATCGTGACAGCTCCTTAAAGG + Intergenic
1148850595 17:50553000-50553022 CCATACTGTAAGCTTCATGAGGG - Intronic
1148999250 17:51740293-51740315 CTATACTGTAGGCTCCTTACAGG + Intronic
1149381483 17:56098559-56098581 CTATCACGTAAGCTCCATAAGGG + Intergenic
1150101587 17:62428764-62428786 CCAACCTGGAAGCTCATCAAGGG + Intronic
1150487381 17:65553164-65553186 CCAGACTGTAAGCTCCATGAGGG + Intronic
1153945864 18:10016876-10016898 CCATACTGAAAGAGCCTTAATGG - Intergenic
1154046908 18:10914904-10914926 CCAGCCTTTAAGCTCCTTTCAGG + Intronic
1154174754 18:12078124-12078146 CCAGCCTTTAAGCTCCTTTCAGG - Intergenic
1155147870 18:23098766-23098788 CCAGACTATAAGCTCCTTGAGGG - Intergenic
1155327360 18:24678219-24678241 CCAAACTGTGAGCTCCTTAAAGG - Intergenic
1155725082 18:29071500-29071522 CAATACTGAAAGCTCCTCAAGGG + Intergenic
1156278509 18:35608680-35608702 CCAAACTGTGAGCTCCTTGAGGG - Intronic
1157114919 18:44853395-44853417 CCATCCTGTGATATCTTTAAGGG - Intronic
1157188695 18:45562196-45562218 CTAGACTGTAAGCTCCTTAAAGG - Intronic
1157434656 18:47658190-47658212 CCAGACTGTAAGCTCCTTGAGGG + Intergenic
1157452268 18:47797741-47797763 CCAGCATGTAAGCTACTTGAGGG - Intergenic
1157486086 18:48088295-48088317 CCCTCCTTTGAGCTCCTGAAGGG - Intronic
1157904993 18:51561852-51561874 CCATCTTTTAAATTCCTTAAAGG + Intergenic
1158313697 18:56187428-56187450 CCTTCCTTTAAGTTCCTTGAGGG + Intergenic
1158602526 18:58866888-58866910 CCATCATGTAAGCTATTTACTGG - Intronic
1160135852 18:76271150-76271172 CTAGACTGTAAGCTCCTTGAGGG + Intergenic
1162959975 19:14119828-14119850 CCTTCCTGTTATCTCCTAAATGG - Exonic
1164010847 19:21202368-21202390 ACATGCTGTAGTCTCCTTAATGG - Intergenic
1166088181 19:40490656-40490678 CCACAATGTAAGCTCCTAAAAGG - Intronic
1168157468 19:54483808-54483830 CAATACTCTCAGCTCCTTAAAGG + Intergenic
1168391321 19:56010380-56010402 CTATGATGTAAGCTCCTTGAGGG - Intronic
925041416 2:734115-734137 GCATCCTGGAAGCTCATGAATGG + Intergenic
925812947 2:7718958-7718980 CCATCCTGTTAGCTTCTGATGGG + Intergenic
927282539 2:21322009-21322031 CCATGCTGTAAGCACTTTAGGGG + Intergenic
928261313 2:29769480-29769502 CCCACCTATAAGCTCCTTGAGGG + Intronic
929012105 2:37455268-37455290 CTGTCCTGTAAGCTCCCAAATGG - Intergenic
929469100 2:42173526-42173548 CCAGGCAGTAAGCTCCTAAAGGG - Intronic
930058076 2:47267299-47267321 CCACGTTGTAAGCACCTTAAGGG + Intergenic
930217570 2:48712278-48712300 CTATGCTGTAAGCTCCTGTAGGG + Intronic
930671936 2:54160480-54160502 CAAGACTGTAAGCTCCTTAAAGG + Intronic
930820056 2:55637348-55637370 CCAAGCTGCAAGCTCCTTGAGGG + Intronic
931638486 2:64361492-64361514 CCAGCCTGTCTGCTCCTGAAGGG - Intergenic
932320061 2:70815448-70815470 CTAGCCTGTAAGCTTCTCAAGGG + Intronic
934967768 2:98737854-98737876 CCAGACTGTAAACTCCTTGAAGG - Intergenic
935716189 2:105940889-105940911 CTAGACTGTAAGCTCCTTGAAGG - Intergenic
936018331 2:108976007-108976029 GCATCATGTAAGATCCTAAAAGG - Intronic
936966123 2:118129203-118129225 CTACCCTGTAATCTCTTTAAAGG + Intergenic
937448301 2:121976934-121976956 ACATCCTGAAATCTGCTTAAGGG - Intergenic
937634155 2:124137097-124137119 CCAGCCTATGAGCTCCTCAAGGG + Intronic
938643265 2:133304798-133304820 ACAGACTGTAAGCTCCTTGAGGG - Intronic
938746018 2:134278995-134279017 CCAGTCTGTAAGCTCCTCAAAGG + Intronic
939920123 2:148099966-148099988 CTAGGCTGTAAGCTCCTTGAGGG - Intronic
940329203 2:152456145-152456167 CCTTTCTCTAAGCTCCCTAAAGG + Intronic
941978804 2:171433465-171433487 CCATGCTCTAAGTCCCTTAAGGG - Intronic
943653419 2:190481602-190481624 CCAGACTGTAAGCTCCTTGGTGG + Intronic
944202244 2:197120189-197120211 CTACACTGTAAGTTCCTTAAAGG + Intronic
944279656 2:197881068-197881090 CCAGCCTGTGAGCTCCCTGAGGG + Intronic
944930659 2:204515869-204515891 CTATACTGTAATCTCCTTGAGGG + Intergenic
946155976 2:217806864-217806886 CCAGCCTGCAAGCTCCCCAAGGG - Intronic
946451764 2:219785938-219785960 CTTTACTGTAAGCTCATTAAGGG + Intergenic
947143394 2:227041189-227041211 CCATACTGTCAGCTCCATGAGGG + Intronic
947428646 2:230006617-230006639 CAAGAATGTAAGCTCCTTAAAGG - Intronic
947544547 2:231001556-231001578 CCACCCAGTAAGCTCCGTCAAGG + Intronic
948964826 2:241370862-241370884 CCATGCTGGATGCTCCTTGAGGG - Intronic
1168867023 20:1095372-1095394 CCATCCTGTCTGCCCCTTGAGGG - Intergenic
1169828157 20:9792058-9792080 CCAGACTGTAAGCACCTTGAGGG + Intronic
1169906074 20:10605368-10605390 CCAAACTGTAAGCTCCTTGAGGG - Intronic
1169988480 20:11473326-11473348 CCATCTTGTCTGCTCCTTACTGG - Intergenic
1170141640 20:13130780-13130802 CAATGTTGTAAGCCCCTTAAGGG + Intronic
1170729640 20:18962143-18962165 CCAAACTGTAAGCCCCTTGAAGG - Intergenic
1172880440 20:38196232-38196254 CCAGCCTCTAAGCTCCATAAGGG - Intergenic
1173217813 20:41102792-41102814 CCAGCCTATAAGTTCCTTAAGGG - Intronic
1174770767 20:53298007-53298029 CCATCCAAGAAGCTCCTTTATGG - Intronic
1175795822 20:61770105-61770127 CTGTCCTGGAAGCTCTTTAAAGG + Intronic
1175799851 20:61795410-61795432 CCTTCCTGGGGGCTCCTTAAAGG - Intronic
1176424251 21:6538240-6538262 CTGTCCTGTGAGCTCCTTGAGGG + Intergenic
1178098684 21:29242524-29242546 CCAGAGTGTAAGCTCCCTAAAGG - Intronic
1179699744 21:43146555-43146577 CTGTCCTGTGAGCTCCTTGAGGG + Intergenic
1181574031 22:23782756-23782778 CAATGCTCTAAGCTCCTTACTGG + Intronic
1181900113 22:26146895-26146917 CCAGACTGTGAGCTCCTTGAAGG + Intergenic
1182501951 22:30754454-30754476 CCAAACAGTGAGCTCCTTAAAGG - Intronic
1182896655 22:33864550-33864572 CAAGACTGTAAGCTCCTTGAGGG + Intronic
1183233490 22:36597938-36597960 CAAGTCTGTAAGCTCCTCAAGGG + Intronic
1183876534 22:40786990-40787012 CTAGACAGTAAGCTCCTTAAAGG - Intronic
1184743026 22:46440011-46440033 CCAGCCTGTGAGCTCCTGAAGGG + Intronic
949173290 3:1028647-1028669 CCACCCTGTAAACTCTTTGAGGG - Intergenic
949374897 3:3378241-3378263 CTAGCCTGTAAGCTCCATGAGGG - Intergenic
949379428 3:3428806-3428828 CCATGCTGTAAGCTTCCTGAGGG - Intergenic
949864420 3:8535750-8535772 CCCAACTGTAAGCTCCTTAAAGG + Intronic
949897944 3:8784091-8784113 ACATCCTCCAAGCTCCTTCAGGG + Intronic
950179827 3:10903502-10903524 CTAAAGTGTAAGCTCCTTAAGGG + Intronic
950488147 3:13285010-13285032 CAAGCCTGGAAGCTCCTGAAAGG - Intergenic
950764662 3:15264904-15264926 GCATTCTGACAGCTCCTTAAAGG - Intronic
950851795 3:16069272-16069294 CTAGCCTGTAAGCTCATGAAAGG - Intergenic
951027926 3:17849219-17849241 CTAGACTGTAAGCTCCATAAAGG - Intronic
951561737 3:23974503-23974525 TCAGAATGTAAGCTCCTTAAAGG + Intronic
953466746 3:43128432-43128454 CCATCTTGTAAGCTGCTCTATGG - Intergenic
953656688 3:44860021-44860043 CTAGCCTGCAAGCTCCTTGAGGG - Intronic
954858554 3:53667642-53667664 CAATCCTGTGAGCTGCTGAAGGG - Intronic
954867786 3:53744327-53744349 CCAGACTGTGAGCTCCTTGAAGG + Intronic
955537459 3:59939445-59939467 CCATGCTGAAAGTTCCTAAAAGG - Intronic
955799201 3:62668679-62668701 CTAGGCTGTAAGCTCCATAAGGG + Intronic
957729768 3:84118785-84118807 TCATCCTTTAAGCACCTGAAAGG + Intergenic
958899471 3:99868938-99868960 GCCAACTGTAAGCTCCTTAAAGG + Intronic
959010474 3:101070170-101070192 CCATCCTGTTATCTTCTTTAGGG + Intergenic
960721369 3:120627529-120627551 CCAGACTGTGAGCTCCTTAAGGG + Intergenic
960977907 3:123194282-123194304 CCATCCTGTGAGTGCCTTAAAGG + Intronic
961237105 3:125376051-125376073 CCAAACTGTGACCTCCTTAATGG + Intergenic
962196785 3:133370774-133370796 CTATACTATTAGCTCCTTAAAGG + Intronic
962505644 3:136044398-136044420 CTAGACTGTAAGCTCCTTACAGG - Intronic
963470954 3:145741017-145741039 CCATCCTGTAAGCAACCTACAGG + Intergenic
964795735 3:160495093-160495115 CTAGATTGTAAGCTCCTTAAGGG - Exonic
965167239 3:165210752-165210774 CCATACTGTAAACTCCTTAAAGG + Intergenic
965788901 3:172366600-172366622 CCAGACTGTGAGTTCCTTAAGGG - Intronic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
970465000 4:16313709-16313731 CCATGTTTTAAGCTCCTCAAAGG - Intergenic
970650095 4:18168174-18168196 TGATGCTGTAAGCTCCTTGAAGG - Intergenic
970663809 4:18314617-18314639 CTAGGCTGTAAGCTCCTTGATGG + Intergenic
971170037 4:24224645-24224667 CCATAATGTAAGCTCCTCAAGGG - Intergenic
971268737 4:25117493-25117515 CCCTACTGTTAGCTCCTTCAAGG - Intergenic
972630451 4:40837301-40837323 CCAACCTGAAGGCTCCTCAAAGG - Intronic
973248416 4:48035718-48035740 CCATTCTATCAGCTCCTTAATGG - Exonic
973559102 4:52116403-52116425 CTAGACTGTAAGCACCTTAAAGG + Intergenic
973963207 4:56132702-56132724 CCATACTGTAAGCTTCTAGAGGG + Intergenic
974681848 4:65175055-65175077 CTCTCTTGTAAGCTCCATAAAGG - Intergenic
975664834 4:76725371-76725393 GCAGAATGTAAGCTCCTTAAAGG + Intronic
975743336 4:77452051-77452073 CCATCCTTTAAGCTCCAATATGG - Intergenic
976346059 4:84002986-84003008 CTAGACTGTAAGCTCCATAAAGG - Intergenic
976798788 4:88964302-88964324 CCATAATATAAGCTCCTTTAGGG - Intronic
978254840 4:106681524-106681546 CCATGCTGTGGGCTCCTAAACGG - Intergenic
978998236 4:115182450-115182472 TCATCCTCTAAGCTCCTATAGGG + Intergenic
979465999 4:121039307-121039329 GCACCCTGAAAGCTCTTTAAGGG - Intronic
979817663 4:125129811-125129833 ACATCCTTGAAGCTCCTTATAGG - Intergenic
980912918 4:139009713-139009735 CCCTCCTGCCAACTCCTTAAAGG + Intergenic
981675888 4:147342473-147342495 CAATCCTGCAAGCTCCATCAAGG + Intergenic
982089971 4:151871990-151872012 TCATCTTGTAAGTTCCTTAAGGG - Intergenic
982786448 4:159542853-159542875 CTACCCTGTAAGTTCCTTTAGGG - Intergenic
983250555 4:165341074-165341096 CCTTCCTCTAAGCTCCTCAAAGG + Intronic
985982453 5:3482183-3482205 CCATGCTATAACTTCCTTAAAGG + Intergenic
987743389 5:21938356-21938378 CCAGACTGTAAGCTCCTTGAAGG - Intronic
990943581 5:61228237-61228259 CCATAGTGCAAACTCCTTAAGGG + Intergenic
990963336 5:61417910-61417932 CCATCCTGTGATATCCTCAATGG - Intronic
991749523 5:69786143-69786165 CCAGACTGTAAGCTCCTTGAAGG + Intergenic
991763586 5:69948497-69948519 CCAGACTGTAAGCTCCTTGAAGG - Intergenic
991783739 5:70169632-70169654 CCAGACTGTAAGCTCCTTGAAGG + Intergenic
991801103 5:70365961-70365983 CCAGACTGTAAGCTCCTTGAAGG + Intergenic
991827497 5:70644085-70644107 CCAGACTGTAAGCTCCTTGAAGG - Intergenic
991842816 5:70823557-70823579 CCAGACTGTAAGCTCCTTGAAGG - Intergenic
991876185 5:71170007-71170029 CCAGACTGTAAGCTCCTTGAAGG + Intergenic
992123539 5:73618244-73618266 CTCTTCTGTAAGCTCCTGAAGGG + Intergenic
992980990 5:82171911-82171933 CTAGACTGTAAGCTCCTTGATGG - Intronic
993693942 5:91037583-91037605 CCAGACTGTTAGCTCCTTGAAGG - Intronic
995072235 5:107937620-107937642 TAATACTGTAAGCTCCTTGAAGG + Intronic
997791194 5:136763915-136763937 CCAGACTGGAAGCTCCTTAAAGG - Intergenic
998244953 5:140491765-140491787 TTAGACTGTAAGCTCCTTAAGGG + Intronic
998500101 5:142625123-142625145 CTAGACTGTAAACTCCTTAAAGG - Intronic
998515209 5:142747482-142747504 CTAGACTATAAGCTCCTTAAGGG - Intergenic
998592293 5:143490348-143490370 CCATCCTGTGAGCTCCTGGATGG - Intergenic
999508326 5:152221557-152221579 CCATACTGTAAGCTCCAAGAAGG + Intergenic
1000294532 5:159901585-159901607 CCTTCCTGAAAGCTTCTTGAGGG + Intergenic
1000614406 5:163411708-163411730 AGATCCTGTAAACTACTTAACGG + Intergenic
1001329752 5:170754025-170754047 CTATGCTTTAAGCTCCTTAAGGG + Intergenic
1002366476 5:178716558-178716580 CCAAAGTATAAGCTCCTTAAAGG - Intronic
1003367460 6:5488994-5489016 CCATACTGTAAGCTCCAGAAAGG - Intronic
1003464954 6:6370128-6370150 CCAGACTATAAGCTCCTTGAGGG - Intergenic
1003594344 6:7461110-7461132 CCATGCTGTAAGCACCGTGAGGG + Intergenic
1003853603 6:10250317-10250339 TCATCCTCTGAGCTCCTTCAGGG + Intergenic
1003878208 6:10456865-10456887 CCAGAATGTAGGCTCCTTAAAGG + Intergenic
1003927638 6:10891930-10891952 CCAGTCTATAAGCTCCATAAAGG - Intronic
1004172638 6:13308805-13308827 TCAAGCTGTAAGCTCCTTGAAGG - Intronic
1004264212 6:14134729-14134751 CCTAACTGTAAGCTCCTTGAGGG - Intronic
1004792348 6:19040755-19040777 CCATACTGTAAGTTCCTCAAAGG - Intergenic
1004895677 6:20145448-20145470 CCAAACTGTAAGCTCCATGAGGG + Intronic
1007635391 6:43296952-43296974 CCCTCCTGTAAGCTCCCTAAGGG + Intronic
1008760204 6:54844958-54844980 CCACCTTCTAGGCTCCTTAAGGG + Intergenic
1008951559 6:57165898-57165920 CCATCCTGCAAGCTCCATTCAGG - Intronic
1010890204 6:81298388-81298410 CTATAGTGTAAGCTCCTTGAAGG + Intergenic
1011717058 6:90117558-90117580 CTCAACTGTAAGCTCCTTAAGGG + Intronic
1012278606 6:97302392-97302414 CAATACTATAAGCTTCTTAAAGG - Intergenic
1012499888 6:99876674-99876696 CCATACTATAAACTCCTTGAGGG - Intergenic
1013489791 6:110635166-110635188 CCTTCCTGTAAACTCCTTAGTGG - Intronic
1013841496 6:114401301-114401323 CCAGACTGTGAGCTCCTTGAGGG - Intergenic
1014327572 6:120018195-120018217 CCATCCTCCAAGCTCCAGAATGG - Intergenic
1014708306 6:124775344-124775366 CCAGCCTTTAATCTCCTCAAAGG + Intronic
1015639676 6:135317629-135317651 CCAGCCTGTAAGCAACTTAAGGG + Intronic
1015863903 6:137708304-137708326 CCATCCTGTGAGCTCTGCAAAGG + Intergenic
1015980317 6:138831686-138831708 CCATACTGTAGGCTCCATAAAGG + Intronic
1017252634 6:152297465-152297487 ACACACTGTAAGCTCCCTAAGGG + Intronic
1017282512 6:152639275-152639297 TCATACTGTAAGCTCCATGAAGG - Intergenic
1017965195 6:159258256-159258278 CCAGACTGTAAGCTCCTTGAGGG - Intronic
1018949293 6:168368769-168368791 CCATCCAGGAAGCTCCTTTGGGG + Intergenic
1019975426 7:4577396-4577418 CCATCCTGTACTCTCCTCAATGG - Intergenic
1020724284 7:11789866-11789888 GTATCCTGTAAGCTCCTTGTAGG + Intronic
1021614815 7:22491346-22491368 CCATACTGCAAACTTCTTAAAGG - Intronic
1021867498 7:24972511-24972533 CTAGTCTGTAAGCTCCTTGAAGG + Intronic
1022121612 7:27313827-27313849 CTACAATGTAAGCTCCTTAAGGG + Intergenic
1022205421 7:28159019-28159041 TCAGCTTGTGAGCTCCTTAAGGG - Intronic
1022575012 7:31489055-31489077 CTAGACTGTAAGCTCCTTAAGGG - Intergenic
1022703579 7:32783378-32783400 CCATGGTGTAAGCTCCCTGAGGG - Intergenic
1023806401 7:43875992-43876014 CCAGACTGTGAGCTCCTTGAGGG - Exonic
1024839215 7:53565389-53565411 CCAGACTGTGAACTCCTTAAAGG + Intergenic
1026056219 7:66986041-66986063 CTAGACTGTGAGCTCCTTAAGGG - Intergenic
1026721867 7:72839027-72839049 CTAGACTGTGAGCTCCTTAAGGG + Intergenic
1028101133 7:86822282-86822304 CTATATTGTAAACTCCTTAAAGG - Intronic
1028601295 7:92603159-92603181 TCTTCCTGTAAGCTCCTGAAAGG + Intergenic
1030188033 7:106782267-106782289 CTATCCTGTCAGTTCCTTGAGGG + Intergenic
1030993620 7:116331620-116331642 CTATACTGTAAGCTCCATACGGG - Intronic
1031322178 7:120344907-120344929 CCCAGCTGTGAGCTCCTTAAGGG - Intronic
1031551459 7:123118949-123118971 CCACCCTGTAAGTTACTTACAGG + Intronic
1031974184 7:128083622-128083644 CTATACTGTGAGCTCCTTCAGGG - Intronic
1032030736 7:128481623-128481645 CCAACCTGGAAGCTCATCAAGGG + Intronic
1032161657 7:129515611-129515633 CCAGACTGGAAGCTCCTTGAGGG - Intergenic
1033001244 7:137507732-137507754 CAATTCTGTAAACTCCTTGAGGG - Intronic
1036528615 8:9559131-9559153 CTAGACTGTAAGCTCCATAAGGG - Intronic
1037990589 8:23319084-23319106 CCGTTATGTAAGCTGCTTAATGG + Intronic
1040441531 8:47448486-47448508 CCACACTGTGAGCTCCTTAAGGG - Intronic
1040676995 8:49762386-49762408 CTAGCTTGTAAGCTGCTTAAAGG + Intergenic
1044592960 8:93931681-93931703 CCAAACTGTGAGCTCCTTGAAGG - Intergenic
1045069794 8:98490566-98490588 CTATACTGTAAGTTCCTTGAAGG + Intronic
1045355491 8:101384947-101384969 TCATTCTCTTAGCTCCTTAAGGG + Intergenic
1045374380 8:101556780-101556802 CCATTCTGTGGGCACCTTAAAGG - Intronic
1045389700 8:101703375-101703397 CTGTCCTGTGAGCTCCTTCAAGG - Intronic
1045677725 8:104626737-104626759 CCAAACTGTAAGCTCTTTGAGGG - Intronic
1046126781 8:109920194-109920216 CCAGAGTGTAAGCTCCTTAAAGG - Intergenic
1046564536 8:115882434-115882456 CCAGCATGTAAGCTCCATGAGGG - Intergenic
1048034711 8:130666423-130666445 CCACACTGTAAGCTCCTCAAGGG + Intergenic
1048335002 8:133496155-133496177 CTGGCCTGTAAGCTCCTGAAGGG - Intronic
1048534817 8:135283433-135283455 CCATCCTGAGCGCTCCTTCATGG - Intergenic
1048566102 8:135599664-135599686 CTAGTCTGTAAGGTCCTTAAGGG - Intronic
1048865001 8:138753920-138753942 CCTTCCTCTGAGCTCCGTAAAGG - Intronic
1049720459 8:144113149-144113171 ACACCCTGCAAGCTCCTTACAGG - Intronic
1052093417 9:24356955-24356977 CCATCCTCTAAACTCCAGAATGG - Intergenic
1052403166 9:28026262-28026284 CTAGACTGTAAACTCCTTAAAGG + Intronic
1052678129 9:31652961-31652983 CCAGTGTGTAAGCTCCATAAAGG + Intergenic
1053167875 9:35857264-35857286 CCACCGTGTGAGCTCCTTCAGGG - Intergenic
1053405128 9:37867553-37867575 CTAGACTGTAAGCTCCTTGAGGG + Intronic
1053613754 9:39742873-39742895 CCATACTGTAACCTCCTGATGGG + Intergenic
1053871794 9:42500829-42500851 CCATACTGTAACCTCCTGATGGG + Intergenic
1054239761 9:62599524-62599546 CCATACTGTAACCTCCTGATGGG - Intergenic
1054553893 9:66634051-66634073 CCATACTGTAACCTCCTGATGGG - Intergenic
1054803778 9:69378865-69378887 CTAGACTGTGAGCTCCTTAATGG - Intronic
1054958455 9:70940536-70940558 CCATACTGTAAGCCCCATAAGGG - Intronic
1055231993 9:74077420-74077442 CCATCTTGAAAACTCCTTATTGG - Intergenic
1055502020 9:76910572-76910594 CTAGCCTGTGAGCTCCTTGAGGG - Intergenic
1058510493 9:105712758-105712780 CCATCATGTCAGCTGCTTCAGGG + Intronic
1058515675 9:105771913-105771935 CTAGTCTGTAAGCTCCTTGAGGG + Intronic
1058578632 9:106430756-106430778 CCAGGCTGAGAGCTCCTTAAAGG - Intergenic
1058839453 9:108892086-108892108 CCAGGCTGTGGGCTCCTTAAGGG - Intronic
1059127031 9:111699028-111699050 CTAGACTATAAGCTCCTTAAAGG - Intronic
1059624906 9:116052846-116052868 CCAAACGGTAAGCTCTTTAAAGG - Intergenic
1059993512 9:119887634-119887656 CCAGACTGTAAACTCCTTGAGGG - Intergenic
1060751042 9:126169752-126169774 CCAGCCTGTAAGCACCTCCAAGG - Intergenic
1185737943 X:2507328-2507350 CCTTCATGTAAGCTCCTCCAGGG - Intergenic
1185769621 X:2755659-2755681 CCCTCCTGTAACCTCCCTAAGGG - Intronic
1186788913 X:12978015-12978037 CCATTCTATAAGGTCCTTAATGG + Intergenic
1187213717 X:17254447-17254469 CCAGCCTGCAAGCTTTTTAAGGG + Intergenic
1187378866 X:18782145-18782167 CTATACTATAAGCTCCTTGAGGG + Intronic
1188439690 X:30203407-30203429 CCAGACAGTCAGCTCCTTAAAGG + Intergenic
1188567345 X:31542111-31542133 CCATTCCGTAAAATCCTTAAGGG - Intronic
1190171227 X:48113962-48113984 CCATACTGTGAGCTCCTTGAGGG + Intergenic
1190180918 X:48191503-48191525 CCCTACTGTGAGCTCCTTGAGGG - Intronic
1190183360 X:48213558-48213580 CCCTACTGTGAGCTCCTTGAGGG + Intronic
1190204060 X:48388081-48388103 CCCTACTGTGAGCTCCTTGATGG + Intronic
1190206476 X:48407322-48407344 CCCTACTGTGAGCTCCTTGATGG - Intronic
1190209319 X:48432293-48432315 CCCTACTGTGAGCTCCTTGATGG + Intergenic
1190371845 X:49750008-49750030 GCATTCTCTAAGCTCCTGAAAGG - Intergenic
1190389352 X:49916764-49916786 CTAGCCTGCAAGCTCCTTGATGG - Intergenic
1190655427 X:52607899-52607921 CCCTACTGTGAGCTCCTTGAGGG - Intergenic
1190663130 X:52673481-52673503 CCCTACTGTGAGCTCCTTGAGGG + Intronic
1190676293 X:52785001-52785023 CCCTACTGTGAGCTCCTTGAGGG - Intronic
1190753463 X:53381323-53381345 CCAGCCTGGAAGCTCCTGAGGGG - Intronic
1192596082 X:72409831-72409853 TCAGACTGTAAGCTCCTTGAGGG + Intronic
1193198273 X:78658488-78658510 CCTTCCTGAAAGCTGCTTACAGG + Exonic
1195474995 X:105275481-105275503 CCATCCTGTAAGCTCCTTAAGGG + Intronic
1195655660 X:107329264-107329286 CTAGACTGTATGCTCCTTAAGGG + Intergenic
1195761562 X:108251644-108251666 CTATAATGTAAGCTACTTAAGGG - Intronic
1197104804 X:122701360-122701382 CCATCCTGGAAGTTCCTGTAAGG - Intergenic
1197521409 X:127502344-127502366 CTATGCTGTAAGCTACTTAAAGG - Intergenic
1198493711 X:137169156-137169178 CCTTCCTGTCAGCTCCTTGTGGG - Intergenic
1198740725 X:139839542-139839564 CTATACTCTAAGCTCCTTGAAGG - Intronic
1199330855 X:146556409-146556431 CCTTCCTGTGAGATTCTTAAGGG + Intergenic
1201300891 Y:12503970-12503992 CCCTCCTGTAACCTCCCTAAGGG + Intergenic
1201755330 Y:17480890-17480912 ACATGCTGTAATCACCTTAATGG - Intergenic
1201846222 Y:18425095-18425117 ACATGCTGTAATCACCTTAATGG + Intergenic