ID: 1195489469

View in Genome Browser
Species Human (GRCh38)
Location X:105450215-105450237
Sequence AGGGCGAGTGCAGTGACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 215}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195489469_1195489477 -9 Left 1195489469 X:105450215-105450237 CCCCAAGTCACTGCACTCGCCCT 0: 1
1: 0
2: 3
3: 35
4: 215
Right 1195489477 X:105450229-105450251 ACTCGCCCTCTGGGAGATGGGGG 0: 1
1: 0
2: 0
3: 13
4: 190
1195489469_1195489482 5 Left 1195489469 X:105450215-105450237 CCCCAAGTCACTGCACTCGCCCT 0: 1
1: 0
2: 3
3: 35
4: 215
Right 1195489482 X:105450243-105450265 AGATGGGGGAGTGGTGGCATAGG 0: 1
1: 1
2: 21
3: 117
4: 817
1195489469_1195489479 -4 Left 1195489469 X:105450215-105450237 CCCCAAGTCACTGCACTCGCCCT 0: 1
1: 0
2: 3
3: 35
4: 215
Right 1195489479 X:105450234-105450256 CCCTCTGGGAGATGGGGGAGTGG 0: 1
1: 0
2: 4
3: 69
4: 575
1195489469_1195489481 -1 Left 1195489469 X:105450215-105450237 CCCCAAGTCACTGCACTCGCCCT 0: 1
1: 0
2: 3
3: 35
4: 215
Right 1195489481 X:105450237-105450259 TCTGGGAGATGGGGGAGTGGTGG 0: 1
1: 2
2: 15
3: 113
4: 987
1195489469_1195489476 -10 Left 1195489469 X:105450215-105450237 CCCCAAGTCACTGCACTCGCCCT 0: 1
1: 0
2: 3
3: 35
4: 215
Right 1195489476 X:105450228-105450250 CACTCGCCCTCTGGGAGATGGGG 0: 1
1: 0
2: 0
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195489469 Original CRISPR AGGGCGAGTGCAGTGACTTG GGG (reversed) Intronic
900767735 1:4516445-4516467 AAGGCGAGTGCAGGCACTGGAGG - Intergenic
904421657 1:30398248-30398270 AGGGGGAGTGAGGTGACATGGGG + Intergenic
904421672 1:30398302-30398324 AGGGGGAGTGAGGTGACCTGGGG + Intergenic
904421687 1:30398355-30398377 AAGGAGAGTGAAGTGACCTGGGG + Intergenic
904421703 1:30398409-30398431 AGGGGGAGTGAGGTGACCTGGGG + Intergenic
904421714 1:30398436-30398458 AGGGGGAGTGAGGTGACCTGGGG + Intergenic
904421741 1:30398516-30398538 AGGGGGAGTGAGGTGACCTGGGG + Intergenic
906181248 1:43821550-43821572 AAGCAGAGAGCAGTGACTTGAGG + Intronic
906678120 1:47708071-47708093 AGGGGGAGCTCAGTGACTCGCGG - Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909146501 1:71940068-71940090 AGGGGGAGTTCAGTGAAGTGAGG + Intronic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
913659824 1:120996836-120996858 AGAGAGAGAGAAGTGACTTGTGG + Intergenic
914011181 1:143779974-143779996 AGAGAGAGAGAAGTGACTTGTGG + Intergenic
914166653 1:145181162-145181184 AGAGAGAGAGAAGTGACTTGTGG - Intergenic
914649804 1:149688613-149688635 AGAGAGAGAGAAGTGACTTGTGG + Intergenic
914779697 1:150773997-150774019 GAGGCCAGTGCAGTGGCTTGGGG - Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919794873 1:201315543-201315565 AGGGCCAGTGGTGTGCCTTGAGG + Intronic
920432293 1:205926756-205926778 AGGTCGAATGCAGAGATTTGGGG - Intronic
923496589 1:234531000-234531022 TGGGCAGGTGCAGTGACCTGGGG - Intergenic
923613206 1:235513549-235513571 AGGGAGAGTACTGTGAGTTGAGG + Intergenic
924271639 1:242339752-242339774 AGGACGAATGAAGTCACTTGGGG + Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1063198246 10:3763083-3763105 TGGGCGAGTAGAGTGACCTGGGG - Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1070509400 10:77146861-77146883 AGGCCAAGTGCAGGGACTTCTGG - Intronic
1070553782 10:77512899-77512921 AGGACAAGTGCAGTGGCCTGAGG + Intronic
1071998317 10:91168585-91168607 AGGGAGAAGGCAATGACTTGAGG + Intronic
1072336605 10:94403251-94403273 AGGGCGCGGGCAGCGACTCGGGG + Exonic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076774655 10:132688045-132688067 AGGGCGTGTGCAGTGCATGGTGG - Intronic
1080707252 11:34707941-34707963 AGGGCAAGCACAGTGACTAGGGG - Intergenic
1081587597 11:44398121-44398143 AGGGCGGGCACAGGGACTTGCGG - Intergenic
1083820963 11:65171217-65171239 GGGGTGGGTGCAGAGACTTGGGG - Intronic
1084959747 11:72710182-72710204 AGGGCCAGGGCAGGGACTGGAGG + Intronic
1085031249 11:73272160-73272182 AGGGTGAATGAAGTGACTTGCGG + Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085727525 11:78967165-78967187 AGGGAGAGTCCAGGGAGTTGTGG - Intronic
1085816168 11:79739499-79739521 AGGGCAAGTGCAGAGACAAGCGG - Intergenic
1091093595 11:132795552-132795574 AGTAGGAGTGCAGAGACTTGGGG - Intronic
1092617333 12:10227075-10227097 AGGGCCACTGCAGTGACCAGGGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096548948 12:52359732-52359754 AGGGTGAGAGCAGTGAGTTTGGG + Intergenic
1097899388 12:64857899-64857921 TGGGAGAGTGCAGTGACTAGAGG - Intronic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1102032350 12:109748496-109748518 TGGGCTAGTGCAGTTATTTGGGG + Intronic
1104779854 12:131413120-131413142 AGGCTGAGAGCAGAGACTTGAGG + Intergenic
1105397388 13:20051474-20051496 AGAGCGAGTTCAGTGGCGTGGGG + Exonic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111003190 13:82212762-82212784 AGGCTGGGTGCAGTGCCTTGTGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113852400 13:113425228-113425250 GGGGCGGGTGCAGGGAGTTGGGG + Intronic
1113897674 13:113776220-113776242 TGGGTGAGTGGAGCGACTTGGGG + Intronic
1114417208 14:22552836-22552858 AGGGAGAGCGCAGTGAGCTGTGG - Intergenic
1115120385 14:29929888-29929910 ATGGCGAAGACAGTGACTTGTGG + Intronic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1117371230 14:55080140-55080162 AGGGAAATTGAAGTGACTTGGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1121472499 14:94166166-94166188 AGGGAGAGGGCAGTGAGATGGGG - Intronic
1121803556 14:96795559-96795581 AGGGAGGATGCAGTAACTTGTGG + Intergenic
1122593625 14:102873163-102873185 CAGGTGAGTGCAGTGATTTGAGG + Intronic
1122865903 14:104603877-104603899 AGGGCGAGGGCTGTGCCTTGTGG - Intronic
1124456316 15:29846032-29846054 GGTGTGAGTGCAGTGAGTTGGGG - Intronic
1125585427 15:40816021-40816043 CGGGAAAGTGCTGTGACTTGGGG - Intronic
1126452453 15:48823566-48823588 AGGGAGAATGCAGTGCCTTGGGG - Intergenic
1126740576 15:51772736-51772758 TGGGCTAGTGTAGTGACCTGGGG - Intronic
1128603440 15:69016512-69016534 AGGGCCCCTGCATTGACTTGGGG - Intronic
1128702326 15:69813517-69813539 GGGACGAGAGCAGTGACTTTGGG + Intergenic
1129556456 15:76515286-76515308 AGGGTGAGTGCAGTAACTGAAGG + Intronic
1134631934 16:15762648-15762670 AGGGGGAGGCCAGTGAGTTGGGG - Intronic
1136227758 16:28870437-28870459 AGGGCAAGAGCAGAGACCTGCGG + Intronic
1137320910 16:47380629-47380651 AGGGAGAGTGGGGTGAGTTGTGG + Intronic
1137554702 16:49463265-49463287 AGGGAGAGTGCACTGAGGTGAGG - Intergenic
1138773569 16:59693658-59693680 AGGGCAAGGGAGGTGACTTGAGG + Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1141621446 16:85238589-85238611 AGGGGGAGTGCAGAGGCTGGCGG - Intergenic
1141639820 16:85334573-85334595 AGGGGCAGTGCATTGACTTTTGG + Intergenic
1142760015 17:2036630-2036652 AGGGCAAGGGCAGTGGCTGGGGG - Exonic
1144472434 17:15556686-15556708 AGGGGAATTGCAGTGAATTGAGG - Intronic
1144924042 17:18788002-18788024 AGGGGAATTGCAGTGAATTGAGG + Intronic
1145069085 17:19787910-19787932 AGGGAGAGTGCAGCAATTTGGGG + Intronic
1145246659 17:21274050-21274072 AGGGTGGGTGCAGTGGCTTGGGG - Intergenic
1145943624 17:28757677-28757699 AGGGCAAGTGCAGTGGCTGTGGG + Exonic
1148755683 17:49971895-49971917 AGGGCGGGTACACTGACGTGTGG + Intronic
1149639629 17:58194197-58194219 CTGACCAGTGCAGTGACTTGAGG + Intronic
1156045219 18:32870456-32870478 AGGTACAGTGCAGTGACTTAGGG - Intergenic
1156519963 18:37713814-37713836 AGTGTGAGTTCAGGGACTTGGGG - Intergenic
1157847413 18:51017049-51017071 AGTGCCAGTGGAGTGCCTTGAGG + Intronic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1159890422 18:73948192-73948214 AGGCAGCGTGGAGTGACTTGGGG + Intergenic
1161236181 19:3199271-3199293 AAGGCGCGTGCGGTGAGTTGGGG + Intronic
1161467462 19:4439590-4439612 AGGGAGGGCCCAGTGACTTGAGG + Intronic
1162289471 19:9768288-9768310 AGGGCGATTGCAGTGCGTTCCGG - Exonic
1166301563 19:41914377-41914399 AGGGAGAGGGCAGTGAGGTGGGG - Intronic
1168544337 19:57238112-57238134 AGGCCGAGTGCAGTGGCTCACGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
933277957 2:80303105-80303127 AGAGCGAGTGCAGGGAGATGAGG + Exonic
935437954 2:103056898-103056920 AGGGAGAGTGCCGTGACTAGGGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
938211214 2:129466941-129466963 AAGGGGAGAGCAGAGACTTGAGG + Intergenic
938931900 2:136094045-136094067 AGAGCTAGTGCAGTGAGTAGGGG - Intergenic
940285163 2:152026658-152026680 AGGCCGAGTGCAGTGGCTCATGG - Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944427437 2:199598167-199598189 AGGGCTAGTGCAGTAACTAGGGG - Intergenic
944555489 2:200884129-200884151 AGGCCGGGTGCAGTGGCTTTGGG + Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
946756104 2:222949270-222949292 AGGGCCAGTGCTGAGACCTGTGG + Intergenic
947244087 2:228027685-228027707 AGGGCGGGCGCAGTGGCTTATGG + Intronic
948457866 2:238115291-238115313 AGGGCGAGTGCCTTGTCCTGGGG - Intronic
948516380 2:238506318-238506340 AGGGCCAGTGCAGTGCTCTGGGG + Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1170597430 20:17816630-17816652 AGGTCGAGTCAAGTGACTTGGGG - Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172245948 20:33444800-33444822 AGGCCTAGAGCAGTGACGTGAGG - Intergenic
1173844284 20:46178211-46178233 AGGGGGAGCGGTGTGACTTGGGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1181519169 22:23435481-23435503 AGGGAGTGTGCAGTGACATTGGG + Intergenic
1183010694 22:34944274-34944296 AGAGCTAGTGCAGTGACCTGAGG - Intergenic
1183096721 22:35556479-35556501 TGGGAGAGTCCAGTGAGTTGGGG + Intergenic
1183311836 22:37114125-37114147 AGAACAAGTGCTGTGACTTGGGG - Intergenic
1184318487 22:43719130-43719152 AGGGCGTGTGCACAGACCTGTGG - Intronic
1184339802 22:43880052-43880074 ATGGGGAGAGCAGTGACTCGTGG + Exonic
1185043113 22:48515753-48515775 AGGGACAGTGCGGGGACTTGGGG + Intronic
949928484 3:9060074-9060096 AGGGGAAGGGCAGTGATTTGGGG - Intronic
954415680 3:50392195-50392217 GGGGAGGGTGCAGGGACTTGAGG - Intronic
954493591 3:50930942-50930964 CAGGAGAGGGCAGTGACTTGGGG + Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
963283577 3:143411485-143411507 AGGGCTAGTTCTGTGTCTTGAGG + Intronic
964675408 3:159273341-159273363 ATGGTGTGTGCAGTGCCTTGTGG + Intronic
965403756 3:168245960-168245982 AGGGAGAGTGAAGTGGCATGTGG + Intergenic
970368813 4:15387579-15387601 AGGGGGATTCCAGTGACTAGTGG + Intronic
971114509 4:23629280-23629302 ATGGTGAGTTCAGTGAGTTGGGG + Intergenic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
974456194 4:62131478-62131500 TGGGGGGGTGCAGTGTCTTGGGG - Intergenic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
978925611 4:114239392-114239414 AGTGAGACTGCAGTGAGTTGTGG - Intergenic
979929767 4:126616664-126616686 AGGGTGAGTGAAGGAACTTGGGG + Intergenic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
982683486 4:158459943-158459965 AAGGAGAGTGCAGTGGCTGGGGG - Intronic
982782589 4:159506785-159506807 ATGGCGAGTGCAGTGAGCTGAGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
986989332 5:13533288-13533310 AAGGCAAGTGCAGTGATGTGAGG - Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
990611766 5:57464715-57464737 AGGGCCAGTGTAATGACTTCTGG - Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991915071 5:71597481-71597503 AGGGCGATTGCAAGGATTTGAGG + Intronic
992995004 5:82323952-82323974 AGGGATAGTGTAGTGACCTGGGG - Intronic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993703232 5:91142987-91143009 AGGGCGAGTGGAGTGGCGAGGGG + Intronic
994245666 5:97472245-97472267 TGGGTGAGAGCAGTGACATGGGG + Intergenic
994539332 5:101075115-101075137 TGGTTGAGTGCAGTCACTTGGGG - Intergenic
995278760 5:110308617-110308639 AGGGTGAGAGCAGTGAGTTGGGG - Intronic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
996854202 5:127986939-127986961 AGGGAGAGTCCAAGGACTTGGGG + Intergenic
997675677 5:135711348-135711370 AAGACAAGTGCAGTAACTTGGGG - Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1001484994 5:172113281-172113303 TGGGTGTGTGCAGTGAGTTGGGG - Intronic
1003058190 6:2841676-2841698 AGGGCGAGCGCAGGGAGCTGCGG + Intronic
1003346433 6:5272218-5272240 AGGGTGAGTGCAGTGGGATGAGG + Intronic
1007270798 6:40635491-40635513 ATGGTGAGTGCAGGGACTTCAGG - Intergenic
1007423570 6:41733942-41733964 AGGGCGGGTGCAGGGGCCTGAGG + Intronic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016344083 6:143092767-143092789 AGGTCAGGTGCAGTGGCTTGTGG + Intronic
1017823728 6:158066633-158066655 AGGGTGAGGGCAGTGACTTTGGG + Exonic
1019592112 7:1840845-1840867 AGGGAGTGTGCAGTGACATTGGG - Intronic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1023996107 7:45159816-45159838 AGGCCCAGTGCAGTCACTGGTGG - Intronic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025724966 7:64047964-64047986 GGGGCAAGTGCAGTGTCTTTTGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028341616 7:89728732-89728754 AGGGCGACTGCAGTAACTATAGG - Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034264482 7:149774225-149774247 AGGGCGAGTGGAGTCCCCTGAGG - Intergenic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1034894791 7:154869565-154869587 AGGGCAAGTGCAGTGCAGTGTGG + Intronic
1037902115 8:22694501-22694523 AGGGGGAGGGCAGAGACTAGGGG - Intergenic
1038487637 8:27948250-27948272 AGGGTGAGGGCGGTGACTTAGGG + Intronic
1042338848 8:67657834-67657856 AGGGAGAGTGCACTGGCATGAGG - Intronic
1042737462 8:72005098-72005120 AGCGCGAGGGCAGTGACTTGAGG - Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1049538619 8:143194768-143194790 AGGGCCAGTGCAGGGGCTGGTGG + Intergenic
1050174119 9:2852393-2852415 AGCAAGAGTGCATTGACTTGGGG - Intergenic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1053030954 9:34777461-34777483 AGGGCGAGGGCAGTGAAGTTGGG + Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054745709 9:68852294-68852316 AGGGGTAGTTCAGTGTCTTGAGG + Intronic
1057500402 9:95593271-95593293 AGTGCGAGTGCAGGGACCAGGGG + Intergenic
1057987415 9:99731496-99731518 AGTGCGTGTGCAGTGACTGGGGG + Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1060060756 9:120457310-120457332 AGGGAGAGTGCAGTGGGCTGTGG - Intronic
1061208859 9:129179211-129179233 CGGAGGAGTGGAGTGACTTGGGG + Intergenic
1061729891 9:132605644-132605666 AGGGCCAGGGCAGAGACGTGAGG + Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1189277530 X:39797587-39797609 AGGGTGAGTGCAGAATCTTGAGG + Intergenic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194401837 X:93446935-93446957 AGGGCAAGTCCAGGGATTTGAGG - Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1196584212 X:117410240-117410262 AGGGCTAGTGCAGTCATTTGGGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG + Intergenic
1199453590 X:148001504-148001526 AGGCCGGGTGCAGTGGCTTACGG + Intronic
1199975291 X:152891637-152891659 AGGGTGAGAGCAGTGAGGTGTGG - Intergenic
1200152291 X:153957138-153957160 AGGGCTATGGCTGTGACTTGTGG - Intronic