ID: 1195476067

View in Genome Browser
Species Human (GRCh38)
Location X:105287240-105287262
Sequence GAGCATTAACTAGGAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195476067 Original CRISPR GAGCATTAACTAGGAAAGAC AGG Intronic
906283812 1:44572496-44572518 GAGCTTTAATTATGAAAGAGGGG - Intronic
909031164 1:70542785-70542807 GAGAATTAACATGGAAAGATTGG + Intergenic
909461051 1:75914756-75914778 GAGCATTTACCTTGAAAGACTGG - Intergenic
913990235 1:143605134-143605156 TAGCATTACCTGGGAAACACTGG + Intergenic
914342488 1:146771889-146771911 AAGAAGTAACTAGGAAATACTGG + Intergenic
916533025 1:165676470-165676492 AAGCATTACCTGGGAAAAACTGG + Intronic
916767302 1:167873814-167873836 AAGCACTAACTATAAAAGACAGG + Intronic
918728751 1:187961677-187961699 GAGCTTTCACTAGGAAATAATGG - Intergenic
918999175 1:191806544-191806566 TAAAATTAACTAGGAAAAACTGG - Intergenic
920897521 1:210070665-210070687 TACCATTTACTGGGAAAGACAGG + Intronic
921994680 1:221405309-221405331 GAGGATTAAAAAGGAAATACAGG - Intergenic
922708724 1:227809580-227809602 GAACATTAATAAGGAAACACTGG + Intergenic
923895594 1:238266761-238266783 TAGCATTAAATAGAAAACACAGG + Intergenic
1064337718 10:14458681-14458703 TAGCTTTAAGTAGGAGAGACTGG - Intronic
1067248690 10:44569282-44569304 GAGCAGTAACAAGGTTAGACTGG + Intergenic
1068124447 10:52821634-52821656 GAGCAAAAATTAAGAAAGACAGG - Intergenic
1068722309 10:60259388-60259410 CCTCATTAATTAGGAAAGACTGG + Intronic
1070207511 10:74278542-74278564 GATGATCAACTAGGAAAGAAAGG - Intronic
1075112562 10:119599002-119599024 AAGCAATAAATAGTAAAGACAGG - Intergenic
1075399521 10:122150919-122150941 GAGCATGAAGTTGGAAAGACAGG + Intronic
1076019327 10:127057888-127057910 GTTCATTAACAAGGAATGACAGG - Intronic
1076362613 10:129900095-129900117 GAGCATGAACATGGAAACACCGG - Intronic
1077723877 11:4654084-4654106 GAAAATTAAATAGGAAAAACAGG - Exonic
1081780304 11:45706056-45706078 AGGCTCTAACTAGGAAAGACAGG + Intergenic
1082999257 11:59276832-59276854 GGGCATTGACTGGGAAAGAATGG + Intergenic
1085877982 11:80431695-80431717 GACAATAAACTAGGAATGACGGG - Intergenic
1086726701 11:90195009-90195031 GTGCAGTAACTAGGAAAAAATGG + Intergenic
1087623126 11:100565167-100565189 GAGAAATAACAAGGAAAGAGGGG - Intergenic
1092054926 12:5500923-5500945 GAGCAATGAGTAGAAAAGACGGG + Intronic
1093737387 12:22637055-22637077 GAGTATTAAAGCGGAAAGACAGG - Intronic
1094226870 12:28055834-28055856 GAGCAGTAAATAAGAAAGCCAGG - Intergenic
1104072736 12:125360602-125360624 GAGCATTAACTAGCAATGCAAGG + Intronic
1105036995 12:132932429-132932451 GAGCCTTAACTAAGAAAGTGGGG + Intronic
1105738000 13:23291970-23291992 CAGCATTTACTAGGTAACACTGG - Intronic
1108741831 13:53346386-53346408 CAGCATTAACCAGGAAGGATAGG - Intergenic
1114352012 14:21863182-21863204 GAGAATGGACTAGGAAGGACTGG + Intergenic
1119417111 14:74479163-74479185 TAGCATTAACTAGGAAAGCTTGG + Intronic
1119669147 14:76505676-76505698 GGGCATTATCAAGGAAAAACTGG + Intergenic
1120250831 14:82060437-82060459 GAGCATTGATTGGGAAAGAATGG - Intergenic
1127629142 15:60810086-60810108 GGGCATAAACCAAGAAAGACAGG - Intronic
1130925253 15:88380752-88380774 GATCCTTAAATAGGAAAGACAGG + Intergenic
1131171238 15:90179718-90179740 GAGCAGAAGCAAGGAAAGACAGG + Intronic
1131939322 15:97543470-97543492 GAAAATTAACTAGGAAATTCAGG - Intergenic
1137422923 16:48351428-48351450 TAGCATGAGCTAGGAAAGCCAGG - Intronic
1137463720 16:48689191-48689213 AAGCATTAACTATGGAAGAATGG - Intergenic
1139991496 16:70943435-70943457 AAGAAGTAACTAGGAAATACTGG - Intronic
1140305809 16:73801488-73801510 CAGCATAAACCAGGAAAGAATGG + Intergenic
1144469852 17:15528927-15528949 GATGATTAACTAGGAAAAAGAGG - Intronic
1145981750 17:29016800-29016822 GAGCATCAGCTGGGAAAGAGGGG - Intronic
1146516853 17:33496176-33496198 GGGCATTGTCTAGGAAAGACAGG + Intronic
1147037235 17:37690851-37690873 GAGCACTCAGTAGGGAAGACCGG + Intronic
1148934739 17:51155853-51155875 GAACTTTAAATAAGAAAGACGGG - Intronic
1151367986 17:73629556-73629578 CAGCATTTCCTAGGGAAGACGGG + Intronic
1152403627 17:80083989-80084011 GAGAATTATATAGAAAAGACTGG + Intronic
1154163531 18:11997309-11997331 GAGCAGGAACTAGGAAACCCTGG + Intronic
1158216921 18:55110163-55110185 GAGGATTACTTAGGTAAGACTGG + Intergenic
1159336208 18:67070649-67070671 AAGCATGAACTAGGAGAAACAGG - Intergenic
1159350360 18:67264759-67264781 AAGCAATAAATAGAAAAGACAGG - Intergenic
1160140598 18:76318297-76318319 GTGCATTAACGTGGAAAGAGGGG + Intergenic
1161509218 19:4661453-4661475 GGGCATTGACTAGGAAGTACAGG + Intronic
1163186349 19:15641839-15641861 GTGCATTAATGTGGAAAGACAGG - Intronic
1163229206 19:15988599-15988621 GAAAATTAAAAAGGAAAGACTGG - Intergenic
1168333144 19:55580954-55580976 GAGCCTGAAAGAGGAAAGACTGG + Intergenic
926655790 2:15404253-15404275 GAGCCTAAACTAAGCAAGACAGG + Intronic
927007174 2:18862866-18862888 GAGCTTAAAATAGGAAAGAATGG + Intergenic
927572310 2:24170367-24170389 GGGCATTGACTAGGAAAGAGGGG - Intronic
927623922 2:24692712-24692734 GAGCATTCAATAGGAAGGAATGG + Intronic
931715315 2:65024234-65024256 AAGCATTAAGTAGGAACAACAGG + Intergenic
933205406 2:79501817-79501839 GAGCATTAATTGGGAAAGAATGG + Intronic
939438342 2:142208050-142208072 GAGGATTAAAAAGGAAAGATTGG - Intergenic
940584683 2:155631333-155631355 GATCATCAATTAGGAAAGTCTGG - Intergenic
943006824 2:182395364-182395386 GAGCAATAAGTAGCAAACACTGG + Intronic
1170783773 20:19449881-19449903 GAGCATTAAGTAGAAAATAAGGG + Intronic
1171174315 20:23040106-23040128 AGGCATTAACTAGGAAAGGAAGG + Intergenic
1172016260 20:31875474-31875496 GATCAGTAACTAGGAAAGAGTGG - Intronic
1174189484 20:48730033-48730055 GAAGATTAAAGAGGAAAGACAGG + Intronic
1175414558 20:58793097-58793119 CAGCAATAACCAGGACAGACGGG - Intergenic
1176514034 21:7769829-7769851 GAACATTAACTAGCAAAGTACGG - Exonic
1176678003 21:9799068-9799090 GAGCAATAAACAGGGAAGACTGG - Intergenic
1178648147 21:34400353-34400375 GAACATTAACTAGCAAAGTACGG - Exonic
1181983842 22:26785395-26785417 GTGCATTAACTTGAAAAGAATGG - Intergenic
1182935316 22:34216672-34216694 GAGCATTAACTAGTATCAACAGG + Intergenic
949258783 3:2081870-2081892 CAGCTTTAAGTAGGAAAGTCAGG + Intergenic
956274252 3:67480803-67480825 GAGCAGTAGCTAGGGAAGACAGG + Intronic
957170624 3:76732394-76732416 GAGGCTTAACTAGGGAAGAATGG + Intronic
957247904 3:77736060-77736082 GAGCATTGACTGGAAAAGAATGG - Intergenic
957845994 3:85736454-85736476 GAGCATTAACTGGGCAACAGAGG + Intronic
959501447 3:107110549-107110571 GAGCAATAAATGGGGAAGACTGG + Intergenic
960728833 3:120701846-120701868 TTGCATTCACTGGGAAAGACAGG - Intronic
963563483 3:146897783-146897805 AAGCATTAAATAGGAAAAAATGG + Intergenic
964430473 3:156600528-156600550 GCGCATGCACTGGGAAAGACAGG + Intergenic
965391625 3:168111163-168111185 GGGCATTGATTAGGAAAAACAGG - Intergenic
969017568 4:4114665-4114687 GAGCATTAAAAAGAAGAGACGGG - Intergenic
969567670 4:7988564-7988586 GAGCTTTAGCAAGGAAAGAAGGG - Intronic
973692392 4:53450904-53450926 AAGCATTACTTAGGAAAGAAAGG - Intronic
974007391 4:56572481-56572503 GAGCACTCACTAGGAGAGAGTGG - Intronic
976161741 4:82208660-82208682 GAGAATTAACTTGCAAAGAAGGG + Intergenic
977204278 4:94152561-94152583 GACCATTGACTAGGAAATAATGG + Intergenic
978948785 4:114530775-114530797 GAGAATTAATAAGGAAACACTGG + Intergenic
979461945 4:120993928-120993950 GAGTATTAATTGGGAAAGAGAGG + Intergenic
979632502 4:122919713-122919735 GAGCAGTGGTTAGGAAAGACTGG - Intronic
979851928 4:125582125-125582147 GAGCAGTATCTAAGAAACACTGG - Intergenic
980558153 4:134436446-134436468 CAGCATTAATTCGGAATGACAGG - Intergenic
983052796 4:163068575-163068597 GAGCACTGATTAGGAAGGACAGG + Intergenic
989555693 5:42792051-42792073 TAGCTTTTACTAGGAAAGAGTGG + Intronic
989814816 5:45722966-45722988 TAGCATTAAGTAGAAAAGAAGGG + Intergenic
990822494 5:59858232-59858254 GAGCATCAAGTAGGAATGCCAGG - Intronic
990928936 5:61064346-61064368 GAGAATTAATAAGGAAATACTGG + Intronic
991036922 5:62136572-62136594 GAGCAATAAAGAGGAAAGAGAGG + Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993846509 5:92951113-92951135 GAAAATTAACAAGGAAACACTGG - Intergenic
994582913 5:101670411-101670433 GTGCATTAACTAGGGAATAAGGG - Intergenic
994659741 5:102639499-102639521 CAGCATCTACTAGGTAAGACTGG + Intergenic
1000272881 5:159703409-159703431 AAGCAGTAAGTAGGAAAGACAGG + Intergenic
1001200849 5:169715066-169715088 GAGCATTATGTATTAAAGACGGG + Intronic
1002220668 5:177677996-177678018 GAGGAAGAACTAGGAAAGAGAGG - Intergenic
1002797935 6:490621-490643 CAACATTACCTAGGAAATACTGG - Intronic
1004932411 6:20475269-20475291 GAGACTTAACTTCGAAAGACCGG - Intronic
1009523246 6:64711519-64711541 GACCATTAACCAAGAAACACTGG + Intronic
1009731424 6:67612908-67612930 GAGAATTATATAAGAAAGACTGG - Intergenic
1010056034 6:71565725-71565747 GAACATTAACTAAGAAAACCTGG + Intergenic
1010407346 6:75520143-75520165 GGGCATTAATTGGGAAAGAATGG - Intergenic
1014456206 6:121637341-121637363 GGGCATTGACTGGGAAAGAATGG - Intergenic
1018676638 6:166227835-166227857 TAGCAATAGCTATGAAAGACAGG - Intergenic
1022078523 7:26997615-26997637 GGGCATTAACTGGAAAAGAGTGG + Intergenic
1022178316 7:27893834-27893856 AAGCATGAACTAGGGAAGAAGGG + Intronic
1023046462 7:36214613-36214635 GAGACTTAAGTAGGAAAGTCTGG + Intronic
1026973906 7:74484756-74484778 GAGCCTTAAAAAGGAAAGACAGG - Intronic
1027343453 7:77233996-77234018 GAGCATTAAGTAGGAAGTAATGG + Intronic
1030479346 7:110082843-110082865 GGGCATTTATTAGGAAAGAATGG + Intergenic
1031580028 7:123462220-123462242 TACCATAAATTAGGAAAGACTGG - Intronic
1033220739 7:139524876-139524898 CAGCATTAACTAGGGAAGCCTGG + Intronic
1033524142 7:142193733-142193755 GAGCATAGGCTTGGAAAGACTGG - Intronic
1033538392 7:142333055-142333077 GAGCAGTAATTAGCAAAGGCTGG - Intergenic
1033604261 7:142914315-142914337 GGGCATTAAACAGGAAAGACTGG - Intronic
1036149889 8:6287534-6287556 GAGCATTATGTAGGAGAGAGTGG + Intergenic
1037101534 8:15053134-15053156 AAGCATCAAATAGGAAAGAGAGG - Intronic
1038554778 8:28501351-28501373 GTGCATTAACTATCAATGACTGG - Intronic
1038572451 8:28674664-28674686 GAGCATTAATTGGGAAAGAATGG + Intronic
1040637390 8:49290808-49290830 GAGCAGTAACTTTGAAGGACTGG - Intergenic
1042067900 8:64899281-64899303 GAGTATTGATTAGGAAAGAATGG + Intergenic
1042164537 8:65933064-65933086 GAGACTTAAATGGGAAAGACAGG + Intergenic
1043262739 8:78222245-78222267 GATCATTAAATATGAAAGAAGGG + Intergenic
1045036005 8:98176942-98176964 CAGCATTAGCTAAGACAGACAGG + Intergenic
1045146230 8:99347445-99347467 AAGCAATAACTGGGTAAGACAGG - Intronic
1045634831 8:104172658-104172680 AAGCATCAACTAGAATAGACAGG - Intronic
1046326095 8:112648758-112648780 GAGCATTCACCACGAAAGAAAGG - Intronic
1046824495 8:118672455-118672477 GATCATTCACTAGGATAGAATGG + Intergenic
1047971575 8:130089053-130089075 GTTCATGTACTAGGAAAGACAGG + Intronic
1050147240 9:2582398-2582420 GATAATTAACAAGGAAAGACTGG + Intergenic
1051244982 9:15100966-15100988 GAGAATTCTCTAGGAAAGTCAGG + Intergenic
1051939962 9:22493991-22494013 GAACATTAACAAGGATATACAGG - Intergenic
1052106322 9:24521753-24521775 TAGCATTAAATAGGAAATAAGGG + Intergenic
1055410434 9:76023287-76023309 CAGCATGAACAAGGGAAGACAGG - Intronic
1057874591 9:98744160-98744182 GAGAAGGAACTAGTAAAGACTGG + Intronic
1059009619 9:110442331-110442353 AAGCACTCACTAGGAAAGCCAGG - Intronic
1060206963 9:121687854-121687876 CAGCACTGACTAGCAAAGACTGG - Intronic
1060328964 9:122647044-122647066 GAAAATTAACTAAGAAACACTGG + Intergenic
1203663152 Un_KI270754v1:1560-1582 GAGCAATAAACAGGGAAGACTGG - Intergenic
1189102092 X:38201443-38201465 CTGCATTCAGTAGGAAAGACAGG - Intronic
1193093554 X:77521804-77521826 GTAAATTAAATAGGAAAGACTGG - Intronic
1193297436 X:79849961-79849983 GGGCATTGACTAGAAAAGAATGG + Intergenic
1193590232 X:83380522-83380544 GAGGATGAGCTAAGAAAGACTGG - Intergenic
1195014217 X:100762545-100762567 GAGCATTGATTGGGAAAGAATGG - Intergenic
1195476067 X:105287240-105287262 GAGCATTAACTAGGAAAGACAGG + Intronic
1196623606 X:117852416-117852438 GATCATTAACTAGAAGAGAATGG + Intergenic