ID: 1195478552

View in Genome Browser
Species Human (GRCh38)
Location X:105316470-105316492
Sequence AAACAGTTATTGATGAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195478552 Original CRISPR AAACAGTTATTGATGAAACC AGG Intronic
902710367 1:18235276-18235298 CAACACATATTTATGAAACCAGG + Intronic
904088156 1:27925563-27925585 AAATAAGTAGTGATGAAACCTGG - Intergenic
907185736 1:52607767-52607789 TCACAGTTATAGATCAAACCCGG + Intronic
908016517 1:59843865-59843887 AGGCAGTGATTGCTGAAACCTGG + Intronic
910340127 1:86177221-86177243 AAACAGTTCTTTATGCAATCTGG - Intergenic
910617138 1:89210974-89210996 AAACAGTTATTTATGAAACAAGG + Intergenic
911323350 1:96440776-96440798 AAACAGCTACTACTGAAACCAGG + Intergenic
911356112 1:96822878-96822900 AAACATTTTTTCATGAAACATGG + Intronic
912458402 1:109815158-109815180 AACCATTTATTGAAAAAACCCGG + Intergenic
913324261 1:117612938-117612960 AAGCAGCCTTTGATGAAACCCGG + Intronic
915854728 1:159370356-159370378 AAACACATATTCATGATACCAGG + Intergenic
915899547 1:159836557-159836579 AAAGAGGTATTGAAGAAACAGGG + Exonic
916256008 1:162788989-162789011 AAACAGTTGTTAGTGAGACCTGG - Intergenic
916430785 1:164726061-164726083 AAATGGTTATAGAAGAAACCAGG - Intronic
917184222 1:172334668-172334690 AAGCAGTTACTGCTGAAACATGG - Intronic
917410813 1:174758383-174758405 AAACATTTATAGATGAAACCAGG - Intronic
919076071 1:192814291-192814313 AAACAAATTTTGATGAAACAAGG + Intergenic
919239233 1:194889994-194890016 AAAAAGATATTTATGAAACAAGG - Intergenic
919958654 1:202443469-202443491 AACTAGTTATTGTTGAAACATGG + Intronic
920733314 1:208509050-208509072 CAACAATTAATGAAGAAACCAGG - Intergenic
923284515 1:232479868-232479890 AAACAGTGCTTGATGAAAGCTGG - Intronic
923434666 1:233956766-233956788 AAGCAGCTGTGGATGAAACCTGG + Intronic
924440326 1:244080539-244080561 AAGCAGTTACTGATGAAAGCAGG - Intergenic
1063002558 10:1938436-1938458 AAACAGTTGTTTATAAAACTGGG + Intergenic
1066593233 10:37019187-37019209 AAAGGGTTAATGATGAAACAAGG + Intergenic
1067272242 10:44802484-44802506 AAACATTTATGTATCAAACCAGG + Intergenic
1068061580 10:52074282-52074304 AAACAGTCATTCATGTAAGCGGG - Intronic
1068287317 10:54956914-54956936 AAACAGTGAATGGTGGAACCAGG + Intronic
1072393220 10:95010872-95010894 AATGAGTTATGGAGGAAACCTGG - Intergenic
1072462069 10:95628699-95628721 AAACATTTATTTATTAAGCCAGG - Intronic
1074555982 10:114490598-114490620 AAAGAGTTATTAATCAAACAAGG - Intronic
1075140066 10:119825001-119825023 AAAGAGTAATTGATAGAACCAGG - Intronic
1076616086 10:131755583-131755605 AAACAGTTGTTAGTGAGACCTGG - Intergenic
1078755011 11:14200872-14200894 ACAGAGTTTTTGTTGAAACCTGG - Intronic
1080897212 11:36456632-36456654 TCATAGTTAGTGATGAAACCAGG - Intronic
1081173704 11:39899946-39899968 AAACAGTTCTGAATCAAACCAGG - Intergenic
1081334808 11:41851810-41851832 AAAAAGTTATTTTTGAAACAAGG - Intergenic
1081434584 11:43013120-43013142 AAACAGTAATTGATGAAATGTGG + Intergenic
1081584257 11:44373441-44373463 AAACAGTCCTTGATCTAACCTGG + Intergenic
1084745899 11:71168953-71168975 AAACAGTGATTTATGAAATCAGG + Intronic
1087011007 11:93514004-93514026 ATAAAGAGATTGATGAAACCAGG - Intronic
1087254818 11:95941627-95941649 AAACATTTATTGTTAAAACAGGG - Intergenic
1088221508 11:107575000-107575022 ACACAGTTAGTGATAAAGCCAGG + Intergenic
1088498717 11:110459960-110459982 AAACAGTTATCAGTGAAACATGG - Intronic
1091718687 12:2796609-2796631 AAACAGGTAAGGAAGAAACCAGG - Intronic
1092502337 12:9060702-9060724 AAATCTTTATTGATGAGACCTGG + Intergenic
1095226907 12:39688008-39688030 AAACATTTATTGAAGAAAAAAGG - Intronic
1096573634 12:52539494-52539516 AAATAGTTATGGCAGAAACCTGG + Intergenic
1096821323 12:54237477-54237499 AACCAGTTATTGATGATTCATGG + Exonic
1097887014 12:64739184-64739206 AAACAGCAAATAATGAAACCTGG + Intronic
1099796875 12:87410669-87410691 AAACAGTTGTTAATGAGACCTGG + Intergenic
1105795874 13:23852065-23852087 CAACAGTTGTTGAAGAGACCAGG - Intronic
1106465063 13:30006200-30006222 TAACATTTGTTGAGGAAACCAGG + Intergenic
1107074110 13:36302488-36302510 AAAACGTTATTTATGAAAACAGG + Exonic
1107676532 13:42803406-42803428 AAAGTGTTATTTATGAAAACAGG - Intergenic
1108192731 13:47959226-47959248 AAAAAGTTTTTTATGAAACAAGG + Intronic
1108383569 13:49877526-49877548 AAAATGTTATTTATGAAACAAGG + Intergenic
1108755870 13:53501564-53501586 AAACATTTATTTTTGAGACCTGG + Intergenic
1109520334 13:63502088-63502110 ATGCAGTTATTGATAAACCCTGG + Intergenic
1110066201 13:71109198-71109220 AAACAGTAATAGATGAAAAAAGG + Intergenic
1110611230 13:77490390-77490412 CAACAGTTATTCAGGAAAACAGG + Intergenic
1110873240 13:80477703-80477725 AAACAGTCTTTGATAAAACAGGG - Intergenic
1111558115 13:89908087-89908109 AAAAGGTTATTTATGAAACAGGG + Intergenic
1112051363 13:95646549-95646571 AAATAGTTATTGATATTACCTGG + Intergenic
1112384179 13:98922472-98922494 AAACATTTTTTCGTGAAACCAGG - Intronic
1113241178 13:108339078-108339100 AAAGAGCTATTGAAGAAACTAGG + Intergenic
1113406771 13:110048017-110048039 AAACAGCTATTGGTGAAGCTGGG - Intergenic
1115575208 14:34704288-34704310 AAACAGTAATAGATCAAACATGG - Intergenic
1116764037 14:49049184-49049206 AACCAATTAGTGATGAAACTAGG - Intergenic
1117512446 14:56466481-56466503 AAAGATTTATTTATGTAACCTGG - Intergenic
1118364254 14:65080894-65080916 AAATATTTATACATGAAACCAGG + Intronic
1119716044 14:76860181-76860203 AAATAGTGTTTGATCAAACCTGG - Intronic
1120298931 14:82680889-82680911 AAAGACTTATTGACAAAACCAGG + Intergenic
1123777539 15:23595324-23595346 GAAAAGTTATTTATGAAACAAGG - Intronic
1124090595 15:26596273-26596295 AAACAGTTATAAATGAAAAAGGG + Intronic
1127852130 15:62923097-62923119 AAACTGTATTTCATGAAACCTGG + Intergenic
1128121542 15:65151863-65151885 AAACATTTATTGAATAAATCAGG + Intronic
1129086123 15:73094047-73094069 AAATAGTTATAGAAGGAACCAGG - Intronic
1129305962 15:74662871-74662893 AAACAGTTATAGGAGAAAACAGG + Intronic
1129856197 15:78827044-78827066 AAACAGTTATTGGTGAGAGAGGG - Intronic
1132066614 15:98736398-98736420 AAACAGTTATTGGTGAGACATGG + Intronic
1135601408 16:23786970-23786992 GAACAGTTTTTGATGACACTGGG + Intergenic
1140539408 16:75742406-75742428 AAAATGTTATTTATGAAACAAGG + Intronic
1143992506 17:10978273-10978295 AAACAGATATTTATAATACCGGG - Intergenic
1144049571 17:11486953-11486975 AAAATGTTATTTATGAAAGCAGG - Intronic
1146119636 17:30180740-30180762 AAAAATTTATTTATGAAAACAGG + Intronic
1153359799 18:4181359-4181381 AAACAGTTTTTGATAAGACATGG + Intronic
1155454584 18:25997737-25997759 AAGCAGCTAAGGATGAAACCTGG + Intergenic
1158032363 18:52981852-52981874 AAACAGTTATAGATGAATAATGG + Intronic
1167029727 19:46949909-46949931 AAACAGTAATGGATGAGACTGGG + Intronic
1167225508 19:48236732-48236754 AAACAGTCATTGCTAATACCAGG - Intronic
1168672620 19:58252525-58252547 AAAGGGTTATTTATGAAACAAGG - Intronic
925014404 2:510822-510844 ACACAGTTCTTGAAGAAACAAGG - Intergenic
925758087 2:7154210-7154232 AAACAGTTATAAAAGAAAGCTGG + Intergenic
926348868 2:11977206-11977228 GAACAGCTATTGATCAAACACGG - Intergenic
926365462 2:12129199-12129221 CATCAGTTATTGAAGAAACTGGG - Intergenic
927074658 2:19565758-19565780 AGACAGTTTTTGCAGAAACCAGG - Intergenic
927255557 2:21037714-21037736 AAACAGTCATTGAGGAGTCCTGG - Intronic
929187878 2:39114058-39114080 AAAGAGTCATTGATCATACCAGG - Intronic
931328334 2:61251798-61251820 AAAAGCTTCTTGATGAAACCAGG + Intronic
932693474 2:73933622-73933644 AAACAGTTTTTCATGAAAAAAGG + Intronic
933103941 2:78297382-78297404 AAACAGGTTGTGATAAAACCAGG + Intergenic
933907724 2:86912179-86912201 ACACAGTTATTCAGGAACCCAGG + Intronic
933908972 2:86921894-86921916 ACACAGTTATTCAGGAACCCAGG + Intronic
934023752 2:87981491-87981513 ACACAGTTATTCAGGAACCCAGG - Intergenic
935939828 2:108226697-108226719 AAACAGATATTGAAGGAAACTGG - Intergenic
936364405 2:111839214-111839236 ACACAGTTATTCAGGAACCCAGG - Intronic
940235901 2:151510432-151510454 AAACAGTTGTTAGTGAGACCTGG + Intronic
940398203 2:153218102-153218124 GAACAGATATTGAGAAAACCTGG - Intergenic
941359381 2:164532917-164532939 AAAGAGTTATTGAAGGAAACTGG + Intronic
942494717 2:176527693-176527715 AAACAGTTGCTCGTGAAACCAGG + Intergenic
943736097 2:191356595-191356617 ATACAAATATTGAAGAAACCAGG + Intronic
945366026 2:208955180-208955202 AAAAGGTTATTTATGAAACAAGG - Intergenic
946078110 2:217092572-217092594 GAACAGTGATTGAGGAAACAAGG + Intergenic
946504841 2:220287798-220287820 AAACAGTTAGAGTTGAACCCAGG + Intergenic
947446407 2:230166966-230166988 CAACAGTCAGTGATGAAACAGGG - Intergenic
947483486 2:230524981-230525003 AAAAGGTTATTTATGAAACAAGG + Intronic
1168795431 20:607793-607815 ACACAGTCAGTGATGGAACCAGG - Intronic
1170179604 20:13514964-13514986 AAAGATTTATTGATGAATCATGG - Intronic
1170404225 20:16019568-16019590 ACACAGTTATTCAGGAACCCAGG + Intronic
1170506456 20:17030818-17030840 ACACAGCTGTTGATGGAACCTGG + Intergenic
1172343983 20:34182195-34182217 AAAAAATTATTCATGGAACCAGG + Intergenic
1173156302 20:40613724-40613746 AAATGGTTATTGATGAAAAAGGG - Intergenic
1174282782 20:49451550-49451572 AGACAGGTAATGATGATACCTGG - Intronic
1174573695 20:51522787-51522809 AAACACTTTTTGAATAAACCAGG + Intronic
1177878471 21:26664493-26664515 AAAAGGTTATTTATGAAACAAGG - Intergenic
1178205457 21:30459121-30459143 ACACAATTATTGATGTAACCAGG + Intergenic
1183743978 22:39683084-39683106 AAACGGCTATTGAAGACACCAGG - Intronic
949412905 3:3785304-3785326 AAACAGTTCTTTTTAAAACCAGG - Intronic
950204360 3:11067173-11067195 AAATGGTTATTTATGAAACAAGG + Intergenic
950630393 3:14278375-14278397 AAACAGTTATATAGAAAACCAGG - Intergenic
951295236 3:20925398-20925420 AAAGATTTGTTTATGAAACCAGG - Intergenic
952827294 3:37534803-37534825 ACACAGATATTGTTGAAGCCAGG + Intronic
953802602 3:46037285-46037307 AAAATGTTATTTATGAAACAAGG + Intergenic
956019587 3:64919887-64919909 AAATAGTGATTCATGAATCCGGG - Intergenic
956988550 3:74734282-74734304 AGACAGTGATTGATTAGACCAGG + Intergenic
957837094 3:85609060-85609082 AAACAGCTATTGAAAAAACATGG - Intronic
957880037 3:86200264-86200286 AAACAGTTCTTGAAGAATGCAGG + Intergenic
962428816 3:135300703-135300725 AAACAGTTACTGGAGAAACAAGG + Intergenic
963166498 3:142209821-142209843 AAACAGTTATGAGTGAATCCAGG + Intronic
963497902 3:146091916-146091938 AAAAGGTTATTAATGAAAGCAGG + Intronic
964476109 3:157099365-157099387 AAACAGAGTTTGAGGAAACCAGG - Intergenic
964590207 3:158353489-158353511 TAAAACTTATTTATGAAACCAGG + Intronic
965400853 3:168210636-168210658 AAAGAGTTGTTGCTTAAACCAGG + Intergenic
965679534 3:171235885-171235907 AAAAGGTTCTTGATGCAACCTGG + Intronic
968679522 4:1907290-1907312 AAGCAGCTATAGAAGAAACCAGG - Intronic
970478481 4:16449676-16449698 AAACAGTGTTGGATGAAAGCTGG + Intergenic
970975122 4:22034708-22034730 ATACAGATACTGATAAAACCTGG - Intergenic
971324199 4:25630820-25630842 AAAAAGTAATTGATGATGCCAGG - Intergenic
972562894 4:40244088-40244110 ATACAGTTATTGATGAGGCTTGG + Exonic
975487199 4:74947332-74947354 ATTCATTTATTGAAGAAACCTGG - Intronic
976857474 4:89622221-89622243 AAAAAGTTATTGATGAAGGAGGG + Intergenic
977993192 4:103469739-103469761 AAAAAGTTTTTGATCAATCCTGG + Intergenic
979011065 4:115369235-115369257 AAAAAGTTATTTCTGAAAACAGG - Intergenic
979163988 4:117502309-117502331 CAACAGTTATTTCTGAAACTAGG - Intergenic
980069603 4:128229526-128229548 AAACCCTTATTGATGAACCTTGG + Intergenic
980824342 4:138055529-138055551 ACACAGTTAGTGATGAAACCAGG + Intergenic
982477023 4:155866263-155866285 ATACTGTTATTGATGAAAATTGG - Exonic
983651107 4:170037702-170037724 AAACAGTTAATGATGAACTTTGG - Intergenic
985341047 4:188955098-188955120 AAACAGTAATAAAGGAAACCAGG + Intergenic
985803212 5:2019671-2019693 AAACAGTTACTGATGAAGTTGGG - Intergenic
986134843 5:4966634-4966656 AATCAGGTAGTGATGGAACCAGG + Intergenic
988074461 5:26335201-26335223 AAAAAGATATTTATGAAAGCTGG - Intergenic
989430171 5:41345119-41345141 AAATAGTAATTGATGAAGCAAGG + Intronic
990271484 5:54146220-54146242 AAACAATAATTGAAGAACCCAGG + Intronic
991667858 5:69017434-69017456 ATAAAGTTAGTGGTGAAACCAGG + Intergenic
992155088 5:73947154-73947176 AAACATTTAATGATGGAAGCGGG + Intergenic
992857955 5:80883167-80883189 AAAGAGTTGTTAATGAATCCAGG + Intergenic
995726354 5:115184784-115184806 AAACATTTATTTATGAAAATAGG + Intergenic
996513094 5:124339492-124339514 AGAGAGTTATGGAAGAAACCAGG + Intergenic
998717667 5:144904369-144904391 GAACAGATATTGAGAAAACCAGG - Intergenic
1000489256 5:161889129-161889151 TAACAGTTAATAATGAAAGCAGG + Intronic
1000727168 5:164785601-164785623 AAACAGCTATTAGTGAGACCTGG + Intergenic
1000824104 5:166022679-166022701 AAACAGGTATTAATGAAATGGGG - Intergenic
1009378246 6:62998232-62998254 AAACAGTTGTTAGTGAAAACTGG + Intergenic
1009644514 6:66380412-66380434 CAACACTCATAGATGAAACCAGG - Intergenic
1009842255 6:69092643-69092665 TTACAGTTAGTGATGAAAACAGG + Intronic
1009933412 6:70203753-70203775 TACTAGTCATTGATGAAACCTGG - Intronic
1011693877 6:89894643-89894665 TAACAGATATTGTTGCAACCTGG - Exonic
1012258518 6:97061195-97061217 AAACAGGTTTTGATGCAACCAGG - Intronic
1014977555 6:127907496-127907518 AAACTGTGATTGATCAAACTTGG + Intronic
1015417657 6:132968056-132968078 AAAAGTTTATTTATGAAACCAGG - Intergenic
1016105715 6:140159607-140159629 AAACATTAATTGATGGAACCAGG + Intergenic
1016634537 6:146272399-146272421 AAACAGTTATCCTTGAAACTGGG + Intronic
1018193571 6:161333737-161333759 AAAAAGTTATTTATGAGACAAGG + Intergenic
1018523628 6:164681326-164681348 AGCCAGTTAGTCATGAAACCAGG - Intergenic
1019046094 6:169147332-169147354 AAAGAGTTATTGTCTAAACCTGG - Intergenic
1019265586 7:115804-115826 AAACAGTTATTGTTTTAAACAGG + Intergenic
1020528914 7:9303503-9303525 AAAATGTTATTGAGGAAAACTGG + Intergenic
1021051244 7:15987957-15987979 GAACATTTATTGATGTAAGCTGG + Intergenic
1021928643 7:25557493-25557515 AAAAAATTATTTATGAAACGGGG + Intergenic
1022198215 7:28090378-28090400 AGGCAGTTATTGAAGAAACTGGG - Intronic
1022235893 7:28459782-28459804 AAACATTAATTAATGAAAACAGG - Intronic
1022458031 7:30576324-30576346 AAAGAGTTATTTATGAAACAAGG - Intergenic
1024359109 7:48449160-48449182 AAACAATTATTTATTAAACATGG - Intronic
1026870525 7:73848482-73848504 AAACAGTTGTTGGGGAGACCTGG + Intergenic
1027541255 7:79468876-79468898 ACACAGTTTATGATGACACCAGG - Intergenic
1027780228 7:82510672-82510694 AAAGAGTTATTGATGCAATTAGG + Intergenic
1027982035 7:85236982-85237004 AAAAAGTTATTGAAGAAACTGGG - Intergenic
1028236158 7:88364064-88364086 AAACAGTTGTTAGTGAGACCTGG + Intergenic
1030480289 7:110094918-110094940 AACCAGTTATGAATGAAATCTGG + Intergenic
1032607466 7:133371133-133371155 AAACAGTGAAAAATGAAACCTGG - Intronic
1033054388 7:138036120-138036142 AAAAGGTTATTTATGAAACAAGG + Intronic
1033575790 7:142683255-142683277 AAATATTTATTGAACAAACCAGG + Intergenic
1036487698 8:9194558-9194580 AAATAGAAATTAATGAAACCAGG - Intergenic
1040383109 8:46892164-46892186 CAACTGTTATTCATGAAAACAGG - Intergenic
1040768814 8:50949174-50949196 AAACATTTATTGCAGAAAGCAGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041768961 8:61452371-61452393 AAGCATTTATTTATAAAACCAGG - Intronic
1041794071 8:61727983-61728005 AAATAGATATTAATGACACCGGG + Intergenic
1042932585 8:74028162-74028184 AAACAGTTGTTAGTGAGACCTGG + Intronic
1044013825 8:87026739-87026761 AAAAGGTTATTTATGAAACAAGG - Intronic
1044098105 8:88094781-88094803 TAACAGTTTTTCATGAGACCTGG - Intronic
1045836018 8:106522654-106522676 ACACAGTTAGTGATGGAAGCAGG - Intronic
1047152582 8:122281184-122281206 AATCAGATTTTGTTGAAACCTGG + Intergenic
1047674892 8:127190297-127190319 AAACACTTTTTCATGAAACAAGG + Intergenic
1048090055 8:131230173-131230195 AAACAGTCATGGGAGAAACCAGG + Intergenic
1050352913 9:4757547-4757569 AACTAATTAGTGATGAAACCAGG - Intergenic
1050992041 9:12167654-12167676 ATACAGTTATTAATAAAACCTGG - Intergenic
1052889405 9:33684061-33684083 AAATATTTATTGAACAAACCAGG + Intergenic
1055064312 9:72103309-72103331 AAACAGGAATTGAAGAAATCTGG + Intergenic
1058184827 9:101841889-101841911 AAAAAGTTTCTGATAAAACCTGG - Intergenic
1059093183 9:111383582-111383604 AAACAGATGATGATCAAACCAGG + Intronic
1060021643 9:120136464-120136486 AAACAGTTAATGATGAAGTTGGG - Intergenic
1060062059 9:120469615-120469637 AAAGATTTATTGATCAAACCTGG + Intronic
1061519752 9:131111230-131111252 AAGAAGTTAATGATGGAACCAGG + Intronic
1062211459 9:135366530-135366552 AAACAGTTTTTGTCAAAACCAGG + Intergenic
1188353375 X:29159704-29159726 ATACAGTTAAAGATGAAATCTGG - Intronic
1190855747 X:54292908-54292930 GAACAGTTAATGGGGAAACCTGG + Exonic
1190951424 X:55148386-55148408 TAAAAGTTATTTATGAAACAAGG + Intronic
1191843379 X:65528731-65528753 ATACAGTTAATGATAGAACCAGG - Intronic
1193700743 X:84757813-84757835 AAAAAATTGTTGATGAAAACAGG + Intergenic
1194008913 X:88534225-88534247 AAAGTGTTATTTATGAAACATGG - Intergenic
1194279098 X:91924788-91924810 ACACAATTACTGATGAGACCAGG - Intronic
1195114324 X:101681779-101681801 AAGCAGGTAGTGATGAAATCTGG + Intergenic
1195478552 X:105316470-105316492 AAACAGTTATTGATGAAACCAGG + Intronic
1196074624 X:111561648-111561670 AAATAGTTGTTAATGAGACCTGG + Intergenic
1197988510 X:132292731-132292753 ACACAGTTATTCATGAAGCTAGG - Intergenic
1199789236 X:151135961-151135983 AAAAGGTTATTTATGAAACAAGG - Intergenic
1200177846 X:154129973-154129995 AAAGAAATATTGAGGAAACCTGG - Intergenic
1200596572 Y:5148291-5148313 ACACAATTACTGATGAGACCAGG - Intronic