ID: 1195485665

View in Genome Browser
Species Human (GRCh38)
Location X:105403016-105403038
Sequence TAAAGTGTGCTGCAACATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195485663_1195485665 9 Left 1195485663 X:105402984-105403006 CCTAAAAATGTCAAAGGAGAGAC 0: 1
1: 0
2: 3
3: 51
4: 521
Right 1195485665 X:105403016-105403038 TAAAGTGTGCTGCAACATAGTGG 0: 1
1: 0
2: 1
3: 5
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195485665 Original CRISPR TAAAGTGTGCTGCAACATAG TGG Intronic
900730156 1:4253059-4253081 TAAAATGTGCAGTAACAGAGGGG - Intergenic
905524828 1:38628633-38628655 CAAATTGTGCTCAAACATAGTGG - Intergenic
907676720 1:56524470-56524492 TATAGAGTGCTGCCACGTAGGGG + Exonic
909385353 1:75049052-75049074 TAAACAGTGCTGCAACAAACAGG - Intergenic
910333415 1:86101729-86101751 TAAAGTCTGCTTGATCATAGTGG + Intronic
913079264 1:115366615-115366637 TAAAGAGTGCTGAATCATGGTGG + Intergenic
917282418 1:173391216-173391238 TAAAGTGGGGTGCTGCATAGGGG - Intergenic
918255953 1:182747430-182747452 TAAGGAGTGCTGTAACATAAGGG + Intergenic
918416418 1:184312795-184312817 TAAAATGTGCTGCAATAAACAGG + Intergenic
921399383 1:214703826-214703848 TAAATAGTGCTGCAACAAACAGG + Intergenic
922386739 1:225093280-225093302 TAAAGTCTGCTTCATCAGAGTGG - Intronic
922673729 1:227536483-227536505 TAAAATGTGATGAAACAGAGTGG - Intergenic
1063511324 10:6647564-6647586 TAAAGAATGCTGAAAGATAGAGG + Intergenic
1063687783 10:8254973-8254995 TATAGGGTGCTGCAGCAAAGAGG - Intergenic
1064068584 10:12205361-12205383 TAAACAGTGCTGCAACAAACAGG + Intronic
1068556338 10:58463346-58463368 TAAACAGTGCTGCAACAAACAGG + Intergenic
1077471395 11:2762428-2762450 TAAAGGGTGCTGGAACAATGTGG - Intronic
1079454860 11:20627512-20627534 TAAAGTCTGCAGCGGCATAGAGG + Intronic
1080174358 11:29343915-29343937 CAGAGTGTGCTGCCACCTAGCGG - Intergenic
1081681482 11:45008533-45008555 TGAAGTGTGCTGCAGCAAACAGG + Intergenic
1086771434 11:90772607-90772629 TAAATAGTGCTGAAACATATGGG - Intergenic
1086977680 11:93155261-93155283 TTCAGTGTGCTGCAACTTCGGGG + Intronic
1091965687 12:4739571-4739593 TAAATTGGGCTGCAACCCAGTGG + Intronic
1093875797 12:24348338-24348360 TCAATAGAGCTGCAACATAGAGG - Intergenic
1094010014 12:25798050-25798072 TCAAAGGTGCTGCAACACAGCGG + Intergenic
1094808485 12:34113816-34113838 TAAAATGTGATGAAACAGAGTGG + Intergenic
1096314633 12:50553477-50553499 TAAACTGACCTGCAACATACAGG - Intronic
1100118976 12:91345705-91345727 TGAAATGTGCTGAAACATAATGG - Intergenic
1100184480 12:92124512-92124534 GAAAGTGCTTTGCAACATAGAGG - Intronic
1106465611 13:30011800-30011822 GAAAGTGTGCTCCAATAAAGTGG - Intergenic
1109236481 13:59827439-59827461 TAAGGAGTTCTGCAACAAAGGGG + Intronic
1109241367 13:59893685-59893707 TAAACTAATCTGCAACATAGAGG - Intronic
1110597161 13:77331825-77331847 TAAACAGTGCTGCAACAAACAGG + Intergenic
1112667515 13:101593471-101593493 TAAATAGTGCTGCAATAAAGGGG - Intronic
1114368999 14:22064594-22064616 TAAACAGTGCTGCAACAAACAGG - Intergenic
1115405022 14:33005601-33005623 TAATCTGTGCTGGAAAATAGAGG + Intronic
1118247834 14:64128944-64128966 CAAACAGTGCTGGAACATAGTGG - Intronic
1126503607 15:49377305-49377327 TGAACAGTGCTGCAACATACAGG + Intronic
1126646312 15:50878124-50878146 TCACATGTGCTACAACATAGAGG + Intergenic
1132119518 15:99164849-99164871 TAAAGTGTGCTGCTTCTTGGAGG + Intronic
1135596488 16:23747946-23747968 AAAAGTGTGGTAGAACATAGTGG - Intergenic
1135879928 16:26245265-26245287 TAAACGGTGCTGCAACAAACAGG - Intergenic
1136273923 16:29166742-29166764 TAAAGTGTTCTGAACCACAGTGG - Intergenic
1138781441 16:59793113-59793135 TAAATGATGCTGCAACATATGGG + Intergenic
1139630426 16:68228679-68228701 TAAATTTTTGTGCAACATAGTGG + Exonic
1146681996 17:34815175-34815197 TAAAGTGTCCTGCACCCTGGAGG + Intergenic
1148011398 17:44484812-44484834 TGATGTGTCCTGCAGCATAGTGG + Intronic
1150660981 17:67078490-67078512 TACAGTGTGCTGCAGCATCTTGG - Exonic
1153516933 18:5912486-5912508 TAAATGGAGCTACAACATAGAGG - Intergenic
1154181266 18:12142018-12142040 GCAAGTGTGGTTCAACATAGAGG - Intergenic
1154182638 18:12149566-12149588 GCAAGTGTGGTTCAACATAGAGG + Intergenic
1157156504 18:45272292-45272314 TAAACAGTGCTGCAACAAACAGG - Intronic
1157225737 18:45862464-45862486 TAAACTCTGCTCCAACATTGGGG - Intronic
1159104374 18:63988856-63988878 TAAAGTGTTCTTCAAATTAGAGG - Exonic
1166793369 19:45411235-45411257 TGAACTGTGCTGCAACAAACAGG + Intronic
926036578 2:9640530-9640552 AAAAGTGTGATGCAATCTAGAGG - Intergenic
930353446 2:50287783-50287805 TTAAGCGTGCTGCAACATATGGG - Intronic
933450555 2:82444592-82444614 TAAAGTGTCCTGCACAATAGAGG - Intergenic
935745122 2:106183661-106183683 TAAAGTAACCTGCAACATGGAGG - Intronic
939672898 2:145035403-145035425 TAAAGAGTTCTGCAACTTATTGG - Intergenic
939967814 2:148627788-148627810 CAGAGTATGCAGCAACATAGTGG - Intergenic
941158449 2:162007290-162007312 TAAAGTCTGCAGCTACCTAGGGG - Intronic
943967506 2:194355583-194355605 AAAAGTGTTCTGAAAAATAGAGG + Intergenic
945539831 2:211071562-211071584 AAAAGTGTGCTCCCAAATAGAGG - Intergenic
945707892 2:213258471-213258493 TAAAGTGTTCTTCAGCATAAAGG - Intergenic
947288260 2:228542623-228542645 AACAGTGTGCTCCACCATAGAGG - Intergenic
947708440 2:232294776-232294798 TAAACTCTCCTGTAACATAGAGG + Intronic
948252416 2:236540666-236540688 TAATGTGTGGTGCAAAATAAGGG + Intergenic
1172265077 20:33604752-33604774 TACAGTGTGCAACAACCTAGAGG - Intronic
1175784033 20:61700906-61700928 GAAAGTGTTCTGCAAAAAAGGGG - Intronic
1176106374 20:63391409-63391431 CAAATTGTGCTAAAACATAGTGG + Intergenic
953864236 3:46570587-46570609 TAAACAGTGCTGCAACAAACAGG - Intronic
957473355 3:80691255-80691277 TAAAGAGTGCTGCAACAAAGAGG + Intergenic
959797643 3:110450952-110450974 TAAACAGTGCTGCAACAAACAGG + Intergenic
963796131 3:149632737-149632759 TGATGTATGCTACAACATAGAGG + Intronic
969100729 4:4766279-4766301 TAAAGAGTGCTGTGACAGAGGGG + Intergenic
970080915 4:12284166-12284188 AAAAGAGTGTTTCAACATAGTGG + Intergenic
972271804 4:37518213-37518235 TAAACAGTGCTGCAACAAACAGG + Intronic
979430812 4:120628114-120628136 TAAAGAGTGCTGCGAAATATGGG + Intergenic
980437138 4:132791749-132791771 TAAACAGTGCTGCAACAAACAGG + Intergenic
984455879 4:179967163-179967185 TCATGTGTGCTGCAGCATATGGG - Intergenic
984531429 4:180921296-180921318 AAAACTGTGTTGCAACATACTGG + Intergenic
984992082 4:185390788-185390810 TAAAGTGTACTTCAAAAAAGAGG - Intronic
990843829 5:60113952-60113974 AAAATTGTTCTGCAACATGGTGG + Intronic
990965045 5:61437088-61437110 AAAAGGGTTCTGCAACATAAGGG + Intronic
996132814 5:119802552-119802574 TAAACAGTGCTGCAACAAACAGG + Intergenic
998945614 5:147336539-147336561 TAAAGTTTACTGAAATATAGTGG - Intronic
1000157540 5:158566478-158566500 TGAACTGTACTGCAAGATAGAGG - Intergenic
1000219740 5:159202367-159202389 TACAGTGTTTTGCAACATAAAGG + Intronic
1001446250 5:171786095-171786117 TAAACTGTGCTCCATCAGAGTGG - Intronic
1001669852 5:173464443-173464465 TAAATTGTCCTGCAACACAGAGG - Intergenic
1006092882 6:31638339-31638361 TTAAGTGTGCTCCAACATTGAGG - Intergenic
1006857564 6:37145966-37145988 TAAAGTGTTTTGTAAAATAGGGG - Intergenic
1009486540 6:64230712-64230734 CAGAGGGTGCTGCAACAGAGGGG + Exonic
1016456417 6:144235412-144235434 TATAGTGTCCTGCAATATATAGG - Intergenic
1017020440 6:150135910-150135932 TAAAGAGGGCAGGAACATAGAGG + Intergenic
1017249967 6:152269902-152269924 GAAAATGTACTGCAGCATAGAGG + Intronic
1018281181 6:162187423-162187445 TAAATTGTGCTTCAACACTGAGG + Intronic
1022223280 7:28336237-28336259 TAAACTGTTCTGAAAAATAGAGG - Intronic
1026745427 7:73007716-73007738 TTCACTGTGCTGCAATATAGGGG + Intergenic
1026749078 7:73035650-73035672 TTCACTGTGCTGCAATATAGGGG + Intergenic
1026752726 7:73063795-73063817 TTCACTGTGCTGCAATATAGGGG + Intergenic
1026756377 7:73091927-73091949 TTCACTGTGCTGCAATATAGGGG + Intergenic
1027031537 7:74892393-74892415 TTCACTGTGCTGCAATATAGGGG + Intergenic
1027091028 7:75301498-75301520 TTCACTGTGCTGCAATATAGGGG - Intergenic
1027094673 7:75329470-75329492 TTCACTGTGCTGCAATATAGGGG - Intergenic
1027098314 7:75357376-75357398 TTCACTGTGCTGCAATATAGGGG - Intergenic
1027324668 7:77038213-77038235 TTCACTGTGCTGCAATATAGGGG + Intergenic
1029172323 7:98639833-98639855 TAAAGAGACCTGCAACAAAGTGG - Intergenic
1029399427 7:100334270-100334292 TTCACTGTGCTGCAATATAGGGG - Intergenic
1031559723 7:123223995-123224017 TAAACTGTTCTGTAAAATAGAGG - Intergenic
1032939515 7:136772545-136772567 CAAACTGTTCTGAAACATAGAGG + Intergenic
1033727386 7:144133199-144133221 TATTGTGTGCTGCTATATAGCGG - Intergenic
1035874089 8:3168457-3168479 GATAATGTGCTGGAACATAGGGG + Intronic
1036031017 8:4973158-4973180 TAAAGTGTTCTGCAAGATATTGG - Intronic
1039147852 8:34469373-34469395 GAAAGTGTGCTACAACATTATGG - Intergenic
1042387344 8:68192551-68192573 TAAAGTGTGATCTAACAAAGAGG - Intronic
1043838577 8:85074309-85074331 TAAAGTATGAAGCAACAGAGTGG + Intergenic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1046209384 8:111047695-111047717 TGAATAGTGCTGCAACAGAGGGG - Intergenic
1046655935 8:116894071-116894093 AAAAGAAGGCTGCAACATAGTGG + Intergenic
1052927949 9:34033166-34033188 TAAACAGTGCTGCAACAAACAGG - Intronic
1058469298 9:105260797-105260819 TCAAGTCTGCTGCAGCAGAGGGG + Intronic
1058922777 9:109633140-109633162 ATAAGTATGCTGCAACAAAGAGG + Intergenic
1189852385 X:45190580-45190602 TCAACTGTGCTGCAACATCCTGG - Intronic
1191795336 X:65015917-65015939 AAAAGTGTTCTGCATAATAGAGG - Intronic
1194408574 X:93528893-93528915 TAAAGTGTGGTTCAACATGATGG + Intergenic
1195133241 X:101875869-101875891 TAAACAGTGCTGCAACAAACAGG - Intergenic
1195168282 X:102241489-102241511 TAAACAGTGCTGCAACAAACAGG + Intergenic
1195190575 X:102445598-102445620 TAAACAGTGCTGCAACAAACAGG - Intronic
1195485665 X:105403016-105403038 TAAAGTGTGCTGCAACATAGTGG + Intronic
1196590641 X:117482458-117482480 CAAAGTATTCTGAAACATAGAGG - Intergenic
1196986464 X:121278551-121278573 TAAAGTATTCTGAAAAATAGAGG + Intergenic
1199259135 X:145750340-145750362 TAAACAGTGCTGCAGCAAAGAGG - Intergenic