ID: 1195493604 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:105503457-105503479 |
| Sequence | AAGAGAAAAAAGAAGGAAGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 5081 | |||
| Summary | {0: 1, 1: 0, 2: 33, 3: 493, 4: 4554} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1195493601_1195493604 | 0 | Left | 1195493601 | X:105503434-105503456 | CCAGAATTTCCAGTTCTCTAAAT | 0: 1 1: 0 2: 4 3: 40 4: 420 |
||
| Right | 1195493604 | X:105503457-105503479 | AAGAGAAAAAAGAAGGAAGCTGG | 0: 1 1: 0 2: 33 3: 493 4: 4554 |
||||
| 1195493602_1195493604 | -9 | Left | 1195493602 | X:105503443-105503465 | CCAGTTCTCTAAATAAGAGAAAA | 0: 1 1: 0 2: 5 3: 75 4: 1076 |
||
| Right | 1195493604 | X:105503457-105503479 | AAGAGAAAAAAGAAGGAAGCTGG | 0: 1 1: 0 2: 33 3: 493 4: 4554 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1195493604 | Original CRISPR | AAGAGAAAAAAGAAGGAAGC TGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||