ID: 1195501091 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:105600763-105600785 |
| Sequence | CTACTAAGAAGTAGAATTGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2317 | |||
| Summary | {0: 1, 1: 2, 2: 35, 3: 365, 4: 1914} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1195501090_1195501091 | -7 | Left | 1195501090 | X:105600747-105600769 | CCATTTTCTAATTTAGCTACTAA | 0: 1 1: 0 2: 2 3: 23 4: 353 |
||
| Right | 1195501091 | X:105600763-105600785 | CTACTAAGAAGTAGAATTGCTGG | 0: 1 1: 2 2: 35 3: 365 4: 1914 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1195501091 | Original CRISPR | CTACTAAGAAGTAGAATTGC TGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||