ID: 1195502124

View in Genome Browser
Species Human (GRCh38)
Location X:105613636-105613658
Sequence TTTAATGAGCTTGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195502124_1195502132 5 Left 1195502124 X:105613636-105613658 CCATCCACCACAAGCTCATTAAA 0: 1
1: 0
2: 0
3: 8
4: 192
Right 1195502132 X:105613664-105613686 CTCGGGCCTTAAGGGAACATTGG 0: 1
1: 43
2: 120
3: 330
4: 586
1195502124_1195502129 -4 Left 1195502124 X:105613636-105613658 CCATCCACCACAAGCTCATTAAA 0: 1
1: 0
2: 0
3: 8
4: 192
Right 1195502129 X:105613655-105613677 TAAAGAGTCCTCGGGCCTTAAGG 0: 1
1: 0
2: 17
3: 137
4: 218
1195502124_1195502130 -3 Left 1195502124 X:105613636-105613658 CCATCCACCACAAGCTCATTAAA 0: 1
1: 0
2: 0
3: 8
4: 192
Right 1195502130 X:105613656-105613678 AAAGAGTCCTCGGGCCTTAAGGG 0: 1
1: 1
2: 17
3: 132
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195502124 Original CRISPR TTTAATGAGCTTGTGGTGGA TGG (reversed) Intronic
903847306 1:26285956-26285978 CTTAGTGAGCTGGTGGTAGAGGG - Exonic
904129957 1:28268230-28268252 GTTAATGAGGTGGTGGTGGTGGG + Intronic
904266304 1:29320234-29320256 TTTGATGAGGTGGTGGGGGAGGG + Intronic
907356060 1:53874810-53874832 TTTAAAAAGCATGTTGTGGAAGG - Intronic
908790412 1:67775535-67775557 TCTGATGAGCTGCTGGTGGATGG + Intronic
913656134 1:120961882-120961904 GTTAATGAGTCTGTGGTGGTTGG - Intergenic
913986622 1:143571444-143571466 CTGAATGAGCTTTTGGTAGAGGG + Intergenic
914205023 1:145519231-145519253 CTGAATGAGCTTTTGGTAGAGGG + Intergenic
914370551 1:147020997-147021019 CTGAATGAGCTTTTGGTAGAGGG - Intergenic
914484144 1:148092413-148092435 CTGAATGAGCTTTTGGTAGAGGG + Intergenic
916277290 1:163008514-163008536 ATTCCTGAGCTTATGGTGGAAGG + Intergenic
917203098 1:172538150-172538172 TTTAATTAGATTGCTGTGGAGGG + Intronic
919729030 1:200901193-200901215 TTAAATGAGCTTTTGAGGGATGG + Intronic
920272999 1:204781000-204781022 ATAAATGACCTTATGGTGGATGG - Intergenic
920884489 1:209913657-209913679 TTTTATGAGCTTGTGGTAAGTGG - Intergenic
921194634 1:212743494-212743516 GTTAATGAACATGTGGAGGAAGG - Intronic
921386244 1:214572663-214572685 TTTAAAGATCTTATGGTGAAAGG - Intergenic
924437622 1:244056673-244056695 TTTCATGAGTTGGGGGTGGAGGG - Exonic
924748180 1:246858518-246858540 TTTATTGTGTTTGTGGTGGGTGG - Intronic
1064523764 10:16231365-16231387 TTTAAGGAGCTTATGGCAGAAGG + Intergenic
1067114714 10:43426315-43426337 TTTAAAGAGATTGAGGGGGAGGG - Intergenic
1067916203 10:50401635-50401657 TTTCAGGAGCTTTTGGTGGGGGG - Intronic
1068326563 10:55496228-55496250 TTTCATGATCTTCTGGTTGATGG - Intronic
1070628142 10:78065889-78065911 TTTAATCTGCGTGTGGTGGCAGG + Intergenic
1071896541 10:90074283-90074305 TTTAAAGTGCTGGGGGTGGAGGG - Intergenic
1072578186 10:96719197-96719219 TTTAATGAGCCTGTAGTACATGG + Intronic
1074955858 10:118388547-118388569 TTTAATAAGCTTGTGAGGGTGGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1081657977 11:44869841-44869863 TTTAATGAGGTTGGGGTGGGTGG + Intronic
1083208929 11:61170617-61170639 CTTAAAGAGCTTGTGTTGGGGGG - Intergenic
1084000513 11:66293131-66293153 TGTGATGAGCATGTGTTGGAGGG + Intronic
1088009445 11:104981725-104981747 CTTAATAAGCTTGTTTTGGAAGG + Intergenic
1090515646 11:127423699-127423721 TTCAGTCAGCTTGTGGTGAATGG + Intergenic
1090613456 11:128492965-128492987 GTTAATGAATTTGTGTTGGATGG - Intronic
1092085863 12:5759296-5759318 TTAATTAAGCTTGTGGGGGAAGG + Intronic
1092477056 12:8828446-8828468 TTTCACCAGCTTGTGGTGAATGG + Intronic
1092807572 12:12239364-12239386 TTTAAAGAGCTGATGGAGGAAGG + Intronic
1094079851 12:26521865-26521887 TTTAATGAGTTAGTGATGTAGGG - Intronic
1094160282 12:27382861-27382883 TACAATGAACTAGTGGTGGATGG - Intronic
1095601011 12:44013340-44013362 TTTAATGAGCTTGTGGCCCTGGG + Intronic
1095924066 12:47561022-47561044 TTTCATGAGATTTTGGAGGAGGG + Intergenic
1096597848 12:52708261-52708283 CTAACTGAGCTTTTGGTGGAGGG + Intergenic
1098072957 12:66695668-66695690 TTTAAGGAGCTTCTTGGGGAGGG + Intronic
1098943752 12:76567242-76567264 TTGAATGATCTCGTGGTTGAGGG - Intergenic
1099572831 12:84347077-84347099 TTAAATGTGTTTGTGGTGGCAGG + Intergenic
1102452224 12:113050355-113050377 TTTAATCAGCTTGTCAGGGAAGG - Intergenic
1102565980 12:113797728-113797750 GTTAATGAGCATCTGGGGGAGGG + Intergenic
1104066339 12:125310236-125310258 TTTGCACAGCTTGTGGTGGATGG - Intronic
1104156803 12:126141316-126141338 TTTAATGGGCCTCTGGTAGACGG + Intergenic
1106380749 13:29236506-29236528 TTGAAATAGCTTGTGGTGAAAGG + Intronic
1106880291 13:34121847-34121869 GATAATAAGCTGGTGGTGGATGG + Intergenic
1108467931 13:50737042-50737064 TTTAATGAGTTTGTGGGGTGGGG + Intronic
1109939408 13:69341469-69341491 TGTAATGTGCTGCTGGTGGATGG + Intergenic
1111485564 13:88895154-88895176 TTTTATGTGATTGTGGTAGATGG - Intergenic
1111602929 13:90496253-90496275 TATAATGTGCTTTCGGTGGAGGG - Intergenic
1113225428 13:108154118-108154140 TTAAATGAGCTTCAGGAGGAAGG - Intergenic
1113774682 13:112936461-112936483 GTTAATGAGCTTTGGGTGAAAGG + Intronic
1115037470 14:28876187-28876209 TTTAATGAGCTTCTGGAGTGTGG + Intergenic
1116186192 14:41604338-41604360 TCTAATCAGCTTGTGTAGGAGGG + Intergenic
1116484920 14:45436307-45436329 TTTAATGAGCTGGGGAAGGAAGG - Intergenic
1119003651 14:70905626-70905648 TGTAATGAGGGTGAGGTGGATGG - Intergenic
1121930972 14:97971895-97971917 TTCAATGGGTTTGTGGTGGAGGG + Intronic
1122283770 14:100639076-100639098 TGGAATGACCTTGTGGTGAAGGG - Intergenic
1122470523 14:101963094-101963116 TTTAAGGAGCATGTGGAAGAGGG - Intergenic
1129363250 15:75037805-75037827 TCTTTTGAGCTTGTGGTGGTAGG + Intronic
1133594868 16:7281317-7281339 TTTAATGAGCTTCTGCTTGGGGG + Intronic
1133782119 16:8947703-8947725 CTTAAAGAGCTTTTGGTGGGTGG - Intronic
1136085642 16:27882956-27882978 TTTAATTAGCTGGTCGTGGTCGG + Intronic
1137385151 16:48034788-48034810 TTTAATCAGTTTATGGGGGAAGG + Intergenic
1138792489 16:59922689-59922711 TTTATTGTGGTTGTGGTGGTTGG + Intergenic
1139168275 16:64597622-64597644 TAAAATGAGCTTGTCCTGGAAGG - Intergenic
1143315757 17:6032221-6032243 TTTCATGAGCTGGTCATGGAAGG - Intronic
1143348239 17:6266269-6266291 TGAAATGAGCTGTTGGTGGAAGG + Intergenic
1151418951 17:73985003-73985025 TTTAATAAACGTGAGGTGGATGG - Intergenic
1159391353 18:67796446-67796468 TTTGAAGAGCTTGTTGTGAAAGG + Intergenic
1159792709 18:72803225-72803247 TTAAATGAGATTGTTGTTGATGG + Intronic
1161645896 19:5453237-5453259 TTTACTGAGGATATGGTGGATGG + Intergenic
1166966094 19:46530121-46530143 TCTAAGGAGCTGGGGGTGGAAGG - Intronic
1168634153 19:57982324-57982346 TTTTATAAGATTGTGGTGGGAGG - Intronic
926003672 2:9354392-9354414 TTTAAAGAGAGTGTAGTGGAGGG + Intronic
926283726 2:11471014-11471036 TTTAATGAGCTTGCAGGTGATGG - Intergenic
928252129 2:29690277-29690299 TTTGTTGTGCTTTTGGTGGAGGG - Intronic
928275017 2:29892823-29892845 TTAAGTAAGCTTGTGGTAGAGGG + Intronic
933878288 2:86642331-86642353 TATAATGAGGGTGTGGTGGCAGG - Intronic
935934918 2:108171228-108171250 TTGAATGTGCTTGAGGAGGAAGG - Intergenic
939500375 2:142976158-142976180 TTTTATGGGGTTGTGCTGGAGGG + Intronic
939894754 2:147777625-147777647 TGTAAGGAGGTGGTGGTGGAGGG - Intergenic
942849578 2:180468029-180468051 TTTGCTGAGCCTGTGGGGGATGG - Intergenic
943237209 2:185337881-185337903 TTCAGTCAGCTTGTGGTGAATGG + Intergenic
944488200 2:200229138-200229160 TTTGATTGGCTTGTGGTGGTGGG - Intergenic
945843480 2:214915658-214915680 TTAAATGAGCTTAATGTGGAAGG + Intergenic
946466540 2:219917006-219917028 TTCAATGAGCTTGTTGTGAAAGG + Intergenic
946712340 2:222519100-222519122 TTTATTTAGCTCGTGATGGATGG - Intronic
947411579 2:229846578-229846600 TTTAATTTTCTTGTGGTGGCTGG + Intronic
1169949476 20:11027408-11027430 TCTAATGAGCTGGAGTTGGAAGG - Intergenic
1175649998 20:60712591-60712613 TTTGATGAGCTTATCATGGATGG - Intergenic
1176895072 21:14367644-14367666 ATTAATGCGCTTGTGGTGACTGG + Intergenic
1176969424 21:15248677-15248699 TTCAATGAGCATTTGTTGGATGG - Intergenic
1182656128 22:31891546-31891568 TTTAATGAGCTTCTGTTGTAAGG - Intronic
1184077001 22:42187253-42187275 TTTCATGGGCTTGTATTGGAGGG - Intronic
1184919625 22:47596565-47596587 TTTAAGGAGCTTGTGGGGCTTGG - Intergenic
949155913 3:827160-827182 TTAAGTTAGCTTGTGGTGAATGG - Intergenic
952007744 3:28861465-28861487 TTTAATTGGCTTGTGGTTCAAGG + Intergenic
952702850 3:36344035-36344057 TTTAATGGGGTTGTACTGGAGGG + Intergenic
956195061 3:66645920-66645942 TTGAATGAGGTGGTGGTGGTGGG + Intergenic
956584597 3:70851115-70851137 TTTAATGAACTTGTACTGAATGG + Intergenic
963857208 3:150267074-150267096 TTTCATGAGCTTGGAGGGGAAGG + Intergenic
964488846 3:157213416-157213438 TTTAATGATTTTGTGGTGTTGGG - Intergenic
964498099 3:157317011-157317033 TTTAATGAGCTTCTGGGATATGG - Intronic
964648252 3:158981946-158981968 ATTGATGAGCTGATGGTGGATGG + Intronic
964705817 3:159617437-159617459 TTTAATGAGATTGTTAGGGAGGG - Intronic
965512357 3:169582258-169582280 TATAAGGAGGTTGTGGGGGAGGG + Intronic
967461581 3:189753107-189753129 TTTAATGAGCTTCTGTTGGGTGG + Intronic
968955996 4:3719920-3719942 TTTTGTGAGCTGGTGGTGGCAGG - Intergenic
970390949 4:15613253-15613275 TTGAATTAGTCTGTGGTGGATGG + Intronic
971525463 4:27612042-27612064 TATAATGAGCTTCTGGTCAAAGG + Intergenic
972986772 4:44774414-44774436 TTTGATGAGCTTGAGCTGAAGGG + Intergenic
975246911 4:72130554-72130576 TTTATTGAGGTTGTGATGAAAGG + Intronic
976078602 4:81328397-81328419 TTTATTGTGCTTTTGGTGTAAGG - Intergenic
978286815 4:107088578-107088600 TTTAATGAGTTTTTTGTGGTTGG + Intronic
978574834 4:110179259-110179281 TTTAAGGAGGCTGAGGTGGATGG + Intronic
980307866 4:131087853-131087875 TTTATTGAGTTTGTTCTGGAGGG - Intergenic
980870720 4:138608256-138608278 TTTAATGAAGGTGTGGTAGAGGG - Intergenic
981753347 4:148114940-148114962 CTTTATGGGCTTGTGCTGGAAGG - Intronic
984715300 4:182918953-182918975 CTTAATGATGTTGTGGTTGAAGG - Intergenic
985841057 5:2306158-2306180 TTAAATGAGGTTGTGTTGGGAGG - Intergenic
985974930 5:3410560-3410582 TTAAAAGAGCTTGGGGTGGGAGG - Intergenic
987380942 5:17285438-17285460 GTTAATGAGAATGTGGAGGAAGG + Intergenic
987404253 5:17508984-17509006 TTTATTTAGTTTGTGGAGGAAGG + Intergenic
988452567 5:31357838-31357860 GTTAAAGATCTTGGGGTGGAGGG - Intergenic
990124971 5:52504266-52504288 TTTGATAAGCATTTGGTGGAAGG + Intergenic
990820972 5:59839987-59840009 CTACATGAGCTTGTGGTGGGGGG + Intronic
991108767 5:62873116-62873138 TTTAATGTTCTTTTGTTGGAGGG - Intergenic
991357340 5:65782557-65782579 CATAGTGAGCTTGTGGAGGAAGG + Intronic
992708179 5:79419492-79419514 TTTTATGAGCTTGTGGTAAGTGG + Intronic
993136490 5:83972682-83972704 TTTAATGAGATCTTGATGGATGG - Intronic
995157898 5:108937578-108937600 TTTAATGACCTGGTAGAGGAGGG + Intronic
999969104 5:156841126-156841148 TTTAAGGAGAGTTTGGTGGAAGG - Intergenic
1001050752 5:168412241-168412263 TAAAATGAGCTTCGGGTGGAGGG - Intronic
1001541792 5:172544990-172545012 TTTAAAGAGTTTGGGTTGGAAGG - Intergenic
1002343875 5:178534843-178534865 TTTAATGAGAGTGTGGGGCAGGG - Intronic
1003132369 6:3405755-3405777 TCTAATGTGCTGGTGTTGGATGG - Intronic
1005945778 6:30594698-30594720 TTTAATGAGGCTGAGGTGGGAGG - Intronic
1007232383 6:40357348-40357370 TTGTGTGAGCTTGTGGGGGAGGG - Intergenic
1008694563 6:54019511-54019533 TTTAATGAACTTCTGGTATAAGG + Intronic
1011271119 6:85580639-85580661 CTTAGTCAGCTTGTGGTGAATGG - Intronic
1012205858 6:96459497-96459519 TTTAATGAGGCTGTGCAGGATGG - Intergenic
1015540251 6:134306451-134306473 TATAATGAGCATGTTATGGAGGG + Intronic
1016262199 6:142185947-142185969 TTTAATGAGCTTATATTGTAAGG + Intronic
1016992815 6:149941782-149941804 TTAAATGAGTCTGTCGTGGAAGG + Intergenic
1017005512 6:150025778-150025800 TTAAATGAGTCTGTCGTGGAAGG - Intergenic
1017032095 6:150233199-150233221 TTTAATCAGCAGGTGGTGGGTGG + Intronic
1020376272 7:7490979-7491001 TTTAATGTGTTTATGGAGGAAGG + Intronic
1026450959 7:70529090-70529112 TTTCATGTGTTTGTGGTGGTGGG - Intronic
1027756913 7:82225363-82225385 TTCAATGAACTTGAGTTGGAAGG - Intronic
1028498277 7:91487461-91487483 TTTAATGAGATTTTGGCTGAAGG + Intergenic
1029246042 7:99202381-99202403 TTTAATAAGGTTGGGGTAGATGG + Intronic
1030639248 7:111985501-111985523 CTTAATGAGATTTTGGGGGAGGG - Intronic
1031573708 7:123390089-123390111 AGTAATGAGCTTGTGGCTGAGGG - Intergenic
1034053393 7:148007620-148007642 TTGATTGAGCTTGTGCTGTATGG + Intronic
1034890103 7:154832211-154832233 TTTGAGGGGCTTGTGTTGGAGGG + Intronic
1035328637 7:158082293-158082315 TGGGATGAGCCTGTGGTGGAGGG - Intronic
1035821433 8:2596526-2596548 TTAAATGAGCTTTTTATGGAGGG - Intergenic
1037645254 8:20787181-20787203 TTCAGTGACCTTGGGGTGGAAGG + Intergenic
1040563005 8:48541154-48541176 TTAAACGAGCTTGTCGGGGAAGG - Intergenic
1041902541 8:62997843-62997865 TTTTATGAGGTTCTGGAGGAGGG - Intronic
1043000432 8:74753159-74753181 TCTAATGAGCATTTGGTGCATGG + Intronic
1043028396 8:75100720-75100742 TTTAAAAAGCTTGTTGTGGGTGG - Intergenic
1043850288 8:85208586-85208608 TTTAATAAGCGGGTGGGGGAAGG - Intronic
1044685775 8:94823903-94823925 TTTATTCAGCTTGGGGTTGAAGG - Intronic
1044725466 8:95191085-95191107 TTTGAAGTGCTTGAGGTGGAGGG + Intergenic
1045823184 8:106365942-106365964 TTTAATGAGCCTGAGGTTGCAGG + Intronic
1046278963 8:111999784-111999806 TTTAATGAGCATGGGTTAGAAGG - Intergenic
1048374292 8:133809162-133809184 CTAAATGTGGTTGTGGTGGATGG + Intergenic
1051435385 9:17025141-17025163 TTTTATGAGCTTTGGGTGCATGG - Intergenic
1051618060 9:19025536-19025558 TTCACAGAGCTTGTGGAGGAAGG - Intronic
1051835865 9:21336786-21336808 TTGAATGAGTTAGGGGTGGAAGG + Intergenic
1055625811 9:78176271-78176293 TTCAATGTGCTTGTGATTGAGGG + Intergenic
1056930084 9:90867050-90867072 TTTAAGTAGCATGTCGTGGAAGG + Intronic
1057618670 9:96616870-96616892 TTTATTGGGCTTTTGGGGGAAGG - Intronic
1060840364 9:126788677-126788699 TTTCTTGAGATTGTGGTCGATGG + Intergenic
1186370193 X:8938608-8938630 TTTCATAAGGTTGTGCTGGAGGG + Intergenic
1186603375 X:11063171-11063193 TTTAATTATCTAGTGGTGGAGGG + Intergenic
1188864666 X:35300212-35300234 TTCAGTCAGCTTGTGGTGAATGG - Intergenic
1190113427 X:47609919-47609941 TGTAATGGGATTCTGGTGGAAGG + Intronic
1192312927 X:70031513-70031535 CTTACAGAGCTTGGGGTGGAAGG + Intronic
1194361008 X:92950453-92950475 TTCAGTCAGCTTGTGGTGGATGG + Intergenic
1195333813 X:103830558-103830580 ATTAATGAGTTTGTGGGGGTAGG - Intronic
1195502124 X:105613636-105613658 TTTAATGAGCTTGTGGTGGATGG - Intronic
1195613771 X:106896623-106896645 TTTAATGAGCATGTGCTGTGTGG + Intronic
1196393843 X:115238492-115238514 CTTAATGTGGTTGTGTTGGAAGG + Intergenic
1196912172 X:120495074-120495096 TTTATTGAACTTGAGGTGCAGGG + Intergenic
1196929198 X:120664128-120664150 CTTGATGAGCTTGTGGTGGGGGG - Intergenic
1197422066 X:126249818-126249840 TTTAATCAACTTGAGCTGGAGGG + Intergenic
1197425388 X:126290602-126290624 TTAAATGGGCTGGGGGTGGAAGG - Intergenic
1198239171 X:134766360-134766382 GATAAGGAGCTTGTGGTGGTTGG + Intergenic
1198427910 X:136538254-136538276 TTTAATGTTTTTGTGGAGGAAGG - Intronic
1200816065 Y:7533808-7533830 TTCAATGAGGTTGTAGTTGAAGG - Intergenic
1200917896 Y:8587518-8587540 TTCATTGAGCTTTTGCTGGATGG + Intergenic
1200931617 Y:8702008-8702030 TTTATTGAGCTGTTGCTGGATGG - Intergenic
1201683021 Y:16669970-16669992 TTTAAGGATTTTGAGGTGGATGG + Intergenic