ID: 1195475118

View in Genome Browser
Species Human (GRCh38)
Location X:105276613-105276635
Sequence CTGAAGTCTGGATTTTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195475115_1195475118 -2 Left 1195475115 X:105276592-105276614 CCTCTGATTTATAAGAGACACCT 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1195475118 X:105276613-105276635 CTGAAGTCTGGATTTTTGTGTGG 0: 1
1: 0
2: 1
3: 19
4: 228
1195475113_1195475118 13 Left 1195475113 X:105276577-105276599 CCAATATTACTAGGCCCTCTGAT 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1195475118 X:105276613-105276635 CTGAAGTCTGGATTTTTGTGTGG 0: 1
1: 0
2: 1
3: 19
4: 228
1195475114_1195475118 -1 Left 1195475114 X:105276591-105276613 CCCTCTGATTTATAAGAGACACC 0: 1
1: 0
2: 0
3: 14
4: 143
Right 1195475118 X:105276613-105276635 CTGAAGTCTGGATTTTTGTGTGG 0: 1
1: 0
2: 1
3: 19
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195475118 Original CRISPR CTGAAGTCTGGATTTTTGTG TGG Intronic
900851715 1:5148613-5148635 CTGAAGGCTGTATTTATGTGGGG + Intergenic
901698193 1:11026750-11026772 CTGGAGTCTGTTTTTTTGGGTGG + Exonic
901905420 1:12405261-12405283 CGGAAATCTGGATTTTTATGTGG + Intronic
902132981 1:14279975-14279997 TTGACATCTGGATTTTTGGGGGG - Intergenic
902429347 1:16351430-16351452 CCAGAGTCTGGATTTTTCTGTGG - Intronic
903960925 1:27057402-27057424 CTGGAGCCTGCACTTTTGTGTGG + Intergenic
905918873 1:41705739-41705761 CAGAAGTGTGGATATTTGTGAGG - Intronic
909053010 1:70790235-70790257 TTGAAATCAGTATTTTTGTGAGG + Intergenic
909346081 1:74589153-74589175 AGGGAGACTGGATTTTTGTGAGG + Intronic
910190690 1:84592197-84592219 CTGATGGCTGTATTTTTGTAGGG - Intergenic
910413234 1:86968366-86968388 TTGAAGTCTTGAGTTTTGTGTGG + Intronic
910557557 1:88552739-88552761 CTGAAGTCTGTAGATTTCTGGGG - Intergenic
912640788 1:111344032-111344054 CTGATATCTGGATTTTTCTGTGG + Intergenic
912865981 1:113256738-113256760 ATGAAGTCTGTATTTTGGTCAGG - Intergenic
915009011 1:152667177-152667199 CTGAGGTCTGGAGTGCTGTGGGG + Intergenic
916014768 1:160740218-160740240 CAGAAGTTTGTATTTTTGAGAGG + Intronic
917453436 1:175166131-175166153 CTGACTCCTGGATTTGTGTGGGG + Intronic
919701442 1:200635521-200635543 CTGATGTCTGTATTTTTTTTTGG + Intronic
921027781 1:211303580-211303602 CTAAATTTAGGATTTTTGTGGGG + Intronic
921224123 1:213000077-213000099 CTATAGTTTGGATTGTTGTGAGG - Intronic
921373761 1:214452029-214452051 CTGGAGTCTCGTTTCTTGTGTGG - Intronic
922087755 1:222367528-222367550 GTGAACTTTGGATTTTTGTCAGG - Intergenic
922246289 1:223801319-223801341 ATGCAGTCTGGATTTTATTGTGG - Intronic
922329676 1:224563303-224563325 GTGAAGTGTTGATTTTTGGGGGG + Intronic
924749937 1:246877272-246877294 TTGAAGCCTGGAATTTTTTGCGG - Exonic
1063208465 10:3856881-3856903 CTTGAGTTTGGATTTTAGTGCGG + Intergenic
1066685253 10:37975852-37975874 GTCAAGACTGGATTTTAGTGTGG + Intronic
1069298840 10:66881445-66881467 TTGTAGGCTGAATTTTTGTGAGG - Intronic
1075971359 10:126656588-126656610 CTGAAGTATGTAGTATTGTGTGG - Intronic
1078235534 11:9481391-9481413 CTGAAGTCTCATTTTTTGGGAGG - Intronic
1079161231 11:17996086-17996108 CTGAAGACTGGATTTGTGATTGG - Intronic
1079571746 11:21952306-21952328 CTGAAGTCTAGAGTGTTCTGTGG + Intergenic
1080038186 11:27731065-27731087 CTGCTGTGTGGAGTTTTGTGAGG + Intergenic
1080841453 11:35987215-35987237 CTGAAGTCTGCATATTTTTAGGG + Intronic
1081024426 11:37992320-37992342 CTGAATCCAGGATTTTTATGGGG + Intergenic
1081325369 11:41738009-41738031 CTGGATTTTGGATTTCTGTGGGG - Intergenic
1082184190 11:49160136-49160158 CTGATGTTTGTATTTCTGTGGGG + Intronic
1083054768 11:59809539-59809561 CTGAAATCTGGATTTTTGAGCGG - Intronic
1083569769 11:63752876-63752898 GTGAAGTCTGTAGTTTTCTGAGG - Intronic
1083688892 11:64394578-64394600 CAGAAGTCTGGTTTCGTGTGGGG + Intergenic
1084946510 11:72641754-72641776 CTGAAGTCCAGATGTTTGGGTGG + Intronic
1085430074 11:76440296-76440318 CTGAGGTCTGGAATCTTATGAGG - Intergenic
1085903187 11:80727122-80727144 CAGAAGTGTAGAGTTTTGTGAGG + Intergenic
1085953270 11:81359112-81359134 CAAAAGTCTAGATTTTTGTGGGG + Intergenic
1086682158 11:89685238-89685260 CTGATGTTTGTATTTCTGTGGGG - Intergenic
1087808889 11:102588682-102588704 ATGCTCTCTGGATTTTTGTGGGG + Intronic
1088703058 11:112431667-112431689 CTGATGGTTGTATTTTTGTGGGG + Intergenic
1088717062 11:112558106-112558128 CTTTATTCTGGATTATTGTGTGG + Intergenic
1090159307 11:124475545-124475567 CTGAAGTATGGTTTTCTGGGAGG + Intergenic
1093842339 12:23919279-23919301 CAAAAATCTGGATTTTTATGAGG + Intronic
1095246633 12:39930770-39930792 CTGAAGTCAGAATATTTATGTGG - Intronic
1098599765 12:72317267-72317289 CTGTAGTTTGTATTCTTGTGGGG + Intronic
1098667709 12:73184506-73184528 CTGATGTTTGTATTTCTGTGGGG + Intergenic
1099001938 12:77188459-77188481 CTTAAGACTTGATGTTTGTGTGG - Intergenic
1103557995 12:121777461-121777483 CAGAAATCTGGATTTTTATGTGG - Exonic
1105911107 13:24868569-24868591 CTGAAATTTGAATTTTTCTGTGG + Intronic
1106410601 13:29508608-29508630 CTGTGGTCTGGCTTTCTGTGTGG + Intergenic
1107158700 13:37199540-37199562 CTGAACTTTGAATTTTTGTTTGG + Intergenic
1107784991 13:43946558-43946580 ATGAAATCTGGTATTTTGTGGGG + Intergenic
1108197655 13:48010896-48010918 CTGAAATCTGGTTTTTCCTGAGG - Intergenic
1109049004 13:57453763-57453785 CTGAAATATGTATTTTGGTGTGG + Intergenic
1109683738 13:65785584-65785606 CTGAAGACCTGACTTTTGTGTGG + Intergenic
1109722546 13:66294330-66294352 GTGATGTGTGGAGTTTTGTGGGG + Intergenic
1110323441 13:74186374-74186396 CTGAACACTGGACTTTGGTGAGG - Intergenic
1110536759 13:76659446-76659468 CTACAGTTTGGTTTTTTGTGTGG + Intergenic
1111451186 13:88419582-88419604 CTGAAGTCTGAATTTCCATGTGG + Intergenic
1111457579 13:88505280-88505302 CTGATGGTTGCATTTTTGTGGGG + Intergenic
1112397111 13:99043362-99043384 CTGAAGCCTGGGCATTTGTGGGG + Intronic
1116240986 14:42342180-42342202 CTGGATTGTGGAATTTTGTGTGG + Intergenic
1116265106 14:42677913-42677935 ATGAAGTCTGGACTTTAATGTGG + Intergenic
1116585779 14:46701371-46701393 CTGAAGTCTGTACATCTGTGCGG + Intergenic
1116904500 14:50391855-50391877 CTGAAGACAGGTTTTTTTTGTGG - Intronic
1117001928 14:51379292-51379314 CTGAAGTCCATATTTTGGTGGGG - Intergenic
1118243522 14:64084869-64084891 CTGAAGGCTCGACTTGTGTGAGG + Intronic
1118663823 14:68044871-68044893 CAGAAAGCAGGATTTTTGTGAGG + Intronic
1120454942 14:84718767-84718789 CAGAAGTTTGGATTTCTGTCTGG - Intergenic
1121843461 14:97153702-97153724 CTGAAGTGTCAATTTTTGTCAGG + Intergenic
1122413666 14:101538469-101538491 CTGTAGGATGGATTGTTGTGGGG - Intergenic
1126742002 15:51786797-51786819 CTAAACTCTTGATTTTTATGTGG - Intronic
1127247895 15:57197711-57197733 TTGAAGTCTTGATTTTTTTCTGG + Intronic
1128037332 15:64538512-64538534 GTAAAGTGTGGATTTTTGTTTGG + Intronic
1129873208 15:78954950-78954972 CTGGAGTCTGGAGTGATGTGTGG + Intergenic
1130423687 15:83774402-83774424 CTGGAGTTTGGATTTTGTTGAGG + Intronic
1131637351 15:94250447-94250469 ATGAACACTGGATTTTTGTATGG + Intronic
1132355958 15:101171486-101171508 CTGCAGTTTGGATTTTTGAACGG - Intergenic
1132426100 15:101718595-101718617 CTATTGTCTGGATTTATGTGTGG - Intronic
1133360957 16:5173462-5173484 CTGAAGTCAAGATGTTGGTGGGG + Intergenic
1133835665 16:9365323-9365345 TTGTAGTCTGGATTTTTATGTGG - Intergenic
1135564137 16:23498942-23498964 CTGAAGTCAGAATTCTTTTGAGG - Intronic
1136384746 16:29916807-29916829 CTGCAGTCTGGATTTTGGCTAGG + Intronic
1137002953 16:35247281-35247303 CTGAAGTATGGTCTTTGGTGGGG - Intergenic
1137380090 16:47990251-47990273 GTGAAGTCTCTATTTTTGTTGGG + Intergenic
1138335429 16:56249265-56249287 GTGAAGTCAGGAGTTTTGTTTGG + Intronic
1140627832 16:76815657-76815679 CTGCAGTCTGGTATTTTGTCTGG - Intergenic
1141105538 16:81230475-81230497 CTAAACTCAGGATTATTGTGAGG + Intergenic
1144850409 17:18241284-18241306 GTGAAGTCTGGAGTTTAGTGGGG + Intronic
1150144319 17:62755048-62755070 CTGTAGAGTGGATTATTGTGAGG - Intronic
1154469187 18:14682000-14682022 TTGAAGGCTGGATTATTGGGAGG - Intergenic
1156456213 18:37296066-37296088 CTGGAATGAGGATTTTTGTGGGG - Intronic
1156691520 18:39712797-39712819 CTGATACCTGGATTTGTGTGAGG + Intergenic
1157924572 18:51749301-51749323 CTGAAGTGGGGGTATTTGTGAGG + Intergenic
1160867773 19:1263264-1263286 CTGCAGGCTGGAGTTTTGTTTGG - Intronic
1164537860 19:29099643-29099665 CTCAAGTCTGGAATCTTGGGTGG + Intergenic
1165552719 19:36602502-36602524 CTGTAGCCTGTATTTTTGTATGG - Intronic
926121625 2:10244125-10244147 CAGAAGTCTGGTTTTTCCTGTGG + Intergenic
926836417 2:17028458-17028480 CTGAATTCTGGATGATTTTGAGG - Intergenic
927591541 2:24361305-24361327 TTGAAGTCTGGTCTTTTGTGAGG - Intergenic
928618859 2:33069205-33069227 CGGAAGTCTGGCTTTGAGTGGGG - Intronic
929083550 2:38146151-38146173 CTGAAAGTTGTATTTTTGTGAGG - Intergenic
930199772 2:48541724-48541746 CTGTATTCTGTTTTTTTGTGTGG - Intronic
930568869 2:53059331-53059353 CGGAAGTCTTTATTTTTATGAGG + Intergenic
931560779 2:63558615-63558637 CCGATGTTTGTATTTTTGTGGGG - Intronic
932272563 2:70423705-70423727 CTGGAGTCAGGATTGTTGTAAGG - Intergenic
932786443 2:74608547-74608569 CCCAAGTGCGGATTTTTGTGTGG + Intronic
932866643 2:75350181-75350203 CTGAAGCTGGGATTTTTGTCTGG - Intergenic
933396412 2:81737268-81737290 CTGTAGTCTAAATTTTTTTGGGG + Intergenic
933949688 2:87317932-87317954 TTGATGTCTGGACTTTTATGAGG - Intergenic
934011947 2:87830085-87830107 CTGAATTTTGGACTTTTATGTGG - Intergenic
936237740 2:110758497-110758519 CTGATGGCTGTATTTTTGTGGGG + Intronic
938227204 2:129626283-129626305 CTGAAGTTTGGGTTTTTGGGAGG + Intergenic
939012225 2:136860149-136860171 CTGAATTCATGATTTTTTTGAGG + Intronic
939969076 2:148640266-148640288 CTGGACTTTGGATTTTTGAGAGG - Intergenic
941118832 2:161504989-161505011 TTGAAGCCTGGAATTTTTTGCGG - Intronic
942271031 2:174275440-174275462 TTAAAGACTAGATTTTTGTGGGG - Intergenic
942352867 2:175071727-175071749 TTGAATTCTGGATTGTTTTGAGG + Intergenic
942622117 2:177856194-177856216 TTGAAGTCTGTATTTTTGGGAGG - Intronic
942908398 2:181210642-181210664 TTGAAGTCTCTATTATTGTGTGG - Intergenic
943000655 2:182324278-182324300 TTGAAGTCAAGATTCTTGTGAGG - Intronic
943846803 2:192660178-192660200 CTGAGGGCTAGATTTTGGTGTGG + Intergenic
944451086 2:199843397-199843419 CTGAACTCTTCATTTTTGTGTGG + Intronic
944959023 2:204848018-204848040 CTGGACTCTTCATTTTTGTGAGG - Intronic
947691966 2:232146735-232146757 ATGAAAACTAGATTTTTGTGAGG + Intronic
948303125 2:236923853-236923875 ATGAAGTGTGTATTTTTATGTGG + Intergenic
1168751535 20:285325-285347 CTGAAGCAGGGATTTTGGTGAGG - Intronic
1169514200 20:6298391-6298413 CTAAAGTCTTGATTTTTCTGGGG + Intergenic
1170487038 20:16828855-16828877 CTGCAGTCTGAATTTCAGTGGGG + Intergenic
1170773825 20:19358169-19358191 CTGCAATCTGGATTTTTGACAGG - Intronic
1170871386 20:20209856-20209878 CTGAACTCAGGATTCCTGTGAGG - Intronic
1171952810 20:31436432-31436454 CTGAAGGCTGGGTTTATCTGGGG - Intergenic
1173163695 20:40671282-40671304 CTGGAGTCTGGCATCTTGTGAGG - Intergenic
1173574272 20:44100583-44100605 CTGCAGCCTGGATTCTCGTGGGG - Intergenic
1175279765 20:57795183-57795205 CTGAGGTTGGAATTTTTGTGGGG + Intergenic
1175473026 20:59246646-59246668 CTGAATTCAGGATTTCTGTGAGG + Intronic
1176805321 21:13475655-13475677 TTGAAGGCTGGATTATTGGGAGG + Intergenic
1177764593 21:25442551-25442573 TTGAAGTCTCTATTATTGTGTGG - Intergenic
1177951928 21:27549085-27549107 CTGAATTCTAAATTTTTGAGAGG + Intergenic
1178397035 21:32251689-32251711 ATGAAGTTTGTATTTTTGTTTGG - Intergenic
1181904757 22:26185574-26185596 CTGCCTTCTGGATTTTTCTGAGG + Intronic
1182400674 22:30074415-30074437 CAGAAATCTGGCTTTTTGGGAGG + Intergenic
949525416 3:4898486-4898508 ATGAAATCTTGATTTTTCTGTGG - Intergenic
955446407 3:59015714-59015736 AAGAAGTCTGGATGTCTGTGAGG - Intronic
955914133 3:63889537-63889559 CTGAAGATTTGATTTTTCTGAGG - Intronic
956242562 3:67146939-67146961 CTTAAGTCTTGTATTTTGTGTGG + Intergenic
958619422 3:96537539-96537561 CTGAAGTTTTATTTTTTGTGTGG - Intergenic
959294174 3:104514119-104514141 TTGAAGACTGGATTTCTCTGGGG + Intergenic
959768398 3:110062230-110062252 CTGACCTCTGATTTTTTGTGTGG - Intergenic
960463342 3:117964347-117964369 CTGAAGTTTCCATCTTTGTGAGG - Intergenic
961200267 3:125039869-125039891 CTGCAGTTTGGCTTTTTGTGGGG - Intronic
962549550 3:136475601-136475623 CTGAAGGCTGGATTGCTATGAGG + Intronic
962898945 3:139740344-139740366 CAGGAGCCTGGACTTTTGTGTGG - Intergenic
963776095 3:149442703-149442725 CTAAAGTCTTTATTTTTCTGGGG - Intergenic
965409326 3:168310295-168310317 CTAAACTCAGGAATTTTGTGGGG + Intergenic
965900889 3:173640236-173640258 CTGAAGCCTGTATTTTAATGAGG + Intronic
966024655 3:175261243-175261265 CTGCAGTTTGGGATTTTGTGAGG - Intronic
966174271 3:177118724-177118746 CTGAAGTTTGTATTTTAATGGGG + Intronic
966428814 3:179809819-179809841 CTGAGGTCTCCATTTTTATGTGG - Intronic
969870747 4:10103125-10103147 CTGCAGCCTGGGCTTTTGTGTGG - Intronic
970124213 4:12791289-12791311 CAGGAGACTGGAATTTTGTGAGG - Intergenic
970867801 4:20779387-20779409 CTCATATCTGGATTTTTGTTTGG + Intronic
970987559 4:22176324-22176346 CTGTATTTTGGATTTGTGTGGGG - Intergenic
972748432 4:41964311-41964333 TTGAAGTGTGCATTTTTGTATGG + Intergenic
972749452 4:41973674-41973696 CTGGATTTTGGATTTGTGTGGGG + Intergenic
972911431 4:43822179-43822201 CTGAGTTTTGGATTTGTGTGGGG - Intergenic
973180314 4:47259189-47259211 GTGAAGGCTGGATTTGTTTGTGG - Intronic
973343867 4:49033142-49033164 CTGTTGTCTGGTTTATTGTGTGG - Intronic
975130765 4:70830521-70830543 CTGGATTCTGTATTTTTGTCCGG + Intronic
975998589 4:80344331-80344353 CTGATGGTTGTATTTTTGTGGGG - Intronic
976461115 4:85314127-85314149 CTGGATTCTGGACTTCTGTGGGG - Intergenic
978393678 4:108254759-108254781 CTGAAGACAAGAGTTTTGTGAGG + Intergenic
981149069 4:141360356-141360378 ATGTAGTTTGTATTTTTGTGGGG + Intergenic
981865870 4:149418273-149418295 CTGATGGCTGTATTTCTGTGGGG - Intergenic
982065487 4:151650865-151650887 AAGACGTCTGGATTCTTGTGTGG - Intronic
982986413 4:162213083-162213105 CTTAAGTCAGGATTTTTATGGGG + Intergenic
983139336 4:164129168-164129190 TAGAACTGTGGATTTTTGTGTGG + Intronic
984232670 4:177117797-177117819 CTGTAGTGTAGATTTTTTTGGGG - Intergenic
985169592 4:187134774-187134796 TTGTTGTCTGAATTTTTGTGAGG - Intergenic
985813547 5:2109611-2109633 CAGATGTCTGCATTTGTGTGGGG - Intergenic
986873021 5:12072966-12072988 CTTAACTCTGAATTTTTATGAGG - Intergenic
989470244 5:41808384-41808406 CTGAAATCTGGAAATCTGTGAGG + Intronic
990267982 5:54099074-54099096 CAGATTTCTGGATTTTGGTGAGG + Intronic
990353451 5:54941423-54941445 CTGAAATCTGCTTTTTTTTGAGG - Intergenic
991487875 5:67156691-67156713 CTGAAGCCTGGGTTAATGTGAGG + Intronic
993632815 5:90307716-90307738 CTGTAGTCTGGATTTTAGGAAGG - Intergenic
994413066 5:99433752-99433774 CACAAGTTTGGATTTGTGTGTGG + Intergenic
994480771 5:100331965-100331987 CACAAGTTTGGATTTGTGTGTGG - Intergenic
995773377 5:115697706-115697728 CTGAAGTTTGTAGATTTGTGTGG - Intergenic
996297856 5:121944423-121944445 CTAAATTCTGCATTTTTATGAGG + Intergenic
998984627 5:147742499-147742521 ATGAAGTTTGCAATTTTGTGAGG + Intronic
1000750760 5:165093822-165093844 CAGAAGTCTGCATTTTCTTGAGG - Intergenic
1001048648 5:168396034-168396056 CTGAGATCTGGGTTTTTCTGAGG - Intronic
1003771107 6:9301879-9301901 ATGAAGTCTTGATTTTTGAAAGG + Intergenic
1005414187 6:25583839-25583861 CTGAAGTGTGGGTTGTTGGGCGG - Intronic
1007152576 6:39708729-39708751 ATGAAGTCTAGACATTTGTGAGG - Intronic
1011587641 6:88943868-88943890 TTGAGGTCTGGATTTTTCTCAGG - Intronic
1015049250 6:128818926-128818948 GTCAAGTCTTGCTTTTTGTGGGG + Intergenic
1016498850 6:144694698-144694720 CTGATGGTTGTATTTTTGTGGGG + Intronic
1016882923 6:148928817-148928839 ATGATTTCTGGATTCTTGTGTGG + Intronic
1018123463 6:160659408-160659430 CTGCACTCTGTGTTTTTGTGGGG - Intronic
1018614720 6:165676303-165676325 GTGAAGTCTGGACTTTAGTGTGG - Intronic
1019790306 7:3008096-3008118 CTGAAGTCTGAGTTTTTCAGAGG - Intronic
1022575285 7:31491383-31491405 CTGAAAATTGGATTTTTCTGTGG + Intergenic
1023176017 7:37436366-37436388 CTGAAGACTGTATATTTGTCAGG + Intronic
1023360574 7:39411102-39411124 CTGAAGTCTGTGTATGTGTGAGG + Intronic
1024749772 7:52452047-52452069 TCAAAGTCTGGATATTTGTGAGG + Intergenic
1027224527 7:76235467-76235489 CTGAACTCTGGCTTCTTGTCTGG - Intronic
1028053081 7:86208659-86208681 CTGAACCCAGGGTTTTTGTGGGG + Intergenic
1031131546 7:117838778-117838800 CTGAAATCTTTATTTTAGTGCGG - Intronic
1032989651 7:137378868-137378890 CTGATGGCTGGATTTTTCTTGGG + Intergenic
1033242091 7:139688764-139688786 TTGCTGTCTGGATTTTGGTGAGG - Intronic
1034364669 7:150536086-150536108 CTGAAGCCTGGCGCTTTGTGGGG - Intergenic
1035170354 7:157014001-157014023 GGGAAGTGTGGATCTTTGTGTGG + Intergenic
1035733509 8:1870194-1870216 CTGAAGTCGGCATTTTTCAGGGG + Intronic
1037342138 8:17857307-17857329 CTGAATTCTGAGTTTTAGTGCGG - Intergenic
1037701760 8:21281786-21281808 CTAAAGTCAAGATATTTGTGTGG - Intergenic
1041380088 8:57245658-57245680 CTAAATTCTGGGATTTTGTGAGG + Intergenic
1041836086 8:62217089-62217111 CTGAAAATTGGATTTTTATGTGG - Intergenic
1041963202 8:63643860-63643882 TTGACTTCTGTATTTTTGTGTGG + Intergenic
1044717411 8:95113175-95113197 CTTTAGTCTGATTTTTTGTGGGG + Intronic
1046038131 8:108868746-108868768 CTGTAATCTGTATATTTGTGTGG - Intergenic
1046357083 8:113101332-113101354 CTAAATGCAGGATTTTTGTGAGG - Intronic
1047944725 8:129863999-129864021 CTGAATTTTTGTTTTTTGTGTGG - Intronic
1049962573 9:750684-750706 TGGAAGACTGGATTTTTCTGGGG - Intergenic
1051195465 9:14558894-14558916 CTGAAGTCTGGCTGCTTGTTTGG + Intergenic
1052709624 9:32037447-32037469 CTGTAGTTTGTATTTCTGTGTGG + Intergenic
1055536984 9:77258175-77258197 CTGAGGTCTGAATATTTGTAAGG - Intronic
1055842996 9:80528814-80528836 CTGACGTTTGCATTTCTGTGGGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1058992750 9:110270217-110270239 AAGAAGACTGGATTTTGGTGGGG + Intergenic
1186244025 X:7601462-7601484 TTGAAGTCTTCATATTTGTGAGG + Intergenic
1186408175 X:9322114-9322136 CTGAGGGCTTGATATTTGTGTGG - Intergenic
1187080167 X:15977525-15977547 GTGAAATTTGGATTTTTGAGTGG + Intergenic
1188942300 X:36254919-36254941 CTGCAGGGGGGATTTTTGTGAGG + Intronic
1195438596 X:104874922-104874944 AGGAAATCTGGATTTTAGTGGGG + Intronic
1195475118 X:105276613-105276635 CTGAAGTCTGGATTTTTGTGTGG + Intronic
1197274154 X:124458794-124458816 CTGAAGTCTAAAGTTTTGAGAGG - Intronic
1197871259 X:131064814-131064836 CCAAAATGTGGATTTTTGTGGGG - Intronic
1199132537 X:144208464-144208486 CTGAATTTTGGACTTTTATGTGG + Intergenic
1200246152 X:154527065-154527087 CTGAATTCTGGCTTTCTGTAAGG - Intergenic
1201667235 Y:16472391-16472413 CAGAAATCTGGATATATGTGGGG - Intergenic