ID: 1195479881

View in Genome Browser
Species Human (GRCh38)
Location X:105332252-105332274
Sequence GGTTCACCTGCATTTGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195479879_1195479881 0 Left 1195479879 X:105332229-105332251 CCACTGGGCTAAGTCTTCAATTT 0: 1
1: 0
2: 0
3: 19
4: 217
Right 1195479881 X:105332252-105332274 GGTTCACCTGCATTTGTTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195479881 Original CRISPR GGTTCACCTGCATTTGTTGC TGG Intronic
901152329 1:7112143-7112165 GTGGCACGTGCATTTGTTGCAGG + Intronic
903264283 1:22147664-22147686 GGAATACCTGCATTTGTTCCAGG + Intergenic
906730430 1:48076240-48076262 GGATCACCTGCATGAGTTGGGGG - Intergenic
909509123 1:76431209-76431231 TGTTCACCTGCTTTTGTTTCTGG - Intronic
913153043 1:116064710-116064732 TGTTCATCTGGATTTGTTGGAGG + Intronic
916324359 1:163540478-163540500 TGTTCCCCTGCCTGTGTTGCAGG - Intergenic
916674099 1:167051986-167052008 GGTTCACCTGCCTTAGCTCCAGG - Intergenic
920384224 1:205556829-205556851 GGTTCAGCTGCATTTTCTGTGGG + Intergenic
923368669 1:233288615-233288637 GGAGTACCTTCATTTGTTGCTGG - Intronic
924461165 1:244259701-244259723 GATTCACATGGATTTGTTGTGGG - Intergenic
1063911235 10:10832485-10832507 GGTTCTTCTGCATTTCATGCTGG + Intergenic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1069884283 10:71613791-71613813 TGTTCACCTGCGTGTGTTGAAGG + Intronic
1071973215 10:90929448-90929470 GCTGCACCTGCTTTTGGTGCAGG + Intergenic
1080800351 11:35604307-35604329 GTATCACCTGCATTTGTTTAAGG - Intergenic
1085217351 11:74844239-74844261 GGTGCTTCAGCATTTGTTGCAGG + Exonic
1087277933 11:96179037-96179059 GGTTCATCTGCTTTTGTCTCTGG + Intronic
1089771300 11:120805175-120805197 GGTTCACAAGGAGTTGTTGCTGG - Intronic
1091194616 11:133720287-133720309 TGGTCACCTGCATCTGTTGGGGG + Intergenic
1091217192 11:133909349-133909371 TTTCCACCTGCATTTGTTCCGGG + Intronic
1093192286 12:16088764-16088786 TGCTCATCTGAATTTGTTGCTGG - Intergenic
1093795306 12:23303575-23303597 GGCTCACCTGGATTTCTTGTTGG - Intergenic
1095949673 12:47775047-47775069 GGTTCACCTCCACTTGTACCAGG - Intronic
1098040788 12:66352411-66352433 GCTTCAGCTGGATTTGTTTCAGG - Intronic
1102443918 12:112986726-112986748 GCCTCACCTGCCATTGTTGCTGG - Intronic
1106582630 13:31031322-31031344 GGGTCAGCTGGATTTGTTACTGG + Intergenic
1107452442 13:40522055-40522077 GTTTCACCTGCATTTCCTTCAGG + Intergenic
1112487950 13:99836479-99836501 CATACACCTGCATTTGGTGCGGG - Intronic
1118748545 14:68790880-68790902 GGTTTACCTGTTTTTGTCGCGGG - Intronic
1121390077 14:93566196-93566218 TGTGGACCTGCATTGGTTGCCGG + Intronic
1121870769 14:97404754-97404776 CATCCACCTGCATTTGTGGCAGG + Intergenic
1132469081 16:91951-91973 GGTGCACCTGCATCTGTGGCAGG - Intronic
1137920277 16:52480251-52480273 GGTTCACCTGAATTTGATGTGGG - Intronic
1144379484 17:14680054-14680076 AGCTCATTTGCATTTGTTGCAGG - Intergenic
1146367105 17:32237653-32237675 GGTTATCCTGCATTTATTCCAGG - Intronic
1149773506 17:59339888-59339910 GGTTTATCTGCAGTTGTTCCAGG + Intronic
1160154660 18:76424292-76424314 TTTTCACCTGCATGTGTTTCGGG - Intronic
1161076017 19:2286166-2286188 GTTTCACCTGCCTTTGCTGTAGG + Intronic
1162709901 19:12585156-12585178 GGGTCACCCTCATTTGGTGCTGG - Intronic
1163857494 19:19716196-19716218 GGGTCACCCTCATTTGGTGCTGG - Intronic
1166089181 19:40497253-40497275 TGTGCATGTGCATTTGTTGCTGG - Intronic
1166095195 19:40534085-40534107 GCTTCTCCTGCATCAGTTGCTGG - Exonic
1167233975 19:48302805-48302827 GGATGACCAGCATTTGCTGCAGG - Exonic
925455735 2:4015232-4015254 GGTTGACCAGCAGTGGTTGCAGG - Intergenic
927396013 2:22652111-22652133 GGTTCACTTGCCTTTCATGCAGG - Intergenic
929805101 2:45138260-45138282 GGAGCTCCTGGATTTGTTGCAGG - Intergenic
935675700 2:105593568-105593590 GTATCAGCTGCATTTGTTCCAGG + Intergenic
939575431 2:143889362-143889384 TGTTCAGCTGTTTTTGTTGCAGG - Intergenic
942818891 2:180087047-180087069 TGTTTACCTGCTTTTGTTGCAGG + Intergenic
1170791797 20:19514823-19514845 AGTTGACCTCCATTTGTGGCTGG - Intronic
1174932696 20:54833092-54833114 TTTTCCCCTCCATTTGTTGCTGG + Intergenic
1179127248 21:38601073-38601095 AGTTCACCAGCTTTTATTGCCGG + Intronic
1181821969 22:25483411-25483433 GGTACACCTCTTTTTGTTGCAGG + Intergenic
1183327989 22:37204778-37204800 GATTCATCTCCATTTGTTGATGG + Exonic
1184057749 22:42063811-42063833 GATTCACCTGCCTCTGTAGCAGG - Intronic
950539999 3:13606464-13606486 GGTTCAACTGTATTTGTGACTGG - Intronic
951813249 3:26724848-26724870 GGCTCACAGGCATTTCTTGCAGG - Intergenic
960926509 3:122799793-122799815 GATTCACCAGTATTTGTTGATGG + Intronic
961000820 3:123372665-123372687 GGCTTACCTGCCCTTGTTGCTGG - Intronic
964599423 3:158480012-158480034 CTTTCACATGCATTTGTTGGAGG + Intronic
965152818 3:165004293-165004315 GCTTCAACAGCATTTGTTACTGG - Intronic
967852478 3:194092808-194092830 ATTTCACATGCATTTGTTTCTGG + Intergenic
970812950 4:20117172-20117194 TGTTCACCTGCATATGTAGTGGG - Intergenic
971370299 4:26013746-26013768 GGTTCTCCTGCACTTGGTGACGG + Intergenic
972706994 4:41554517-41554539 GGTTCCCCTGCAGTTTTTACTGG - Intronic
976626053 4:87183368-87183390 GGTTCGCCTGCCATTGTTGCCGG - Exonic
980532220 4:134070666-134070688 AGTTCACCTGCACATTTTGCTGG - Intergenic
982720466 4:158854565-158854587 TGTTAACCTGTATTTGTTACAGG - Intronic
995981948 5:118114763-118114785 GGTGTACTTGCATTTCTTGCAGG - Intergenic
996920918 5:128766598-128766620 TATTAACCTGAATTTGTTGCAGG + Intronic
998060854 5:139117802-139117824 GATTCACCTGCAGCTGTTCCAGG + Intronic
1004472976 6:15945708-15945730 TTTGCACCTGCATTTCTTGCAGG - Intergenic
1007397208 6:41584810-41584832 GGATCTGCTGCATCTGTTGCGGG - Exonic
1010144958 6:72657586-72657608 TGTTCACCTGCAGTGGTTCCTGG + Intronic
1011350312 6:86415908-86415930 CTTTCACCTGCACTTGTTGTGGG - Intergenic
1012601857 6:101108544-101108566 TTTTCAGCTGCATTTCTTGCTGG - Intergenic
1016239429 6:141911697-141911719 GGTTTCCCTGCCTTTGTGGCTGG - Intergenic
1016325280 6:142893758-142893780 GTTTCACCTGCATTTTTCGGGGG + Intronic
1019141619 6:169950352-169950374 GATTCAGCTGGATTTGTTGCAGG - Intergenic
1019189208 6:170240483-170240505 GGTTCACTTGCATTTCTTCTTGG - Intergenic
1019335766 7:481767-481789 GCTTCACCTGCATCCCTTGCTGG + Intergenic
1020334321 7:7050692-7050714 GATTCACTTATATTTGTTGCAGG - Intergenic
1022327059 7:29342058-29342080 TGTTCATTTGCCTTTGTTGCTGG + Intronic
1022881843 7:34595785-34595807 GCTTCACCTGTATTTATAGCTGG + Intergenic
1029583937 7:101457816-101457838 AGTTTACTTGTATTTGTTGCTGG + Intronic
1033768173 7:144517865-144517887 GCTTTACCTGCATTTATAGCAGG - Intronic
1040845485 8:51833657-51833679 TGTGAACCTGCATTTGTTGTTGG - Exonic
1041928981 8:63266916-63266938 TGGTCACCTGTATTTATTGCTGG - Intergenic
1046163723 8:110401172-110401194 GGTTCACCTGCCTTTGCAGAGGG - Intergenic
1052644879 9:31220990-31221012 ATTGCACCTGCATTTGTTGGGGG - Intergenic
1057263576 9:93599581-93599603 GCTTCACCGGCATTTGTTCCTGG - Intronic
1060998335 9:127887477-127887499 GGCTCACCTGCAGTAGTTGGGGG + Exonic
1193970518 X:88045655-88045677 GTTTCTCTTGCATTTGTTTCTGG - Intergenic
1195479881 X:105332252-105332274 GGTTCACCTGCATTTGTTGCTGG + Intronic
1196720548 X:118849747-118849769 TATTCACCTGCATTTCTTGGGGG + Intergenic
1200074938 X:153546208-153546230 GGTTCACCTGCCTCGGTGGCAGG + Intronic