ID: 1195493604

View in Genome Browser
Species Human (GRCh38)
Location X:105503457-105503479
Sequence AAGAGAAAAAAGAAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5081
Summary {0: 1, 1: 0, 2: 33, 3: 493, 4: 4554}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195493601_1195493604 0 Left 1195493601 X:105503434-105503456 CCAGAATTTCCAGTTCTCTAAAT 0: 1
1: 0
2: 4
3: 40
4: 420
Right 1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG 0: 1
1: 0
2: 33
3: 493
4: 4554
1195493602_1195493604 -9 Left 1195493602 X:105503443-105503465 CCAGTTCTCTAAATAAGAGAAAA 0: 1
1: 0
2: 5
3: 75
4: 1076
Right 1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG 0: 1
1: 0
2: 33
3: 493
4: 4554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195493604 Original CRISPR AAGAGAAAAAAGAAGGAAGC TGG Intronic
Too many off-targets to display for this crispr