ID: 1195501091

View in Genome Browser
Species Human (GRCh38)
Location X:105600763-105600785
Sequence CTACTAAGAAGTAGAATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2317
Summary {0: 1, 1: 2, 2: 35, 3: 365, 4: 1914}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195501090_1195501091 -7 Left 1195501090 X:105600747-105600769 CCATTTTCTAATTTAGCTACTAA 0: 1
1: 0
2: 2
3: 23
4: 353
Right 1195501091 X:105600763-105600785 CTACTAAGAAGTAGAATTGCTGG 0: 1
1: 2
2: 35
3: 365
4: 1914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195501091 Original CRISPR CTACTAAGAAGTAGAATTGC TGG Intronic
Too many off-targets to display for this crispr