ID: 1195501559

View in Genome Browser
Species Human (GRCh38)
Location X:105606936-105606958
Sequence ATACAAACCTACAACTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 0, 3: 59, 4: 506}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195501559 Original CRISPR ATACAAACCTACAACTATAT AGG Intronic
900037285 1:425796-425818 ATAAAAACCCTCAACAATATAGG - Intergenic
900058914 1:661537-661559 ATAAAAACCCTCAACAATATAGG - Intergenic
902832091 1:19022025-19022047 ATAAAAACCTACAGCTTTACTGG + Intergenic
905162884 1:36052438-36052460 ATACAAAATTACAACTAGATAGG + Intronic
906549464 1:46650897-46650919 ATACAAAAGTACAGCTAGATGGG + Intronic
907024186 1:51099074-51099096 ATACAAACATACAGTTAGATAGG + Intergenic
907261100 1:53219240-53219262 ATACAAAATTACAGCTATATGGG + Intronic
907811831 1:57878777-57878799 ATACAAAATTACAGCTAGATAGG - Intronic
907957205 1:59241247-59241269 AGCCAAACATACAAGTATATAGG + Intergenic
908012651 1:59796499-59796521 ATACAAACTTACAGCTAGATAGG + Intergenic
908529139 1:65017107-65017129 AGACAAATCTACAATTATATGGG + Intergenic
908684550 1:66700781-66700803 GTACAAAATTACAACTAGATAGG - Intronic
908873654 1:68644968-68644990 GTTCAAACTTACAACTATTTTGG + Intergenic
909097008 1:71300252-71300274 ATACAAGCAAACAACCATATTGG + Intergenic
909574831 1:77162106-77162128 AGACAAACATACAACTACATTGG + Intronic
909769617 1:79404273-79404295 ATACAAACCAACTAGTATAGTGG - Intergenic
909869184 1:80718023-80718045 ATACAAAATTACAGCTAGATAGG - Intergenic
910487097 1:87726955-87726977 ATACATACATACATATATATCGG + Intergenic
910721433 1:90290616-90290638 ATACAAACTTACAGCTAGATAGG + Intergenic
910840704 1:91558732-91558754 ATACAAAAATACAGCTAGATAGG - Intergenic
911518331 1:98896561-98896583 ATTCTAATCTACAACTATTTGGG - Intronic
911685241 1:100768251-100768273 ATACAAAATTACAGCTAGATAGG + Intergenic
911717145 1:101146206-101146228 ATACAAAATTACAGCTAGATAGG - Intergenic
912141321 1:106731895-106731917 ATAGAAACTTACAGCTAAATAGG + Intergenic
912909167 1:113739677-113739699 ATACAAAAGTACAGCTAGATAGG - Intronic
913148751 1:116018856-116018878 ATACAAAATTACAGCTAGATAGG - Intronic
913373372 1:118125478-118125500 ATACAAAATTACCACTAGATAGG - Intronic
914979139 1:152397452-152397474 ATACAAAATTACAGCTAGATAGG + Intergenic
916990890 1:170243611-170243633 ATACAAAATTACAGCTAGATGGG - Intergenic
917154372 1:171980555-171980577 ATACAAAAGTACAGCTAGATAGG - Intronic
917363826 1:174206586-174206608 ATAGAAACCTAAAAATATAAGGG - Intronic
917732344 1:177887728-177887750 ATATAACCATACAACCATATTGG + Intergenic
917831530 1:178895045-178895067 TTCCAAACCTATAACTATATTGG + Intronic
918133773 1:181651868-181651890 ATACAAATCTGCAACTATTTGGG + Intronic
919076523 1:192820237-192820259 CTAAAAACCTGCCACTATATAGG + Intergenic
920674155 1:208027503-208027525 ATACATACATACATATATATAGG - Intronic
922138230 1:222853781-222853803 ATACAAAATTACAGCTAGATAGG + Intergenic
922988040 1:229881401-229881423 ATACACACATACACATATATAGG - Intergenic
923173287 1:231437475-231437497 ATACAAAATTACAGCTAGATAGG + Intergenic
923401845 1:233623322-233623344 ATACAAAATTACAGCTAGATAGG + Intronic
924005431 1:239604969-239604991 ATGCAAACCTACAACTTTCATGG + Intronic
1062840273 10:664775-664797 ATATATATCTACAAATATATAGG + Intronic
1062841511 10:676825-676847 ATACAAAATTACATCTAGATAGG + Intronic
1062987182 10:1779872-1779894 ATAAAAACCTAAAACCATAGTGG + Intergenic
1063845399 10:10122141-10122163 AAATAAACCTACAAATATTTGGG + Intergenic
1065083116 10:22146615-22146637 ATACAAAATTACAGCTAGATAGG - Intergenic
1066111668 10:32202782-32202804 ATACAAAATTACAGCTAGATAGG - Intergenic
1067261949 10:44700483-44700505 ATACAAATGTACAACTTTGTTGG - Intergenic
1068081157 10:52318766-52318788 ATAAAAACCTACAATTTTCTTGG - Intergenic
1068264539 10:54629555-54629577 ATAAAAACCTACAACAAACTAGG + Intronic
1068728770 10:60333022-60333044 ATAAAAACATACAATTTTATAGG + Intronic
1068795653 10:61076744-61076766 ATACAAAATTACAGCTAGATAGG - Intergenic
1068819605 10:61359019-61359041 ATAGAGACCTAAAAATATATTGG - Intergenic
1070016342 10:72536099-72536121 ATACAAAATTACACCTAGATAGG + Intronic
1070119144 10:73558772-73558794 ACACAAATTTACAACTGTATGGG - Intronic
1070339352 10:75482474-75482496 ATATAAAACTGCAACTATAGTGG - Intronic
1071239538 10:83689760-83689782 ATACAAAGCAAAAACTATAACGG + Intergenic
1072763076 10:98073762-98073784 ATACACAATTACAACTAGATAGG + Intergenic
1072981082 10:100098093-100098115 AAATAAAGCTACAATTATATGGG - Intergenic
1073506382 10:103996157-103996179 AAACTAACCTTCAACTATAAGGG - Intronic
1073579355 10:104650188-104650210 ACTCAAGCCTACAACTCTATGGG - Intronic
1074173449 10:110970146-110970168 ACACAAAACTACAGCTAGATAGG - Intronic
1074630392 10:115248064-115248086 ATACAAAATTACAGCTAGATAGG + Intronic
1074768360 10:116717003-116717025 ATACAAACCCAGCACTCTATTGG + Intronic
1074956770 10:118398173-118398195 ATACACACACACAACTATCTAGG + Intergenic
1075891821 10:125958149-125958171 ATACAAAATTACAGCTAGATAGG - Intronic
1075962101 10:126577034-126577056 ATACAAAATTACAGCTAGATAGG + Intronic
1076964011 11:63719-63741 ATAAAAACCCTCAACAATATAGG - Intergenic
1077928979 11:6710813-6710835 ATACAAAATTACAGCTAGATAGG - Intergenic
1078297053 11:10082694-10082716 ATAAAAACCTTCAACAAAATAGG + Intronic
1078711793 11:13799530-13799552 ATACAAATACAGAACTATATAGG - Intergenic
1078971327 11:16415427-16415449 ATACAAAATTACAGCTAGATAGG + Intronic
1079278719 11:19068225-19068247 ATACAAAATTACAGCTAGATAGG - Intergenic
1079648973 11:22902415-22902437 ATAAAACCATACAAGTATATTGG - Intergenic
1080988285 11:37497850-37497872 ACACAAACCTAAAAGTATAGAGG - Intergenic
1081134785 11:39426751-39426773 ATACAAAACTACAATTAGACAGG + Intergenic
1081399854 11:42630128-42630150 ATTCTACCCTACAACTATATTGG - Intergenic
1082901602 11:58259791-58259813 ATACAAAAGTACACCTAGATTGG - Intergenic
1082901641 11:58260468-58260490 ATACAAAATTACAGCTAGATGGG - Intergenic
1084866802 11:72064952-72064974 ATACAAACTCACAAGTATGTGGG - Intronic
1086452211 11:86928061-86928083 ATACATACATACATCTATGTAGG - Intronic
1087258491 11:95983443-95983465 ATACAAAATTACAGCTAGATAGG + Intronic
1087284511 11:96250501-96250523 ATACAAAATTACAGCTAGATAGG - Intronic
1087339411 11:96883686-96883708 ATACAAAATTACAGCTAGATAGG + Intergenic
1087551044 11:99648946-99648968 ATACACAACTACAGCTAGATTGG + Intronic
1087679691 11:101205749-101205771 ATACAAAATTACAGCTAGATAGG - Intergenic
1088571306 11:111226444-111226466 ATACAAAATTACAGCTAGATAGG + Intergenic
1088632311 11:111785607-111785629 AGACAAAACTACAACTGTATAGG - Intronic
1089941937 11:122427862-122427884 ATACAAATCTTCAGCTATTTTGG - Intergenic
1090296675 11:125593944-125593966 ATACACAAGTACAACTAGATAGG + Intronic
1090302230 11:125652914-125652936 ATACAAAATTACAGCTAGATAGG - Intronic
1090877048 11:130799695-130799717 ATACAAAGTTACAGCTAGATAGG - Intergenic
1090905692 11:131072865-131072887 ATACAAAGTTACATCTATATTGG + Intergenic
1092034678 12:5322651-5322673 ATACAAAATTACAGCTACATAGG + Intergenic
1092042858 12:5400577-5400599 ATACAAACCTCACACCATATTGG + Intergenic
1092496921 12:9005617-9005639 ATACAAAATTACAGCTAGATAGG + Intronic
1093018701 12:14182569-14182591 AGAAAAACCTACAAACATATTGG + Intergenic
1093198638 12:16160065-16160087 TTACAAACTTAAAAATATATTGG + Intergenic
1093210511 12:16302543-16302565 ATACAAAAGTACAAGTAGATAGG + Intergenic
1093389465 12:18601509-18601531 ATACAAAATTACAGCTAGATAGG + Intronic
1093422444 12:18989962-18989984 ATACAAACCTACAAATACAAAGG + Intergenic
1093506621 12:19874084-19874106 ATACAAAATTCCAACTAGATAGG - Intergenic
1093666651 12:21822157-21822179 ATACTAAACTACAGATATATTGG - Intronic
1093678226 12:21968866-21968888 ATACAAAGCTACAGGTAGATAGG + Intergenic
1093721339 12:22445459-22445481 ATACAAAACTTCAATTAAATAGG + Intergenic
1094165509 12:27438790-27438812 AAACAAACAAACAAATATATAGG + Intergenic
1095649598 12:44591649-44591671 ATACAAAATTACAGCTAGATAGG + Intronic
1096280757 12:50251247-50251269 ATTTATACCCACAACTATATTGG - Intronic
1096418813 12:51438231-51438253 ATAAAAAATTACAACTATATAGG - Intronic
1096719851 12:53513137-53513159 ATACAAACCTACATCTACAGAGG + Exonic
1097210338 12:57363470-57363492 ATACAAAACTATAGCTAGATAGG + Intronic
1097569203 12:61310540-61310562 ATACAAAACTACAGCTAGATAGG + Intergenic
1097976059 12:65687680-65687702 GTACAAAGCTACAATTAAATAGG + Intergenic
1098158748 12:67626832-67626854 ATAAAAAATTAAAACTATATTGG + Intergenic
1098353710 12:69589673-69589695 ATACATACCTTCATCTAAATAGG - Exonic
1098713830 12:73802781-73802803 ATACAAAATTACAGCTAGATAGG - Intergenic
1099387520 12:82033551-82033573 ATACAAAATTACATCTAGATAGG - Intergenic
1099437540 12:82661711-82661733 ATACAAAATTACAACTAGATAGG - Intergenic
1100026542 12:90135416-90135438 ATACAAAAGTACCACTAAATAGG + Intergenic
1100146931 12:91689850-91689872 ATACAAAATTACAGCTAGATAGG + Intergenic
1100193176 12:92214933-92214955 ATACAAAATTACAGCTAGATAGG - Intergenic
1100341698 12:93685319-93685341 ATACAAAATTACAGCTAGATGGG + Intronic
1101395653 12:104344678-104344700 ATATAAAACTACAGCTAGATAGG - Intronic
1105250429 13:18694253-18694275 AAACCAACCTATAACCATATGGG - Intergenic
1105252447 13:18711927-18711949 ATACGAACTTACAGCTAGATAGG - Intergenic
1105394000 13:20011181-20011203 ATACAAAATTATAGCTATATAGG - Intronic
1105682361 13:22742360-22742382 TTACAAAGCTACAACTAGAAAGG + Intergenic
1105780888 13:23704600-23704622 ATACAAAATTACAGCTAGATAGG - Intergenic
1106220060 13:27739089-27739111 ATACAAAATTACAGCTAGATAGG + Intergenic
1107918233 13:45175053-45175075 ATGCAAAATTACAGCTATATAGG - Intronic
1107944181 13:45402680-45402702 ATACTTCCCTACTACTATATAGG + Intronic
1108038672 13:46319247-46319269 ATGCAAAACTACAGCTATACAGG + Intergenic
1108824313 13:54392999-54393021 ATAAAAATATACAAGTATATAGG - Intergenic
1108974502 13:56421536-56421558 ATACAAAGTTACAGCTAGATAGG - Intergenic
1109194696 13:59365497-59365519 ATACAAAATTACAGCTAAATAGG - Intergenic
1109463746 13:62699489-62699511 ATACAAACAGAAAAATATATAGG - Intergenic
1109510715 13:63368370-63368392 ATACAAAATTACAGCTATATAGG + Intergenic
1109604286 13:64671918-64671940 ATACAAAATTACAGCTAGATAGG - Intergenic
1109991392 13:70062047-70062069 ATACAAAATTACAACTAGACAGG - Intronic
1110082539 13:71334117-71334139 ATACAAAATTACAACGAGATAGG - Intergenic
1110264951 13:73527050-73527072 ATACAAAATTACAGCTAGATAGG + Intergenic
1110769839 13:79329215-79329237 ATACACACATACAAGTAGATAGG - Intronic
1110875298 13:80502266-80502288 CTACATACCTACACATATATAGG - Intergenic
1111088721 13:83413160-83413182 ATATAACCATACAACAATATAGG - Intergenic
1111556774 13:89890982-89891004 ATACAAAATTACAGCTAGATAGG + Intergenic
1112150565 13:96756662-96756684 ATAAAAAAATACAACTATACTGG - Intronic
1113172603 13:107522369-107522391 TTAGACACCTAAAACTATATTGG - Intronic
1114123782 14:19700701-19700723 ATAAATACCTTCCACTATATTGG - Intergenic
1114140974 14:19910333-19910355 ATACAAATAAGCAACTATATTGG - Intergenic
1115364541 14:32543149-32543171 ATACAAAATTACAGCTAGATAGG - Intronic
1115947519 14:38678920-38678942 ATACAAAATTACAGCTAGATGGG - Intergenic
1116007306 14:39307980-39308002 ATACAAAATTATAACTAGATAGG + Intronic
1116148859 14:41111487-41111509 AAGCAAATTTACAACTATATAGG + Intergenic
1116473380 14:45311202-45311224 ATACAAAATTACAGCTAGATAGG - Intergenic
1117703138 14:58435579-58435601 ATACAAAATTACAGCTACATAGG - Intronic
1118394729 14:65326289-65326311 ATACAAAATTACAGCTAGATAGG + Intergenic
1118515095 14:66518871-66518893 ATACAAAATTACAGCTAGATTGG + Intronic
1118561786 14:67092927-67092949 ATAGTCACCTACATCTATATAGG - Intronic
1119979607 14:79064758-79064780 ATACACACATACATATATATGGG - Intronic
1120116475 14:80624030-80624052 AGACAAAGCTACAGCTAGATGGG - Intronic
1120799964 14:88676893-88676915 ATACAAACAAACAAATAAATAGG - Intronic
1124174439 15:27409219-27409241 ATATAAAACTATAACTATTTTGG - Intronic
1124876190 15:33596813-33596835 ATACAAAATTACAGCTAGATGGG - Intronic
1125072316 15:35570129-35570151 AAACAAACCTACACATATATAGG - Intergenic
1125896117 15:43303003-43303025 ATACAAAATTACAGCTAGATAGG + Intergenic
1126864145 15:52919404-52919426 ATACAAAATTACAGCTAGATAGG + Intergenic
1126984160 15:54283247-54283269 ATACATACCTTCAACAATATGGG + Intronic
1127155251 15:56117582-56117604 ATACAAAATTAGAACTAGATAGG - Intronic
1129623480 15:77171567-77171589 ACACAAAATTACAACTAGATGGG + Intronic
1131554063 15:93381399-93381421 ATACACAATTACAACTAAATAGG - Intergenic
1131592476 15:93764711-93764733 AAACAAACCACCAACTATTTGGG + Intergenic
1132217969 15:100081397-100081419 ATACACACATACATATATATGGG - Intronic
1132444540 15:101901462-101901484 ATAAAAACCCTCAACAATATAGG + Intergenic
1133582694 16:7161760-7161782 ATACAAACCAACATTTATAGAGG + Intronic
1133712330 16:8413270-8413292 ATACAAAGTTACAGCTAGATGGG + Intergenic
1133840999 16:9409168-9409190 AGACAAACCTAGCACTTTATAGG + Intergenic
1135304785 16:21358858-21358880 TTAAAAATTTACAACTATATAGG + Intergenic
1135838688 16:25853582-25853604 ATAAAAACTTTCAACAATATAGG - Intronic
1136301526 16:29337984-29338006 TTAAAAATTTACAACTATATAGG + Intergenic
1137385470 16:48038405-48038427 ATACAAAATTACAGCTAGATAGG + Intergenic
1137470676 16:48754265-48754287 ATACAAAATTACAGCTAGATAGG + Intergenic
1139102946 16:63790106-63790128 ATACAAAATTACAGCTAAATAGG + Intergenic
1140150728 16:72361908-72361930 ATACACACATACAAATAAATGGG + Intergenic
1140420998 16:74818704-74818726 ATACAAAATTACAGCTAGATAGG - Intergenic
1142063230 16:88044681-88044703 TTAAAAATTTACAACTATATAGG + Intronic
1142179624 16:88661884-88661906 ACACACACATACATCTATATAGG + Intronic
1144228590 17:13176002-13176024 GTACAAAGTTACAACTAGATAGG + Intergenic
1144543667 17:16171760-16171782 TTACAAACCTACAACTCTACAGG + Intronic
1146238802 17:31194424-31194446 ATTCAAAATTACAACTAGATAGG + Intronic
1146888554 17:36488919-36488941 ATACAAAATTACAGCTAGATGGG - Intronic
1148339678 17:46865920-46865942 AAACAAAAGTACAACTATAAAGG - Intronic
1148449151 17:47763314-47763336 AGACAAATCCACAATTATATTGG - Intergenic
1149149631 17:53544987-53545009 ATAAGAACCTGCAACTATGTTGG - Intergenic
1151416103 17:73966010-73966032 GTAGAAAGCTACAACTGTATTGG - Intergenic
1152194705 17:78910544-78910566 ATACAAAATTACAGCTAGATAGG - Intronic
1153558111 18:6339036-6339058 GAACAAACCCACAAATATATTGG + Intronic
1153718457 18:7875744-7875766 ATACACACATACAAATATACAGG - Intronic
1153989366 18:10382476-10382498 ATACAAACCTGCAGTTATATAGG - Intergenic
1155236834 18:23828499-23828521 ATACACACATACATGTATATAGG + Intronic
1155486706 18:26351406-26351428 ATACAAAATTACAGCTAGATAGG + Intronic
1155648712 18:28114093-28114115 ATACAAAATTACGACTATATAGG + Intronic
1156135303 18:34030601-34030623 ATACAAAATTACAGCTAGATAGG + Intronic
1156199192 18:34810581-34810603 CTACAAAATTACAACTATGTAGG + Intronic
1156733766 18:40228284-40228306 ATACAAAACTACAAAAAAATCGG - Intergenic
1156751706 18:40465632-40465654 ATAGAAAACTACAGCTAGATAGG - Intergenic
1157013837 18:43684636-43684658 ATACAAAATTACAACTAGATGGG + Intergenic
1157152816 18:45235521-45235543 ATACAAAATTACAGCTAGATAGG - Intronic
1159294504 18:66466970-66466992 ATACACACATACACATATATGGG - Intergenic
1159331893 18:67005595-67005617 ATACAAAGATACAATTAGATCGG - Intergenic
1159416519 18:68156331-68156353 ATACAAAATTACATCTAGATAGG - Intergenic
1160640814 19:133351-133373 ATAAAAACCCTCAACAATATAGG - Intergenic
1163967306 19:20758785-20758807 CTACAAACCCCCAAATATATTGG + Intronic
1164499535 19:28805562-28805584 ATACACACATACATGTATATTGG - Intergenic
1164545603 19:29159366-29159388 ATAAAAACCCACAACAAAATTGG + Intergenic
1164910153 19:32004296-32004318 ATAGAAACATACAACAATAAGGG + Intergenic
1167878922 19:52438893-52438915 ATTCAAACCTTCAACGACATAGG + Exonic
925464228 2:4091771-4091793 ATACAAAATTACAGCTAAATAGG - Intergenic
926891267 2:17640930-17640952 ATACAAAATTACAGCTAGATAGG - Intronic
927447969 2:23182274-23182296 AGACAAATCCACAATTATATTGG + Intergenic
928182268 2:29076984-29077006 ATATAAAAGTACAACTATTTTGG + Intergenic
928570478 2:32602473-32602495 ATACACAATTACAACTAGATAGG + Intronic
928783395 2:34852460-34852482 ATACAAAATTACAGCTAGATAGG - Intergenic
929356044 2:41025730-41025752 ATACAAAACTACAGCTAGATAGG + Intergenic
930630257 2:53745915-53745937 ATACAAACCTTGAATTATTTTGG + Intronic
930895670 2:56442594-56442616 ATACAGAATTACAGCTATATAGG - Intergenic
931465113 2:62479166-62479188 ATACAAAATTACAGCTAGATAGG - Intergenic
931506026 2:62927244-62927266 ATACAAAATTACAGCTAGATAGG + Intronic
932552981 2:72790981-72791003 ATACAAAATTACAGCTAGATAGG + Intronic
932849801 2:75173264-75173286 ATGGAAACCTACAACTGCATTGG - Intronic
933052205 2:77613469-77613491 AAACAAACCTACAACTAACCAGG + Intergenic
933127662 2:78630892-78630914 ATACAAAATTACAGCTAGATAGG - Intergenic
933174655 2:79161439-79161461 GTACAAACATACAGCTAGATAGG + Intergenic
933594464 2:84268737-84268759 ATACAAAATTACAGCTAGATAGG + Intergenic
934487172 2:94725923-94725945 ATACAAACTTACAGCTAGATAGG - Intergenic
934611367 2:95739413-95739435 ATAAAAACCAATAACTGTATAGG + Intergenic
935412663 2:102782003-102782025 ATTGAAACCTACTAATATATTGG + Intronic
935506117 2:103905709-103905731 AAATAAACCCACAAATATATAGG - Intergenic
936991192 2:118368096-118368118 ATATAAATCGACAACTTTATAGG + Intergenic
937233167 2:120413466-120413488 ATACAAAATTACAGCTAGATTGG + Intergenic
937403220 2:121603957-121603979 ATACAAAATTACAGCTAGATAGG + Intronic
938771025 2:134500855-134500877 ATACAAAATTACAGCTAGATAGG + Intronic
939481856 2:142758418-142758440 ATACAAAACCATAACTAGATGGG + Intergenic
939901227 2:147852221-147852243 ATACACCCCTACTACTACATGGG - Intronic
939976630 2:148724438-148724460 ATACAAAGTTACAGCTAGATAGG - Intronic
941224765 2:162834050-162834072 AAACAAACCAACAAATATGTTGG + Intronic
941484437 2:166061453-166061475 ACACAAAATTACAACTAGATAGG + Intronic
942082536 2:172414387-172414409 ATACAAAATTACAGCTAGATAGG - Intergenic
942354326 2:175092164-175092186 ATTTAAACAGACAACTATATTGG + Intronic
942766105 2:179459019-179459041 ATGCAAACTTGCAACTATAGGGG - Intronic
943347372 2:186755317-186755339 ACACAAACCTACAAGAATAAAGG - Intronic
943400250 2:187399984-187400006 ATACAAAATTACAGCTAGATAGG + Intronic
944193871 2:197031733-197031755 ATACAATACTATAATTATATTGG + Intronic
945477077 2:210296385-210296407 ATACAAAATTATAACTAGATTGG - Intronic
945547731 2:211177612-211177634 ATAGAAACCTATAAATAAATAGG + Intergenic
946096928 2:217282383-217282405 AAACAAACTTACAAAAATATTGG + Intergenic
946299029 2:218811148-218811170 AAACAAAAATACAACTTTATTGG + Intronic
947090420 2:226504055-226504077 ATACAAAATTACAGCTAGATAGG + Intergenic
947477414 2:230462835-230462857 ATATAAATCTAACACTATATAGG - Intronic
947560461 2:231145336-231145358 AAAAAATCATACAACTATATAGG + Intronic
947835919 2:233175562-233175584 ATACAAACCTAAAAATGCATGGG + Intronic
1169665866 20:8034776-8034798 ATACAAAATTACAGCTAGATAGG + Intergenic
1170046671 20:12092688-12092710 ATACAAAATTACAGCTAGATAGG + Intergenic
1170146306 20:13178815-13178837 ATACAAAATTACAGCTAGATAGG + Intergenic
1170410672 20:16087697-16087719 ATACAAAATTACAGCTAGATAGG + Intergenic
1171000525 20:21410661-21410683 ATACAAAATTACAGCTAGATAGG - Intergenic
1171047084 20:21819490-21819512 ATACAAAGTTACAGCTAGATAGG + Intergenic
1171106400 20:22437447-22437469 ATACAAAATTACAACTAACTAGG - Intergenic
1173303528 20:41826398-41826420 ATACAAAATTACAGCTAGATAGG + Intergenic
1173483521 20:43422647-43422669 ATACAAAATTACAGCTAGATAGG + Intergenic
1174168650 20:48602973-48602995 AAACAAACCTACACAAATATGGG + Intergenic
1174439912 20:50542671-50542693 AGCCACAACTACAACTATATAGG - Intronic
1176695381 21:9971465-9971487 ATCTAAACTTACAAATATATTGG - Intergenic
1176837973 21:13811811-13811833 ATACGAACTTACAGCTAGATAGG - Intergenic
1176991619 21:15504223-15504245 ATACACAGCTACAACCATTTTGG + Intergenic
1178071546 21:28973398-28973420 ACACAAAGCAACAAATATATAGG + Intronic
1180754463 22:18151072-18151094 ATACATTCATACAAATATATCGG + Intronic
1181912375 22:26249271-26249293 ATACAAACTTACAGCTAGATCGG - Intronic
1184075808 22:42176886-42176908 ATACAAAATTACATCTAGATGGG + Intronic
1184968266 22:47996907-47996929 AGACAAAACTATAACTAAATAGG - Intergenic
950822413 3:15775276-15775298 ATAACAACATACAACTATGTAGG + Intronic
951516993 3:23571157-23571179 ATACAAACTTATAATTAAATAGG - Intronic
951638527 3:24807468-24807490 ATACAAAATTACAACTAGGTAGG + Intergenic
952329530 3:32351322-32351344 ATACAAAACTACAAAAATACAGG + Intronic
955127819 3:56131727-56131749 ATACAAAATTACAGCTAGATAGG + Intronic
955446487 3:59016418-59016440 ATACAAAACTACAGCTAGATAGG + Intronic
955800907 3:62685574-62685596 ATACAAAATTACAGCTAGATAGG + Intronic
956081366 3:65560092-65560114 ATACAAAACTCCATATATATAGG + Intronic
956496673 3:69834265-69834287 ATACAAAGTTACAATTAGATAGG - Intronic
957166399 3:76679483-76679505 ATATAAATATAAAACTATATAGG + Intronic
957423183 3:79999639-79999661 ATTCAAAACTACAGCTACATTGG + Intergenic
957464727 3:80572723-80572745 TTACAAATGTACCACTATATAGG - Intergenic
958189172 3:90162537-90162559 ATACAAAATTACAGCTAGATAGG + Intergenic
958411483 3:93822169-93822191 ATACAAAATTACAGCTAGATAGG + Intergenic
958812880 3:98882080-98882102 ATACAAAGTTACAGCTAGATAGG - Intronic
959218788 3:103487679-103487701 ATACAAAATTACAGCTAGATAGG - Intergenic
959255731 3:104010787-104010809 ATAAAAACCTACAATTATAGTGG - Intergenic
959369769 3:105508831-105508853 CTACAAAGTTACAACTGTATAGG - Intronic
960261227 3:115570796-115570818 ATACAAAATTACAGCTAAATAGG + Intergenic
960607525 3:119522451-119522473 ATACAAAATTATAACTAGATCGG + Intronic
960865850 3:122199772-122199794 ATACAAAATTACAACTAGATAGG + Intronic
961963284 3:130875229-130875251 ATACAAAATTACAGCTAGATAGG - Intronic
962495400 3:135934815-135934837 ATACAAAAGTACAGCTAGATAGG - Intergenic
963401029 3:144799805-144799827 ATACACACATACATATATATTGG - Intergenic
963535861 3:146527221-146527243 ATACAAAATTACAGCTAGATAGG + Intronic
963731530 3:148978731-148978753 ACACAAACATTCAACTATAGAGG - Intergenic
965421182 3:168460590-168460612 ATACAAAATTTCAATTATATAGG + Intergenic
965844175 3:172942570-172942592 TGACAAACCTACCACTATTTTGG + Intronic
966986566 3:185185722-185185744 ATACAAAATTACACCTAGATTGG - Intergenic
967150458 3:186644217-186644239 ATACAAAATTACAGCTAGATAGG - Intronic
967538746 3:190640009-190640031 ATACAAAGCTACACATATTTGGG - Intronic
967834854 3:193952641-193952663 ATACAAAATTACAGCTAGATAGG - Intergenic
970173808 4:13316162-13316184 ATACAAAATTACAGCTAAATAGG - Intergenic
970488898 4:16552100-16552122 ATACAAACCAACAAGGATAAAGG - Intronic
970637731 4:18027232-18027254 TTACAATCCTACTAGTATATTGG - Intergenic
970905338 4:21209353-21209375 ATACAAAATTACAGCTAGATAGG - Intronic
971745011 4:30567770-30567792 ATACAAAGTTACAACTAGATAGG + Intergenic
972049603 4:34712577-34712599 ATACAAAATGACAACTAGATAGG + Intergenic
972090950 4:35283081-35283103 ATAAAAAACTACATCTAGATAGG - Intergenic
972858499 4:43137548-43137570 AAACAAAGCTATAACTACATGGG - Intergenic
972955472 4:44384669-44384691 ATGCATAACTACAACTAGATAGG + Intronic
973114156 4:46434404-46434426 ATACAAAGCTACAGATATATAGG - Intronic
973217203 4:47682493-47682515 ATACAAAATTACAGCTAGATAGG + Intronic
974493703 4:62600326-62600348 ATAAAAAAATACAACTCTATTGG - Intergenic
974768127 4:66374992-66375014 GCACATACCTACAACTATATTGG - Intergenic
975806609 4:78119286-78119308 ATACAAAATTACAGCTAGATGGG - Intronic
976120574 4:81776285-81776307 ATACAAAACTACAGCCAGATAGG + Intronic
976127018 4:81844333-81844355 ATAGCAACATACAATTATATTGG - Intronic
976298643 4:83496979-83497001 ATACAAAATTACAGCTAGATAGG - Intronic
977068535 4:92351608-92351630 CTACAAACTTACAGCTAAATAGG - Intronic
977360022 4:95991070-95991092 ATACATCCCTACAACTCAATAGG - Intergenic
977547446 4:98400612-98400634 ATACAAAATTACAGCTAGATAGG + Intronic
977643190 4:99380503-99380525 ATACAAAATTACAGCTAGATAGG + Intergenic
978464150 4:108989631-108989653 ATACAAACCTTAAAGTGTATAGG + Intronic
978878219 4:113667863-113667885 GTAAGATCCTACAACTATATAGG + Intronic
978911946 4:114074326-114074348 ATAAAAACCTTCAACAATCTAGG + Intergenic
978915156 4:114116487-114116509 ATACAAAATTACAGCTAGATAGG + Intergenic
979143453 4:117208726-117208748 ATACAAAATTACCACTAGATAGG + Intergenic
979830210 4:125290574-125290596 TTAAAAACCTTCAACCATATAGG - Intergenic
979922124 4:126511433-126511455 GCACAAAATTACAACTATATAGG - Intergenic
980235808 4:130104916-130104938 ATACAAAACTATAGCTAGATAGG - Intergenic
980348703 4:131660579-131660601 ATACAAAATTATAGCTATATAGG + Intergenic
980864394 4:138537413-138537435 ATACAAAGTTACAGCTATATGGG + Intergenic
980882872 4:138731254-138731276 ATACAAAATTACAGCTAGATGGG + Intergenic
981520731 4:145659915-145659937 GTACAAAGTTACAACTAGATAGG - Exonic
981622305 4:146715653-146715675 ATACAAAATTACAGCTAAATAGG + Intronic
981643456 4:146972030-146972052 ATACAAAATTACAGCTAGATAGG - Intergenic
981710279 4:147702038-147702060 GTACAAAGCTACAATTAGATTGG + Intergenic
982737118 4:159018346-159018368 AGACAAACCCAAAACTATGTAGG + Intronic
983193566 4:164780732-164780754 AGACAAACCTAAAACCATAATGG + Intergenic
983396724 4:167206873-167206895 ATACAAAGTTACAACTAGATAGG + Intronic
983541211 4:168912818-168912840 ATACAAAATTACAGCTACATAGG - Intronic
984020618 4:174480497-174480519 ATAAAAACCTTCAACAATCTAGG + Intergenic
984541829 4:181048162-181048184 ATACAAAATTACAGCTAGATAGG - Intergenic
985052376 4:186004705-186004727 ATACAAAGTTACAGCTAGATAGG - Intergenic
985290598 4:188382743-188382765 ATACAAAATTACAACTGGATAGG - Intergenic
986051623 5:4095245-4095267 ATACACACATACACATATATAGG - Intergenic
986621880 5:9684436-9684458 ATACAAAATTACAGCTACATAGG + Intronic
986969787 5:13319113-13319135 ATACAAAATTACAGCTAAATAGG - Intergenic
987009270 5:13744376-13744398 ATACAAAATTACAGCTAGATAGG + Intronic
987490317 5:18572067-18572089 ATACAAAATTACATCTAGATTGG + Intergenic
987607204 5:20152793-20152815 TTGGAAACCTACAACTGTATAGG - Intronic
987760257 5:22152724-22152746 ATACAAAATTTCAATTATATAGG - Intronic
988219227 5:28319844-28319866 ATGCTAACCTACAATTATATAGG + Intergenic
988227985 5:28438270-28438292 ATACAAAGCTACAATTAAAAAGG + Intergenic
988243972 5:28653323-28653345 ATACAAAATTACAGCTAAATAGG - Intergenic
988300030 5:29411328-29411350 ATACAAAGTTACAATTAAATAGG + Intergenic
988333027 5:29867468-29867490 ATACAAATCTACAAACATTTGGG + Intergenic
988371593 5:30376543-30376565 ATACAAACCTACAGTTTTAGTGG + Intergenic
989249735 5:39297038-39297060 ATACAACATTACAACTACATAGG + Intronic
990691468 5:58369030-58369052 ATATAAAATTACAGCTATATAGG - Intergenic
991425912 5:66491686-66491708 ATAAGAACCTAGAACTATAAGGG + Intergenic
991895000 5:71386162-71386184 ATACAAAATTTCAATTATATAGG - Intergenic
992088337 5:73297725-73297747 AAAAAAACCTTCAACTATCTGGG - Intergenic
992266536 5:75024146-75024168 CTACAAATCTACACCTAAATTGG - Intergenic
993089262 5:83403861-83403883 ATAAATACCTACATGTATATGGG + Intergenic
993514787 5:88817845-88817867 ATACAAACATACAAGTAAATAGG + Intronic
993517122 5:88851376-88851398 ATACAAATCTTCAACTGCATGGG + Intronic
994357386 5:98809229-98809251 ATACAAAATTACACCTAGATAGG + Intergenic
994479689 5:100318064-100318086 ATACAAAATTACAGCTAGATAGG + Intergenic
994491609 5:100452761-100452783 ATACAAAATTACAACTAGACAGG + Intergenic
994937651 5:106276038-106276060 ATATAAATCTACAATTTTATAGG + Intergenic
995596054 5:113749147-113749169 ATACATACCTACAAATACATAGG - Intergenic
995671302 5:114606599-114606621 ATACAAAATTACAGCTAGATGGG - Intergenic
995849398 5:116529281-116529303 ATACAAAAGTACAGCTAGATAGG + Intronic
996038386 5:118783546-118783568 ATATAAACCCACAAATAAATGGG - Intergenic
996658621 5:125971633-125971655 AAGCAAACCTACAACTTTAATGG + Intergenic
997133574 5:131301225-131301247 ACACAAAATTACAACTAGATAGG + Intronic
997637264 5:135421959-135421981 AGACAAATCTACAATTAAATGGG - Intergenic
998181159 5:139944356-139944378 ATACAAAATTACAGCTAGATAGG - Intronic
998198735 5:140100105-140100127 ATACAAAATTACAGCTAGATAGG - Intergenic
998550496 5:143072809-143072831 ATACAAAATTACAGCTAGATAGG + Intronic
999420945 5:151442589-151442611 ATACAAAATTACAGCTAGATAGG - Intronic
999863345 5:155673333-155673355 ATACAAAATTACAGCTAAATAGG - Intergenic
1000540536 5:162533701-162533723 ATACAAAATTACAGCTAGATAGG - Intergenic
1001439793 5:171733823-171733845 ATGCAAACATCCAAGTATATCGG + Intergenic
1001971620 5:175959861-175959883 ATACCAACTTACAAATATTTAGG + Exonic
1002245822 5:177883916-177883938 ATACCAACTTACAAATATTTAGG - Intergenic
1002678887 5:180944211-180944233 ATACAAAGTTACAATTAGATAGG + Intronic
1002736536 5:181393070-181393092 ATAAAAACCCTCAACAATATAGG + Intergenic
1002748161 6:81754-81776 ATAAAAACCCTCAACAATATAGG - Intergenic
1002954256 6:1846450-1846472 AAACAAAACTACTACAATATTGG + Intronic
1003612520 6:7626578-7626600 ATACAACTCTACAACTATAGAGG + Intergenic
1004438288 6:15619109-15619131 ATACAAAATTACAGCTAGATAGG + Intronic
1004676536 6:17848354-17848376 ATACAAAATTACAGCTAAATTGG - Intronic
1005919389 6:30386122-30386144 ATAAAAACCTTCAACAAAATAGG + Intergenic
1006958392 6:37899548-37899570 ATACAAATATACATCTAAATTGG - Intronic
1008293203 6:49743922-49743944 ATTAAAACATACAGCTATATGGG - Intronic
1008937652 6:57009172-57009194 ATACAAAATTACAGCTAGATGGG + Intronic
1009429445 6:63549851-63549873 ATACAAAATTGCAACTACATAGG + Intronic
1009434128 6:63598912-63598934 ATTCTAACCTAGAACCATATAGG + Intergenic
1010290968 6:74137034-74137056 ATATAAAATTACAGCTATATAGG + Intergenic
1010346933 6:74822228-74822250 ATACAAAATTACAGCTAGATAGG + Intergenic
1011118947 6:83928508-83928530 AAACAAAACAAAAACTATATGGG + Intronic
1011483065 6:87814400-87814422 AGACAAACCTACAAGGAAATGGG + Intergenic
1012006504 6:93719372-93719394 ATACAAACCTACAATACTATAGG + Intergenic
1012688962 6:102290397-102290419 GTACAAAGCTACAATTAGATAGG - Intergenic
1012837148 6:104283354-104283376 ATACAAAATTACAACTAGATAGG + Intergenic
1013058469 6:106608373-106608395 ATACAAAATTACAGCTAGATAGG + Intronic
1013149731 6:107432876-107432898 ATACAAAGTTACAACTAGATGGG - Intronic
1013651162 6:112196274-112196296 ACACAAACTTACAGCTAGATGGG - Intronic
1013670324 6:112395141-112395163 ATACAAAATTACAACTAAATAGG - Intergenic
1014299531 6:119664567-119664589 ACACAAAGCAACAACTATAAGGG - Intergenic
1014361458 6:120481003-120481025 TTACAATCCTACAAATAGATAGG - Intergenic
1015285452 6:131481547-131481569 ATACAAAATTACAACTAGTTAGG - Intergenic
1015549584 6:134398203-134398225 ATACAAAGTTACAGCTAGATAGG + Intergenic
1015963999 6:138679923-138679945 ATCCAAACATATAAATATATTGG + Intronic
1016294262 6:142557522-142557544 ATACAAAATTACAGCTAGATAGG + Intergenic
1016368822 6:143349482-143349504 ATACAAAATTACAGCTAGATAGG - Intergenic
1016695555 6:146990651-146990673 ATAGAAACATACAAATATCTGGG - Intergenic
1016975058 6:149799485-149799507 TTGCAAACCTAAAACTATCTTGG - Intronic
1017118754 6:151003931-151003953 ATAAAACCCTACAGCTATGTGGG - Intronic
1017427378 6:154336567-154336589 ATACAAACATACAGTTAGATAGG + Intronic
1019241634 6:170668599-170668621 ATAAAAACCCTCAACAATATAGG + Intergenic
1019748548 7:2714289-2714311 ATACAAAACTAAAACTAGAAGGG + Exonic
1020787084 7:12586966-12586988 ATACAAAATTACAGCAATATAGG + Intronic
1021063925 7:16148676-16148698 ATAGAAAATTACAACTAGATGGG + Intronic
1021980546 7:26050558-26050580 ATACAAAATTACAGCTAGATAGG - Intergenic
1022895350 7:34745108-34745130 ATACAAAGGGACAACTATATTGG + Intronic
1023374559 7:39543051-39543073 ATACAGACCTAGAATTACATAGG + Intergenic
1024333020 7:48175787-48175809 ATACAAAATTACAGCTAGATAGG - Intronic
1024789477 7:52948069-52948091 ATAAAAACAAATAACTATATTGG + Intergenic
1025136383 7:56417423-56417445 ATACAAAATTACAGCTACATAGG + Intergenic
1026369852 7:69688731-69688753 ATACAAAACTACAGCTAAATAGG - Intronic
1028002073 7:85511324-85511346 AGACAAATCTACTACTATAATGG - Intergenic
1028157407 7:87447276-87447298 ACTTAAACCTCCAACTATATAGG - Intronic
1028227920 7:88271150-88271172 ATACAAAATTACAGCTAGATAGG - Intergenic
1030074694 7:105726259-105726281 ATCCAAACTTCCAACTATGTAGG + Intronic
1030647092 7:112073798-112073820 ATACAAAATTATAACTAGATAGG + Intronic
1031265948 7:119580431-119580453 ATACAAAATTACAGCTAGATAGG + Intergenic
1031302224 7:120075449-120075471 ATACAAAAGTACAGCTAGATAGG + Intergenic
1031457833 7:122006344-122006366 ATACAAAATTACAGCTAGATAGG - Intronic
1031604424 7:123750691-123750713 ATACACAATTACAACTAGATAGG + Intergenic
1031632346 7:124059486-124059508 ATACAAACAAACACCTAAATGGG + Intergenic
1031790575 7:126097192-126097214 ACACAAATCTACAATTACATTGG - Intergenic
1031795051 7:126162642-126162664 ATACAAAATTACAGCTATGTAGG + Intergenic
1032930803 7:136667615-136667637 ATACAAAATTACAGCTAGATAGG - Intergenic
1033387767 7:140895527-140895549 ATACAAAATTACAGCTAGATAGG - Intronic
1033789937 7:144779331-144779353 ATACACACACACAATTATATAGG - Intronic
1034757369 7:153635395-153635417 ATACAAAATTACAGCTAGATAGG - Intergenic
1035506482 8:139497-139519 ATAAAAACCCTCAACAATATAGG - Intergenic
1037096785 8:14995425-14995447 ATAGAAACCTGCAACCATCTGGG - Intronic
1037110038 8:15154862-15154884 ATACAAAATTACAGCTAGATAGG + Intronic
1037848920 8:22309770-22309792 ATAAAAACCTACATTTATATAGG - Intronic
1038352517 8:26790495-26790517 ATACAAAATTACAGCTAGATAGG + Intronic
1038938247 8:32276145-32276167 ATACAAAGTTACAGCTAGATAGG - Intronic
1039380931 8:37084643-37084665 ATAGACACCTACAACTAAAGAGG + Intergenic
1039457709 8:37718500-37718522 ATACAAAGTTACAGCTACATAGG + Intergenic
1041078779 8:54194406-54194428 ATACAAAAGTACAGCTATATAGG - Intergenic
1041529681 8:58850978-58851000 ACACAAATAAACAACTATATTGG + Intronic
1042783703 8:72522841-72522863 ATACAAAATTACACCTAGATGGG + Intergenic
1043035846 8:75197629-75197651 ATGAAAACATACAGCTATATAGG + Intergenic
1043218698 8:77630006-77630028 ACAAAAACCTATAACTGTATTGG - Intergenic
1043709267 8:83394444-83394466 ATACAAAATTACAGCTAGATAGG + Intergenic
1044149509 8:88757675-88757697 ATACAAAATTACAGCTACATAGG - Intergenic
1044169592 8:89032921-89032943 GAACAAACTTAAAACTATATTGG - Intergenic
1044191899 8:89329240-89329262 ATACAAAATTACAGCTAGATAGG + Intergenic
1044218690 8:89644348-89644370 ATACAAAACTACAGCTAGATAGG + Intergenic
1044219927 8:89658350-89658372 ATACAAAATTACATCTAGATAGG + Intergenic
1044553003 8:93532914-93532936 ATAAAAAAATACAACTGTATGGG - Intergenic
1044676986 8:94739111-94739133 ATACAAAATTACAGCTAGATAGG - Intronic
1045646950 8:104308515-104308537 AAACCTACCTACAACTATCTTGG + Intergenic
1045682149 8:104673596-104673618 GTACAAATCTATAACTATGTTGG + Intronic
1045717743 8:105068061-105068083 ATACAAAATTACAGCTAGATAGG - Intronic
1046283911 8:112071057-112071079 ATACAAAGTTACAGCTAAATTGG + Intergenic
1047036372 8:120943450-120943472 ATACAAAATTACAGCTAGATAGG - Intergenic
1047556788 8:125940693-125940715 ATCCACACTCACAACTATATTGG - Intergenic
1050285247 9:4095131-4095153 ATACAAAATTACAGCTAGATAGG - Intronic
1052162302 9:25279972-25279994 ATAAAAAGCTACAACTACCTTGG + Intergenic
1053183989 9:35999351-35999373 ATATATACCTATAAGTATATAGG + Intergenic
1053632362 9:39957417-39957439 ATCTAAACTTACAAATATATTGG - Intergenic
1053670629 9:40358428-40358450 ATACAAACTTACAGCTAGATAGG + Intergenic
1053773398 9:41506114-41506136 ATCTAAACTTACAAATATATTGG + Intergenic
1053920418 9:42984773-42984795 ATACAAACTTACAGCTAGATAGG + Intergenic
1054211526 9:62293280-62293302 ATCTAAACTTACAAATATATTGG + Intergenic
1054313458 9:63555566-63555588 ATCTAAACTTACAAATATATTGG - Intergenic
1054381750 9:64498491-64498513 ATACAAACTTACAGCTAGATAGG + Intergenic
1054513984 9:66017872-66017894 ATACAAACTTACAGCTAGATAGG - Intergenic
1055345628 9:75334405-75334427 ATACAAAACAACAGCTAGATAGG + Intergenic
1055405007 9:75965238-75965260 ATACACACATACACATATATAGG - Intronic
1055682453 9:78730768-78730790 ATACAAAATTATAGCTATATGGG + Intergenic
1055844779 9:80548344-80548366 ATACAAACCCTAAAATATATAGG + Intergenic
1056241273 9:84649112-84649134 ATACAAAATTACAACTAGATAGG - Intergenic
1056904064 9:90629562-90629584 ATACAAAGGAACAACTGTATTGG - Intronic
1057103069 9:92382457-92382479 ATACAAAATTACAGCTAGATAGG - Intronic
1057538913 9:95946188-95946210 AGACAAATCCACAACTATAATGG + Intronic
1057628066 9:96695470-96695492 ATACAAAAGTACAGCTAGATAGG + Intergenic
1057876577 9:98759870-98759892 ATACAAAACTATAGCTAGATAGG + Intronic
1058098436 9:100890059-100890081 ATACAAACTTTCAACTAGTTAGG - Intergenic
1058613811 9:106804201-106804223 ATACAAAACTACGGCTAAATAGG + Intergenic
1059209420 9:112498846-112498868 ATACAAAATTACAGCTAGATAGG - Intronic
1059608753 9:115868796-115868818 ATACAAAATTACAGCTAGATAGG + Intergenic
1059787658 9:117603668-117603690 ATACAAAAGTACAGCTAGATAGG + Intergenic
1060097925 9:120810200-120810222 ATACAAAATTACAACGAGATAGG - Intergenic
1060227778 9:121805861-121805883 ATACAAAATTACAGCTAGATAGG + Intergenic
1060329340 9:122651419-122651441 ATGCAAAATTACAGCTATATAGG - Intergenic
1203601826 Un_KI270748v1:17833-17855 ATAAAAACCCTCAACAATATAGG + Intergenic
1185895382 X:3853930-3853952 AGAAAAAGCTACAACTATCTAGG - Intergenic
1185900499 X:3892354-3892376 AGAAAAAGCTACAACTATCTAGG - Intergenic
1185905615 X:3930785-3930807 AGAAAAAGCTACAACTATCTAGG - Intergenic
1185937232 X:4271598-4271620 ATACAAAACTACATCCAGATAGG + Intergenic
1186032178 X:5380192-5380214 ATACAAACTTACAGCTAGATAGG + Intergenic
1186054917 X:5640070-5640092 ATGCAAAATTACAACTACATAGG - Intergenic
1186649933 X:11548358-11548380 ATACAAACTTACATCTAGATAGG - Intronic
1187214311 X:17261373-17261395 ACACAAAATTACAACTATATAGG + Intergenic
1188121468 X:26313809-26313831 GTACAAAGCTACAATTAAATAGG - Intergenic
1188253051 X:27923325-27923347 ATTCAAACCCACAACTAAAAAGG - Intergenic
1188469593 X:30523165-30523187 ATACAAAATTATAGCTATATAGG - Intergenic
1188503900 X:30860167-30860189 ATACATACCTACAAAAATAGGGG + Intronic
1189053832 X:37677285-37677307 AAGCAAACCTACAAGTATGTTGG + Exonic
1189384882 X:40529139-40529161 ATACAAAATTACAGCTAAATAGG + Intergenic
1189411581 X:40777433-40777455 ATTCACACTTACAACTATTTTGG + Intergenic
1189781904 X:44522702-44522724 ATTCCAACCTAGAACTCTATGGG + Intergenic
1189814694 X:44812875-44812897 ATACAAAATTACAGCTAGATAGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1189876596 X:45442561-45442583 GTACAAAGCTACAATTATATAGG - Intergenic
1190133801 X:47775500-47775522 ATACAAACATACAGTTAGATAGG + Intergenic
1190515518 X:51220154-51220176 ATACAAACCTTAAATTATGTAGG - Intergenic
1191196125 X:57725350-57725372 ACACAAAGCTGCAAATATATGGG - Intergenic
1191647786 X:63501988-63502010 ATACAAAATTTCAACTAGATAGG + Intergenic
1191767801 X:64719207-64719229 ATACAAAATTACAGCTAGATAGG + Intergenic
1192291703 X:69803760-69803782 ATACAAAATTACAACTAGATAGG - Intronic
1192319056 X:70074490-70074512 ATACAAAAATTCAGCTATATAGG - Intergenic
1192361295 X:70441914-70441936 TTACAAACATACAAAAATATTGG - Intergenic
1193302970 X:79914642-79914664 ATACAAAACTACAGTTAGATAGG - Intergenic
1193304824 X:79936177-79936199 ATACAAAGCTACAGTTAGATAGG - Intergenic
1193436910 X:81485202-81485224 ATACAAAATTACAGCTAGATGGG + Intergenic
1193664121 X:84295262-84295284 ATACAAAATTACAGTTATATAGG - Intergenic
1193847049 X:86485412-86485434 GTACAAACCTACAGTTAGATAGG + Intronic
1194239411 X:91425522-91425544 ATACTAATCTACTATTATATTGG - Intergenic
1194252653 X:91596779-91596801 ATAAAAACTTACAACAGTATTGG + Intergenic
1194328377 X:92550047-92550069 ATACAAAATTACAACTAGATAGG - Intronic
1194511155 X:94796456-94796478 ATACAAAATTACAACTGGATAGG - Intergenic
1195203261 X:102570018-102570040 ATACAAAATTACAGCTACATAGG + Intergenic
1195407049 X:104526092-104526114 ATATAAACCTTCAACTTTAGAGG + Intergenic
1195501559 X:105606936-105606958 ATACAAACCTACAACTATATAGG + Intronic
1195745209 X:108110549-108110571 ATACAAAATTACAGCTAAATAGG - Intronic
1197133629 X:123035047-123035069 ATACACAACTACAGCTAGATAGG + Intergenic
1197414597 X:126159552-126159574 AGATAAACCAACAAGTATATAGG - Intergenic
1197653440 X:129089941-129089963 AGACAAAACTACAGCTAGATAGG + Intergenic
1198121915 X:133602293-133602315 ATACAAAATTACAGCTAGATAGG + Intronic
1199105543 X:143862205-143862227 ACACAAAATTACAACTATAAAGG + Intergenic
1199687624 X:150278761-150278783 ATACAAAATTACAGCTAGATAGG - Intergenic
1199756350 X:150868596-150868618 ATACAAAATTACAGCTAGATAGG - Intronic
1200571586 Y:4838036-4838058 ATAAAAACTTACAACAGTATTGG + Intergenic
1200637084 Y:5669270-5669292 ATACAAAATTACAACTAGATAGG - Intronic
1201894942 Y:18983169-18983191 AGAAAAAGATACAACTATATAGG + Intergenic