ID: 1195506230

View in Genome Browser
Species Human (GRCh38)
Location X:105659908-105659930
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1257
Summary {0: 2, 1: 11, 2: 274, 3: 470, 4: 500}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195506228_1195506230 -6 Left 1195506228 X:105659891-105659913 CCTCAAAGGGTAAATCTAAGACT 0: 1
1: 1
2: 16
3: 53
4: 206
Right 1195506230 X:105659908-105659930 AAGACTTATTGGCCCTAAAGAGG 0: 2
1: 11
2: 274
3: 470
4: 500
1195506225_1195506230 15 Left 1195506225 X:105659870-105659892 CCTGCAAGATGTAGAAAATATCC 0: 1
1: 1
2: 20
3: 200
4: 653
Right 1195506230 X:105659908-105659930 AAGACTTATTGGCCCTAAAGAGG 0: 2
1: 11
2: 274
3: 470
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902143937 1:14380752-14380774 AAAATTTATTAACCCTAAAGAGG + Intergenic
904028962 1:27522077-27522099 AAGATTTATTGGCACTGACGTGG - Intergenic
906735045 1:48117338-48117360 AAGAGTTATTTGCCTTAAAAAGG + Intergenic
906756380 1:48320141-48320163 AAGAGATATTGGCCTTAAAGAGG + Intronic
906870781 1:49478099-49478121 AAGAGTCATTGGGCTTAAAGAGG + Intronic
906903370 1:49862418-49862440 AAGAGATAATGGCCTTAAAGAGG + Intronic
906906172 1:49894798-49894820 AAGATTTACTGGCCTTAAAGGGG + Intronic
906909188 1:49927752-49927774 AAGAGTTATTGACCTTAAAGAGG + Intronic
907004076 1:50892793-50892815 AAGAGTTATTGGTCTTAAAGAGG - Intronic
907457006 1:54582390-54582412 AAGACAAATTGGGCCTAGAGGGG - Intronic
908175394 1:61550984-61551006 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
908302121 1:62772641-62772663 AAGACTTATTGGCCCTAAAGAGG - Intergenic
908598820 1:65717407-65717429 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
908958753 1:69669675-69669697 AAAACTTACTGGCCTTAAAGAGG - Intronic
909084254 1:71153060-71153082 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
909231126 1:73092147-73092169 AAGGGTTATTAGCCTTAAAGAGG - Intergenic
909438845 1:75674751-75674773 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
909615963 1:77608041-77608063 AAGAGTTATTAGCCTTAAAGAGG + Intronic
909870488 1:80732463-80732485 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
909958734 1:81809231-81809253 AAGACTTTTTAGCCTTAAATAGG - Intronic
910102360 1:83592668-83592690 AAGAATTATTGGCCTTAAAGAGG - Intergenic
910290014 1:85590565-85590587 AAGATTTATCAGCCTTAAAGAGG + Intergenic
910330808 1:86070361-86070383 GAGAGTTATTGGCCTTAAAGAGG + Intronic
910349121 1:86276136-86276158 AAGAGTTATTGGCCTTTAAGAGG - Intergenic
910379098 1:86607412-86607434 AAGAATTATTGACCCTAAAGAGG - Intergenic
910470239 1:87545553-87545575 AAGATTTATTGTCCTTAAAGAGG - Intergenic
910547525 1:88434544-88434566 AAGAGTTATTGGCCCTAAAGTGG + Intergenic
910560389 1:88583527-88583549 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
910639594 1:89445492-89445514 CTGAGTTATTGGCCTTAAAGAGG - Intergenic
910716240 1:90234701-90234723 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
910733291 1:90422285-90422307 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
910801191 1:91148323-91148345 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
911343770 1:96672625-96672647 AAGAGTTATTGACCTTAAAGAGG - Intergenic
911581982 1:99644667-99644689 GAAACTTATTGGCCCTACTGAGG - Intergenic
911725141 1:101235415-101235437 AAGACTTATTTCACTTAAAGGGG - Intergenic
911826158 1:102487211-102487233 AAGAATTATTGACCTTAAAAAGG + Intergenic
911975668 1:104490897-104490919 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
912015503 1:105028878-105028900 ATAAGTTATTGGCCTTAAAGAGG + Intergenic
912059155 1:105642754-105642776 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
912070930 1:105808295-105808317 AAGAGTTATTGGCTTTAAAGAGG + Intergenic
912117137 1:106420354-106420376 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
912136017 1:106660988-106661010 AAGAGTTATTTGCCTTAAAGAGG + Intergenic
912598719 1:110905163-110905185 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
912601293 1:110935727-110935749 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
912633083 1:111266094-111266116 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
912899089 1:113629027-113629049 AAGAGTTATTGGCCCAAAAGAGG - Intronic
912906790 1:113715994-113716016 AAGAGTTACTGACCTTAAAGAGG + Intronic
912913715 1:113789745-113789767 AAGACTTCTTTGCCCAAATGTGG - Intronic
913032380 1:114922242-114922264 AAGAGTCATTGGCCTTAAAGAGG - Intronic
913608298 1:120486911-120486933 AAGATTCATTGGCCTTAAAGAGG - Intergenic
913707083 1:121435884-121435906 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
914020677 1:143863832-143863854 AAGACTAATTTTCCCCAAAGAGG + Intergenic
914370054 1:147016694-147016716 AAGATTCATTGGCCTTAAAGAGG - Intergenic
914484641 1:148096721-148096743 AAGATTCATTGGCCTTAAAGAGG + Intergenic
914582904 1:149034933-149034955 AAGATTCATTGGCCTTAAAGAGG + Intronic
914659174 1:149771758-149771780 AAGACTAATTTTCCCCAAAGAGG + Intergenic
915005539 1:152631695-152631717 AAGGTTTATTGGCCTTAAAAAGG + Intergenic
915186305 1:154107965-154107987 AAGAGCTACTGGCCTTAAAGAGG + Intronic
915753067 1:158229938-158229960 AAGTGCTATTGGCCTTAAAGAGG + Intergenic
915777419 1:158505971-158505993 AAGAATTATTGGCCTTAAAAAGG - Intergenic
915811058 1:158911035-158911057 AAGAGTTACTGGCCTTGAAGAGG + Intergenic
915857012 1:159398817-159398839 AAGAATTACTGGCCTTAAAGAGG + Intergenic
916293625 1:163192479-163192501 AAGACCTATTCGCCTTAAAGTGG + Intronic
916321986 1:163514379-163514401 AAGGTTTATTGACCTTAAAGAGG + Intergenic
916369298 1:164072522-164072544 AAGAGTTACTGGCTTTAAAGAGG - Intergenic
916379315 1:164191031-164191053 GAAATTTATTGGCCTTAAAGAGG + Intergenic
916616229 1:166443796-166443818 AAGAGTTAGTGGCCTTAAAGAGG - Intergenic
917061540 1:171047281-171047303 AAGAGTCACTGGCCTTAAAGAGG - Intronic
917300489 1:173569562-173569584 AAGTGTTATTGGCCTTAAAGAGG - Intronic
917364187 1:174210624-174210646 AAAAGTTATTGGCCTTAAAGAGG + Intronic
917372934 1:174315848-174315870 AAGCATTATTGGCCTTAAAGAGG - Intronic
917840967 1:178977473-178977495 AAGAGTCGTTGGCCTTAAAGAGG + Intergenic
917986443 1:180325207-180325229 AAGAGTTATTGGCCTTAAGGAGG - Intronic
918018565 1:180662738-180662760 AAGAATTACTGGCCTTAAAAAGG - Intronic
918415916 1:184308756-184308778 AAGAATTATTGGCCTTAAAGAGG - Intergenic
918476067 1:184926774-184926796 CTGAGTTATTGGCCTTAAAGAGG - Intronic
918666063 1:187153111-187153133 AAGAGTTGTTGGCCTTAAAGAGG - Intergenic
918671462 1:187222763-187222785 AAGAGTTACTGGCTTTAAAGAGG - Intergenic
918871506 1:189980972-189980994 AAGAGTTATTGGCCATAAAAAGG - Intergenic
918959481 1:191254875-191254897 AAGGGTTATTGTCCTTAAAGAGG - Intergenic
918986229 1:191630793-191630815 AAGAGTTATTGGTCTTAAAGCGG + Intergenic
919067940 1:192716085-192716107 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
919283881 1:195527587-195527609 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
919511693 1:198473188-198473210 AACAGTTATTGGCCATAAAGAGG + Intergenic
920549826 1:206848960-206848982 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
920924021 1:210325047-210325069 GAGAGTTACTGGCCTTAAAGAGG - Intergenic
920953478 1:210596437-210596459 AAGAGTTACTGGCCTTAAAAGGG - Intronic
921002506 1:211057744-211057766 AAAAGTTATTGGCCTTAAAGAGG + Intronic
921012119 1:211152072-211152094 AAGAGTTATTGGCCTTTAAAAGG + Intergenic
921042820 1:211449922-211449944 AAGTGTTATTGGCCTTAAAGAGG + Intergenic
921746411 1:218744910-218744932 AAGACTTATTAGCCTTAGTGAGG + Intergenic
921769917 1:219023676-219023698 GAGACTTATTGGCCTTAAAGAGG + Intergenic
921775189 1:219089677-219089699 AAGATTTACTGGCCTTAAAGAGG + Intergenic
921823353 1:219642279-219642301 GAAAGTTATTGGCCTTAAAGAGG + Intergenic
921929177 1:220741112-220741134 AACAGTTATTGGCCTCAAAGAGG - Intergenic
923867576 1:237956452-237956474 AAGAGTTACTGGTCCTAAAGAGG + Intergenic
924490637 1:244534375-244534397 AAGAGTTATGGGCCTAAAAGAGG - Intronic
924515997 1:244766794-244766816 AAGACTTATTGGCCTTAAAGAGG - Intergenic
924833653 1:247626840-247626862 AAAAGTTATTGGCTTTAAAGAGG - Intergenic
1062765740 10:63410-63432 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1063505079 10:6590521-6590543 AAGACTACTTGGCCATAAAAAGG + Intergenic
1064442057 10:15362979-15363001 AATACTTATTGGACAAAAAGAGG - Intronic
1064446696 10:15400094-15400116 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1064521557 10:16208389-16208411 AAGAGTTATTGGCCTTCAAGAGG - Intergenic
1065426828 10:25615007-25615029 AAGACTTATTGGCCTTAAAGAGG - Intergenic
1065431288 10:25659924-25659946 AAGAATTATTGGCCTTAAAGAGG - Intergenic
1065461043 10:25965213-25965235 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1066142808 10:32524983-32525005 AAGAGTTATTGGCCTTGAACAGG - Intronic
1066527130 10:36293782-36293804 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1068125073 10:52829090-52829112 AAGAATTATTGACCTTAAAGAGG + Intergenic
1068217450 10:54000717-54000739 AAGTGTTATTGGCATTAAAGAGG + Intronic
1068475701 10:57521558-57521580 AAGACTTATTGGGCCAGATGTGG + Intergenic
1069147978 10:64919021-64919043 AAGAGTTAGTGGTCTTAAAGAGG + Intergenic
1069343663 10:67441339-67441361 AAGAATTATTGGTCTTAAAGAGG + Intronic
1069391910 10:67944982-67945004 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1069397619 10:68007086-68007108 AAGGGTTACTGGCCTTAAAGAGG - Intronic
1070445116 10:76491788-76491810 AAGAGTAATTGGCCTTAAAGAGG - Intronic
1070464400 10:76705036-76705058 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1071046482 10:81385860-81385882 AAGAGTTATTGGCCTTCAAGAGG - Intergenic
1071109220 10:82135451-82135473 AAGAGTTATTTGCCTTAAAAAGG - Intronic
1071209327 10:83319200-83319222 AAGAGTTATTGACCTTAAAGAGG + Intergenic
1071896574 10:90074612-90074634 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1071963172 10:90825888-90825910 AAGAGTCACTGGCCTTAAAGAGG + Intronic
1072115342 10:92365375-92365397 AAGAGTTATTAGCCTTAAAAAGG - Intergenic
1072396799 10:95051387-95051409 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1072399772 10:95085729-95085751 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
1072843181 10:98797516-98797538 AAGAGATATTGGCCTTAAAGAGG + Intronic
1072853569 10:98923505-98923527 AAGAGTTATTGGCTTTAAAGAGG - Intronic
1072862860 10:99024450-99024472 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1072946982 10:99819238-99819260 AAGACATACAGGCCCTGAAGAGG + Exonic
1075195110 10:120349625-120349647 AAGAGTTATTGGCCTTAAAAAGG + Intergenic
1075830415 10:125406226-125406248 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1077427642 11:2491601-2491623 AAGATTTATTGACCTTAAAGAGG + Intronic
1077709829 11:4524680-4524702 CAGAACTATTGGCCTTAAAGAGG + Intergenic
1077740599 11:4841196-4841218 AAGAGTTATTGGTCTTAAAGAGG + Intronic
1077835638 11:5924751-5924773 AAGAGATATTGTCCTTAAAGAGG + Intronic
1077970445 11:7183275-7183297 AAGAGTAATTGGCCCTAAAGAGG + Intergenic
1078036954 11:7815851-7815873 AAGAGTTATTGGCCTTAAACAGG + Intergenic
1078244474 11:9561698-9561720 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1078305477 11:10180683-10180705 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1078691046 11:13580918-13580940 AAGAGTTATTGGCCCTAAAAAGG + Intergenic
1078842868 11:15095297-15095319 AAGAGTTATTGGTCTTAAAGAGG - Intergenic
1079038114 11:17038295-17038317 AAGAGTTATTGGCCTTAAAGCGG + Intergenic
1079069083 11:17327534-17327556 GAGTTTTATTGGCCTTAAAGAGG - Intronic
1079183710 11:18216821-18216843 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1079473711 11:20806649-20806671 ATGAGTTATTGGCCTTAAAGGGG - Intronic
1079558375 11:21790622-21790644 AAGACTTATTGGTCTTAAAGAGG - Intergenic
1079625833 11:22616883-22616905 AAGAGTTATTGGCCTTAAAAAGG - Intergenic
1079701553 11:23554877-23554899 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1079760028 11:24318013-24318035 AAGCATTATTGGCCTAAAAGAGG - Intergenic
1080489606 11:32749153-32749175 AAGTGTTTTTGGCCTTAAAGAGG - Intronic
1080707047 11:34706091-34706113 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
1081049339 11:38317411-38317433 AAGAGTAATTGGCCTTAACGAGG + Intergenic
1081112266 11:39150540-39150562 AACAGTTATTAGCCTTAAAGAGG + Intergenic
1081192885 11:40126209-40126231 AAGACTTATTTGGCTTACAGTGG + Intronic
1081245910 11:40765860-40765882 AAGAGTCATTGGCCTTAAGGAGG + Intronic
1082114578 11:48314443-48314465 AAGAATCATTTGCCTTAAAGAGG - Intergenic
1082225468 11:49701716-49701738 AAGAGTTATTGGCCTTAAATAGG - Intergenic
1082823910 11:57563979-57564001 AAGAGTTACTGGCCTTAAATAGG + Intronic
1084658576 11:70533947-70533969 AACACTACTTGGCCATAAAGAGG - Intronic
1085007961 11:73112603-73112625 AAGAGTTATTGACCTTAAAGAGG - Intronic
1085147499 11:74214357-74214379 AAGAGTTAGTGGTCTTAAAGAGG + Intronic
1085194500 11:74660417-74660439 AAGAGTTATTGACCTTAAAGAGG - Intronic
1085372122 11:76018945-76018967 AAGAGTTACTGGCCTTAAAGAGG - Intronic
1085562960 11:77488826-77488848 AAGACTTATTGGCCATAAAAAGG + Intergenic
1086068928 11:82777392-82777414 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1086261268 11:84944342-84944364 AAGAGTTATTGGTCTTAAAGAGG - Intronic
1086569794 11:88268358-88268380 ATGAGTTATTAGCCTTAAAGAGG + Intergenic
1086623613 11:88917860-88917882 AAGAGTTATTGGCCTTAAATAGG + Intronic
1086847699 11:91772656-91772678 AAGAGTTAACGGCCTTAAAGTGG - Intergenic
1087178468 11:95118770-95118792 AAGAATTACTGGCCTTAAAGAGG - Intronic
1087503078 11:98984519-98984541 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1087877116 11:103371332-103371354 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1087887729 11:103499206-103499228 AAGAGTTACTAGCCTTAAAGAGG + Intergenic
1088182007 11:107122921-107122943 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1088330814 11:108649046-108649068 AAGAGTTATTGGCCTTAAAGTGG + Intergenic
1088361850 11:108999817-108999839 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1088411345 11:109538199-109538221 AAGAGTTATTGGCCCTAAAGGGG - Intergenic
1088601622 11:111483751-111483773 AAGAGTTATTACCCTTAAAGAGG + Intronic
1088944317 11:114494312-114494334 AAGAGGTATTAGCCTTAAAGAGG - Intergenic
1088985369 11:114901091-114901113 AAGAGTTATTGGCATTAAAGAGG + Intergenic
1089463951 11:118671575-118671597 AAGACTTATTGTACTTAAAGAGG + Intronic
1089824532 11:121263333-121263355 AAGAGTTACTGGACCTAAAGTGG - Intergenic
1090316601 11:125796278-125796300 AAGAGTTATTGACCTTAAAGAGG - Intergenic
1092320356 12:7466183-7466205 AAGAGTTATTGGCCTTAAAAAGG + Intronic
1092326574 12:7537855-7537877 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1092629828 12:10365243-10365265 AAGGCTAATTGCCCCTAAGGAGG + Intergenic
1092642555 12:10531662-10531684 AAGAGTTATTGGCCTTACAGAGG + Intergenic
1093259350 12:16916488-16916510 AAGAGTTGTTGGCCTTAAAAAGG - Intergenic
1093321159 12:17717216-17717238 AAGAGTCACTGGCCTTAAAGAGG - Intergenic
1093403764 12:18779553-18779575 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1093403956 12:18781726-18781748 AAGAGTTACTGGCTTTAAAGAGG + Intergenic
1093581488 12:20789145-20789167 AAGAGTTATTGTCCTTAAAGAGG - Intergenic
1093602059 12:21039346-21039368 AAGAGTTATTTGCCTTAAAAGGG - Intronic
1093607961 12:21117326-21117348 AAGAGTTGTTGGGCTTAAAGAGG - Intronic
1093694509 12:22144841-22144863 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1093903130 12:24659700-24659722 AAGAATTATTGACCTTAAGGAGG - Intergenic
1093988663 12:25566205-25566227 AAGAGTTATTGGCCTCAAAGAGG - Intronic
1094258747 12:28466240-28466262 AAGAGTTATTGGCCCTAAAGAGG + Intronic
1094328070 12:29261451-29261473 AAGAGTCATTGGCCTTAAAGAGG + Intronic
1094658008 12:32439783-32439805 AAAAGTTATTGGCCTTAAAGAGG - Intronic
1094757674 12:33490989-33491011 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1094815928 12:34184762-34184784 AAGAGTTATTGGCCTTAAAAAGG - Intergenic
1096451145 12:51742811-51742833 TAGAGTTATTGGCCTTAAAAAGG - Intronic
1097146835 12:56947224-56947246 AAGAGTTATGGGCCTTAATGAGG - Intergenic
1097466421 12:59930125-59930147 AAGAGTTATTGGCCTTAACTAGG + Intergenic
1097508787 12:60509068-60509090 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1097563488 12:61238378-61238400 AAGTGTTATTGGCCTTAAAGAGG - Intergenic
1097770112 12:63573474-63573496 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1097791416 12:63819193-63819215 AAGAGTTATTGGCCTTAAAAAGG + Intergenic
1097899037 12:64855439-64855461 AACAGTTATTGGCCTTAAAGTGG - Intronic
1097904696 12:64907682-64907704 CAGGCTTATTGGACCTAAGGTGG - Intergenic
1098112109 12:67133724-67133746 AAGAATTATTAACCATAAAGGGG - Intergenic
1098142717 12:67467678-67467700 AAGAGTTGTTGGCCTTAAACAGG - Intergenic
1098207737 12:68131222-68131244 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1098395478 12:70012378-70012400 AAGAGTTCTTGGCTTTAAAGAGG + Intergenic
1098504082 12:71228419-71228441 ATGAGTTATTGGCCTTAAAAAGG + Intronic
1098537737 12:71613780-71613802 ATGACTTAATGTCCATAAAGTGG + Intronic
1098959203 12:76720635-76720657 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1099024670 12:77449745-77449767 AAGAATCATTGGCCTTAAAGGGG + Intergenic
1099100784 12:78438276-78438298 AAGAGTTATGAGCCCTAAAGAGG - Intergenic
1099495523 12:83341367-83341389 AAGAGTTATTGGCCTTAAATAGG + Intergenic
1099562068 12:84191457-84191479 TAGCATTATTGGCCTTAAAGGGG - Intergenic
1099564717 12:84228999-84229021 AAGAATTATTGACCTTAAAGAGG - Intergenic
1099609940 12:84855892-84855914 AAGAGTTATTGCCCTTAAAGAGG - Intergenic
1099764005 12:86959489-86959511 AAGAGTTATTGGCCTTAAACAGG - Intergenic
1099808337 12:87548043-87548065 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1099911801 12:88842934-88842956 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1100060859 12:90574329-90574351 CAGAATTATCGGCCTTAAAGAGG - Intergenic
1100360616 12:93876432-93876454 AAGAGTTATTGGCCTTAAATAGG - Intronic
1100875894 12:98961041-98961063 AAGTGTTATTGGCCCTAAAGAGG + Intronic
1100914577 12:99404682-99404704 AACAGTTATTGGCCTTATAGAGG + Intronic
1100923765 12:99520672-99520694 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1100946545 12:99789891-99789913 AAAAGTTACTGGCCTTAAAGAGG + Intronic
1101162402 12:101992655-101992677 AAGAGTTATTGGCTCTAAAGAGG - Intronic
1102232137 12:111269967-111269989 ATGAATTAGAGGCCCTAAAGGGG - Intronic
1104106694 12:125667193-125667215 AAGATTTCTTTGCCCTAAAAAGG - Intergenic
1105336216 13:19472273-19472295 AAGTGGTATTGGCCTTAAAGAGG - Intronic
1105558847 13:21471872-21471894 AAGGGTTTTTGGCCTTAAAGAGG - Intergenic
1105772738 13:23628525-23628547 AAGACTTTCTGACTCTAAAGTGG - Intronic
1107083778 13:36404259-36404281 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1107370043 13:39736113-39736135 AAGAGTTGTTGGCCTTAAAGAGG - Intronic
1107552032 13:41486141-41486163 AAGAGGTATTGGCCTTAAAGAGG - Intergenic
1107808055 13:44173338-44173360 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1108255778 13:48610001-48610023 CTGAGTTATTGGCCTTAAAGAGG - Intergenic
1108328746 13:49362627-49362649 AAGACTTACTGACCTTAAAGAGG + Intronic
1108332591 13:49404958-49404980 AAGAGTCATTGGCCTTAAAAAGG + Intronic
1108878966 13:55085815-55085837 AAGAGTTGTTGGCCTTACAGAGG - Intergenic
1108973456 13:56404670-56404692 CAGAATTATTGGACTTAAAGAGG + Intergenic
1109506892 13:63313281-63313303 AAGAGTAATTGGCCTTAAAAAGG + Intergenic
1109522583 13:63532661-63532683 ATCTCTTATTGGCCTTAAAGAGG - Intergenic
1109554479 13:63954272-63954294 AAGAATTATTGGCCTTAATCAGG - Intergenic
1109747824 13:66649091-66649113 AAGATTTGTTGGTCTTAAAGAGG + Intronic
1109961424 13:69637480-69637502 AAGAGTAATTGGCCTTAAAAAGG - Intergenic
1110376879 13:74804080-74804102 AAGAGTTATTGTCCTTAAAGAGG + Intergenic
1110486748 13:76053890-76053912 AAGAGTTATTGGCTTTAATGAGG + Intergenic
1110806763 13:79764075-79764097 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
1110915027 13:81010772-81010794 CTGAGTTATTGGCCTTAAAGAGG - Intergenic
1110916581 13:81029160-81029182 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1111130496 13:83969002-83969024 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1111365065 13:87233110-87233132 AAGAGTTATTGGCCTTAAAAGGG - Intergenic
1111639494 13:90948822-90948844 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1112137145 13:96593048-96593070 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1112177014 13:97035785-97035807 AAGAGTTACTGGCCCTAAAGAGG + Intergenic
1112705736 13:102067680-102067702 AGTACTTACTGGCCTTAAAGAGG + Intronic
1112866032 13:103899292-103899314 AAGAGTTATTAGCCTTAAAGAGG + Intergenic
1112877602 13:104064028-104064050 CTGACTTATTAGCCCGAAAGTGG + Intergenic
1112901330 13:104361665-104361687 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
1113217784 13:108062387-108062409 AAGAATTATTGGCCATAAAGAGG + Intergenic
1113558828 13:111260140-111260162 AGGAGTTATTGGCCTTAAGGAGG + Intronic
1114506479 14:23218702-23218724 GTGAGTTATTGGCCTTAAAGAGG + Intronic
1114994210 14:28327559-28327581 AAGAGTTATTGGTCTTAAAGAGG - Intergenic
1115308631 14:31957415-31957437 AAGACATATTCTCCCTAAAGAGG + Intergenic
1115333417 14:32221694-32221716 AAGACTCATTTGCACTCAAGAGG + Intergenic
1115381442 14:32744722-32744744 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1115661225 14:35496176-35496198 CTGAGTTATTGGCCTTAAAGAGG + Intergenic
1115673045 14:35637604-35637626 TAGAGTTATTGGCTTTAAAGAGG + Intronic
1115809980 14:37096479-37096501 AAGAATTATTGGCCTTAAAGAGG - Intronic
1115821161 14:37213600-37213622 AAGAGGTATTGGCCTTAAAGAGG + Intronic
1115861368 14:37689347-37689369 AAGTGTTATTGGCCTTAAAGAGG + Intronic
1115930299 14:38483690-38483712 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1115948817 14:38696070-38696092 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1116058038 14:39887370-39887392 AAGAGTTATTGGCTTTACAGAGG + Intergenic
1116085703 14:40235459-40235481 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
1116140916 14:40993581-40993603 AACAGTGATTGGCCTTAAAGAGG - Intergenic
1116154869 14:41190416-41190438 TAGAGTTATTGGCCTTAAAGAGG + Intergenic
1116192764 14:41681145-41681167 AAGAGTTATTGGCCTTAGAGAGG + Intronic
1116220741 14:42084407-42084429 AAGAGTTATCGGCCTTAAAGAGG - Intergenic
1116392856 14:44414568-44414590 TAGAGTTATTGGTCTTAAAGAGG + Intergenic
1116481241 14:45393528-45393550 AAGAATTATTGGCCTTAAAAAGG + Intergenic
1116506808 14:45693016-45693038 AAGAGTTATTGGCCTTACAGAGG - Intergenic
1116766124 14:49072065-49072087 AAGAGTTATAGGCCTAAAAGAGG + Intergenic
1116889294 14:50251401-50251423 AAGAGTTATTGGCCTAAAAGAGG + Intronic
1117110509 14:52448077-52448099 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1117159203 14:52972262-52972284 AAGAGTTATGGGCCTTAAAGAGG - Intergenic
1117208293 14:53468615-53468637 AAGACTTGTTGGCCTTAAAGAGG - Intergenic
1117504306 14:56387282-56387304 AAGAGTTATTGGCCTTGAAGAGG - Intergenic
1117530015 14:56651488-56651510 AACAATTATTGGCCTGAAAGTGG + Intronic
1117795237 14:59387079-59387101 AAGAATTATTGGCCTTAAAGAGG - Intergenic
1117842846 14:59879310-59879332 AAGAGTTATTGGCCTTAAGGAGG - Intergenic
1117870998 14:60199974-60199996 AAGAGTTATTGGCTTGAAAGGGG + Intergenic
1117934330 14:60885301-60885323 AAGAGTTATGGGGCCTAAATAGG - Intronic
1118010588 14:61606838-61606860 TACACTTATTGGCCATTAAGAGG - Intronic
1118034052 14:61847672-61847694 CAGAGTTATTGGCCATAAAGAGG - Intergenic
1118099040 14:62574341-62574363 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
1118240954 14:64058470-64058492 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1118380954 14:65217105-65217127 AAGACTTATTGGCATTAGGGTGG - Intergenic
1118543703 14:66860003-66860025 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1119083626 14:71720258-71720280 AAGAATTATTGGCCCTAAAGAGG - Intronic
1120107484 14:80513579-80513601 AAGAGTTTTTGGCCTTAAAGAGG - Intronic
1120340519 14:83215799-83215821 ATGAGTTATTTGCCTTAAAGAGG - Intergenic
1120426490 14:84354061-84354083 TAAAGTTATTGGCCTTAAAGTGG + Intergenic
1120603295 14:86539650-86539672 AAGACATTTTGGCTCTAGAGGGG - Intergenic
1120808366 14:88776963-88776985 AGGAGTTACTGGCCTTAAAGAGG + Intronic
1121153138 14:91655721-91655743 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1121376127 14:93412314-93412336 AACAGTTATTGGCCTTAAAGAGG + Intronic
1121758996 14:96427730-96427752 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1123111902 14:105875444-105875466 AAGAATTATTAGCCTTAAAGAGG - Intergenic
1123720295 15:23055012-23055034 AAGAGTTATTAACCTTAAAGAGG - Intergenic
1124037298 15:26066443-26066465 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1124844095 15:33273954-33273976 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1125044326 15:35229158-35229180 AAGAGTAATTGGCCTTAAAGAGG - Intronic
1125272473 15:37954095-37954117 AAGAGTTACTGGCCTTAAAGGGG + Intronic
1125276821 15:38002457-38002479 AAAAGTTATTGGCCTTAAAGAGG - Intergenic
1125510163 15:40288500-40288522 AAGACTTCTAGGCCCCAGAGAGG + Exonic
1125565991 15:40678759-40678781 AAGAGTTATTGGCCTGAAAGAGG - Intergenic
1125566263 15:40681106-40681128 AAGAGTTACTGGCCTTAAAAGGG - Intergenic
1125877694 15:43165173-43165195 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1126053054 15:44705164-44705186 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1126216413 15:46159354-46159376 AAGAGTTATTTGCCTTAAAGAGG + Intergenic
1126247062 15:46519333-46519355 AACAGTTATTGGCCTTAAAGAGG + Intergenic
1126250631 15:46564269-46564291 AAGCATTATTGGCCCTAAAGAGG - Intergenic
1126294834 15:47128371-47128393 AAGAGCTATTGGCCTTAAAGAGG - Intergenic
1126488982 15:49215340-49215362 AAGAGTTATTGGCTTTAAAGAGG - Intronic
1126660548 15:51029248-51029270 AAGGATTATTGGCCTTATAGAGG - Intergenic
1127022455 15:54763597-54763619 AAGAGTCATTGGCCTTAAAGAGG + Intergenic
1127033909 15:54894204-54894226 CTGAGTTATTGGCCTTAAAGAGG - Intergenic
1127140610 15:55971637-55971659 AAGACTTATTAGCTTTAAAGAGG + Intronic
1127155567 15:56121638-56121660 AAGAGCTATTGGCCTTAAAGAGG - Intronic
1127837642 15:62803422-62803444 AAGAGTTATTGGCCTTAAAAAGG - Intronic
1127971331 15:63964561-63964583 AAGAGTTATTGGCCCCAATGAGG - Intronic
1128364659 15:66989548-66989570 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1129642593 15:77395332-77395354 AAGAGTTATTGCGCTTAAAGAGG + Intronic
1129736027 15:77964413-77964435 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1129835294 15:78701302-78701324 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1130173075 15:81537062-81537084 AAGAGTTTTTGGCTTTAAAGAGG + Intergenic
1130400183 15:83545135-83545157 AAGAGTTATTGACCTTAAAGAGG - Intronic
1130440968 15:83954142-83954164 AAGAGTTATTAGTCTTAAAGGGG - Intronic
1130511980 15:84596988-84597010 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1131323341 15:91419338-91419360 AATAGTTATTGGCCTCAAAGAGG - Intergenic
1131945080 15:97610577-97610599 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1133833717 16:9348952-9348974 AAGAGTTACTGGCCTCAAAGAGG - Intergenic
1137225861 16:46507729-46507751 AAGAGTTAATGGCCTTAGAGAGG + Intergenic
1138638120 16:58360398-58360420 AAGGGTTATTGGCCTTAAAAAGG - Intronic
1138806703 16:60098911-60098933 AAGCATTATTGGCTTTAAAGAGG - Intergenic
1138844787 16:60552806-60552828 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1139103652 16:63800554-63800576 AAGACTTACTGGCTTTAAGGAGG - Intergenic
1140157920 16:72453595-72453617 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1140566932 16:76054695-76054717 AAGAGTTATTGGCCTTAAGGCGG - Intergenic
1140646460 16:77036985-77037007 AAGACTTATTGGCCTTAAACAGG - Intergenic
1140652925 16:77108104-77108126 AAGAGTTATTGCCTCTACAGAGG - Intergenic
1141037489 16:80640982-80641004 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1141485385 16:84335687-84335709 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1142919759 17:3173973-3173995 AAGAGTGATTGGCCTTAAAGAGG + Intergenic
1143257140 17:5568165-5568187 AAGAGTTATTGGCCTTAAGGAGG - Intronic
1143431440 17:6890054-6890076 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1144258686 17:13496416-13496438 AAGACTTCCTGGGCCTCAAGAGG - Exonic
1144345466 17:14345408-14345430 AAGACTTCCTGGGCCTCAAGAGG + Exonic
1146242362 17:31242412-31242434 AAGAGTTACTGGCCTTAAAGAGG - Intronic
1149054468 17:52346542-52346564 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1149111136 17:53032275-53032297 AAGTGTTATTGGCCTTTAAGAGG - Intergenic
1149235061 17:54579687-54579709 CAGAGCTATTGGCCTTAAAGAGG + Intergenic
1149239944 17:54637057-54637079 AAGAGTTATTGGCTTTAAAGAGG + Intergenic
1149906482 17:60530836-60530858 AAGAGTTATTGACCTTACAGAGG + Intergenic
1150871205 17:68912476-68912498 AAGAGTCATTGGCCTTAAGGAGG + Intronic
1151830606 17:76547189-76547211 AAGACTGAGGGGTCCTAAAGGGG - Intronic
1152909531 17:82992090-82992112 AAGAGTTATTGGCCCTAAAAAGG + Intronic
1152958540 18:62755-62777 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1153075146 18:1154603-1154625 AAGAGTTATTGGCCTTAGTGAGG - Intergenic
1153099776 18:1453159-1453181 AAGAGTTATTGCCCTTAAAGAGG + Intergenic
1153268152 18:3292357-3292379 AAGGGTTATAGGCCTTAAAGGGG - Intergenic
1153363504 18:4225830-4225852 AAGAGTTATTGGCCTTAAAAAGG + Intronic
1153388742 18:4531211-4531233 AAGAGTTATTGGACTTAAAGAGG - Intergenic
1153425893 18:4962565-4962587 AAGAGTTATTTGCCATAAAAAGG + Intergenic
1153714765 18:7837119-7837141 AAGAGTTATTGGACTTAAAAAGG - Intronic
1153722502 18:7921195-7921217 AAGAATTATTGGTGCTCAAGAGG - Intronic
1154386759 18:13899394-13899416 AAGAGTTATTGGTCTTAAAGAGG + Intronic
1155282314 18:24252102-24252124 CAGTGTTACTGGCCCTAAAGAGG + Intronic
1155560650 18:27072809-27072831 AAGACTTATTGGTCCAGTAGGGG + Intronic
1155977946 18:32152056-32152078 AAGAATTATTGGCATTCAAGAGG - Intronic
1156025823 18:32654050-32654072 AGGAGTTATTGGCATTAAAGGGG - Intergenic
1156094431 18:33511789-33511811 AGGAGTTATTGGCCTTAGAGAGG + Intergenic
1156572607 18:38275525-38275547 AAGAGTTGTTGGCCTTAAAGAGG - Intergenic
1156977106 18:43236509-43236531 AAGAGATTTTGGCCATAAAGAGG - Intergenic
1157022568 18:43804425-43804447 AAGAGTTATTGGCCTTAAAGGGG - Intergenic
1157879490 18:51306338-51306360 AAGAGTTATTGGCATTAAGGAGG + Intergenic
1157937151 18:51885430-51885452 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1158242942 18:55398118-55398140 AATACTTATTGACCCTGTAGTGG - Intronic
1158468789 18:57715398-57715420 AAGAGTTATTGGCATTAAAGTGG + Intronic
1158948839 18:62473362-62473384 CAGAATTATTGGCCTTACAGAGG - Intergenic
1159091857 18:63859092-63859114 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1159260647 18:66007427-66007449 AAGAGTTATTGACCGTAAAGTGG + Intergenic
1159284749 18:66335299-66335321 AAGAGTTATTGGCCTTAGAGAGG - Intergenic
1159718547 18:71856518-71856540 AAGAGTTATTGGCCATAAAGAGG + Intergenic
1162611068 19:11753556-11753578 AGGAGTTATTAGCCTTAAAGAGG - Intergenic
1162692648 19:12446818-12446840 AAGAGTCATTGGCTTTAAAGAGG - Intronic
1163185296 19:15634668-15634690 AACAATTCTTGGCCTTAAAGAGG - Intronic
1164456961 19:28416743-28416765 AAGAGTTATTGGCCTTAAAGGGG - Intergenic
1164547043 19:29174837-29174859 AAGATTTATCGGCCTTAAAGAGG + Intergenic
1165645644 19:37433382-37433404 AACACTTATTGGCCTTAAAGAGG + Intronic
1166408088 19:42537809-42537831 AAAAGTTATTGGCCTTAAAGAGG - Intronic
1166755719 19:45189874-45189896 AAGAATTACTGGACTTAAAGAGG - Intronic
925269601 2:2593115-2593137 TAGAGTTATTGGCCTTAAAGAGG + Intergenic
925491111 2:4394392-4394414 AACAGTTATTGACCTTAAAGAGG - Intergenic
925877145 2:8321582-8321604 AAGATATAATGGCCCTGAAGTGG - Intergenic
926512327 2:13797800-13797822 AAGCATTATTGGCTTTAAAGAGG - Intergenic
926833779 2:16995352-16995374 AAAAGTTATTGGCTTTAAAGAGG - Intergenic
926963989 2:18389740-18389762 AAGACTAATTGGCCTGGAAGAGG - Intergenic
927348073 2:22070378-22070400 CAGAGTTATTGGCCTTAAAAGGG + Intergenic
927569986 2:24151037-24151059 AAGAGTTATTGGCCTTACAGGGG - Intronic
928459056 2:31452524-31452546 AAGAATTATTGGCCTTAAAGAGG + Intergenic
928484293 2:31713485-31713507 TAAAGTTATTGGCCTTAAAGAGG + Intergenic
928495504 2:31827810-31827832 AAGAGATATTGGCCTTAAAGAGG - Intergenic
928609745 2:32981189-32981211 AAGAGTTACTGACCTTAAAGAGG - Intronic
928763297 2:34610297-34610319 AAAATTTATTGGCCTTAAAGAGG - Intergenic
928846191 2:35676031-35676053 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
929215402 2:39406262-39406284 AAGACTTATTGGCCTTAAAAAGG + Intronic
929388481 2:41440972-41440994 AAGACTTACTGGTCTTAAAAGGG - Intergenic
929926394 2:46215690-46215712 AAAAGTTATTGGCCTTAAAGAGG - Intergenic
930141725 2:47957453-47957475 AAGTGTTATTGGCCTTAAAGAGG + Intergenic
930475608 2:51877268-51877290 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
930527673 2:52550056-52550078 AAGAGTTATTAGCCTTAAAGAGG + Intergenic
930778438 2:55198230-55198252 AGGAGTTATTGGTCTTAAAGAGG + Intronic
930878147 2:56243246-56243268 AAGAGTTATTGGCTTTAAAGAGG - Intronic
930895239 2:56438782-56438804 AAGAGTTATTGGGCTTAAAGAGG - Intergenic
930981088 2:57527174-57527196 AAGAGTTATTGGCCCTAATGAGG - Intergenic
931085791 2:58829540-58829562 AAGAATTATTGGCCTAAAAGAGG - Intergenic
931568848 2:63647018-63647040 AAGAATTAATGGCCTTAAAGAGG - Intronic
931572442 2:63682567-63682589 AAGAGTTATTGGCCTTAAAGAGG + Intronic
931600629 2:63999702-63999724 AAGAGTTATTGTCTGTAAAGAGG - Intronic
932101324 2:68901904-68901926 AAGATTTGTTGGCCTCAAAGAGG + Intergenic
932858607 2:75265497-75265519 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
932889706 2:75581496-75581518 AAGACTTATTGGTCTTAAAGAGG + Intergenic
932920974 2:75915284-75915306 AAGAGGCATTGGCCTTAAAGAGG - Intergenic
933227361 2:79766640-79766662 AAGAATTAATGGCCTTAAAGAGG - Intronic
933338328 2:80988326-80988348 AAGGGTTATTGGCTTTAAAGAGG + Intergenic
933601156 2:84331782-84331804 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
933617986 2:84504014-84504036 AACAGTTATTGGCCTAAAAGAGG - Intergenic
934870758 2:97862763-97862785 AAGAGTTAATGGCCTTAAAGAGG + Intronic
935078426 2:99769101-99769123 AAGAATTGTTGGCCTTAAAGAGG - Intronic
935437707 2:103054742-103054764 AAAAGTTATTGGCCTTAAAGAGG - Intergenic
935478438 2:103555613-103555635 AAGAGCTATTGGCTTTAAAGAGG - Intergenic
935751099 2:106234610-106234632 AAGAGTTGTTGGCCTTAAAGAGG + Intergenic
936511083 2:113147899-113147921 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
936778057 2:115997845-115997867 AAGGGTTATTCGCCTTAAAGAGG - Intergenic
936794798 2:116192487-116192509 AAGAGTTATTGGTCTTAACGAGG - Intergenic
937591391 2:123616821-123616843 AAGAGTTATTGGTCTTAAAGAGG + Intergenic
938177779 2:129151974-129151996 AAGCATTAATGGCCTTAAAGAGG - Intergenic
939257073 2:139758356-139758378 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
939443031 2:142274578-142274600 AAGAGTTATTGGTCTTGAAGAGG - Intergenic
939913184 2:148007599-148007621 AAGAGTTACTGGCCTTAAAGAGG + Intronic
940425556 2:153527071-153527093 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
940443786 2:153752858-153752880 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
940503607 2:154526023-154526045 AAGAGTTATTGCCCTTAAAGAGG - Intergenic
940629523 2:156220293-156220315 AACACTTATTGACTCTAAAGGGG + Intergenic
940730698 2:157387074-157387096 AAGATTTATTGGCCTTAAAAAGG + Intergenic
940738647 2:157481686-157481708 AAGAGTTACTGGCCTTAAAGAGG + Intronic
940803205 2:158155617-158155639 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
940947930 2:159638782-159638804 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
941153969 2:161952761-161952783 AAGAGTTATAGGCCCAATAGGGG - Intronic
941227825 2:162870082-162870104 AAGAATTATTGGCCCTGAAGAGG + Intergenic
941559675 2:167029097-167029119 ATGACTTAATGGTCTTAAAGAGG + Intronic
941672406 2:168309248-168309270 AAGAGTTGTTGGGCTTAAAGAGG - Intergenic
941678769 2:168372617-168372639 AAGAGTTTTTGGCTTTAAAGAGG + Intergenic
942352500 2:175066953-175066975 AAGAGTTATTGTCCTTATAGAGG + Intergenic
942391618 2:175501079-175501101 AAGAGTTATTGACCTTAAAGAGG - Intergenic
942750293 2:179278830-179278852 AAGAGGTATTGGTCTTAAAGAGG + Intergenic
942769274 2:179496371-179496393 AAGAGTTATTGGCCTTAAAGGGG + Intronic
942814142 2:180032537-180032559 AAGAGTTTTTGGACATAAAGAGG - Intergenic
942846051 2:180426886-180426908 AAGTATTATTGGCCTGAAAGAGG + Intergenic
942862970 2:180637582-180637604 AAGAGTTATTGGCCTTAAAGGGG + Intergenic
942915165 2:181296014-181296036 AAGAGTTATTGACCTTAAAGAGG + Intergenic
943128066 2:183821247-183821269 AAGAGTAATTGACCTTAAAGAGG + Intergenic
943208026 2:184926617-184926639 AAGAGTTTTTGGCCTTAAATAGG - Intronic
943226626 2:185186544-185186566 AAGAGATATTGGCCTTAATGTGG - Intergenic
943237083 2:185336668-185336690 AACAGTTATTGGCCTCAAAGAGG - Intergenic
943309876 2:186312156-186312178 AAGAGTTATTAGCCTTAAATAGG + Intergenic
943331300 2:186562510-186562532 AAGAGATATTAGCCTTAAAGAGG + Intergenic
944005112 2:194895634-194895656 AAGAGTAATTGGCCTTAAAGAGG - Intergenic
944021503 2:195110755-195110777 GAGATTCATTGGCCTTAAAGAGG - Intergenic
944377169 2:199059117-199059139 AAGAGATATTGGCCTTAAAGAGG + Intergenic
944760615 2:202809870-202809892 AAGAGTTATTGGCTTTAAAGAGG + Intronic
944963193 2:204900223-204900245 AAGAGTTATTGGCCTTAAAGAGG - Intronic
944990336 2:205228718-205228740 AAGAGTTATTGGCCTTAAAGAGG - Intronic
945454216 2:210031210-210031232 AATACTTAATTGCCATAAAGTGG + Intronic
945575829 2:211526975-211526997 AAGAGTTATTGGCCTTAATGAGG + Intronic
945739542 2:213643621-213643643 AAGAGTTATTGGCCATAAAGAGG - Intronic
946508913 2:220333535-220333557 AGGAGTTATTGGCCTTAAAGAGG - Intergenic
946984881 2:225259792-225259814 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
946994950 2:225380852-225380874 AAGACTTATTTGCAGTAATGAGG + Intergenic
947008976 2:225545298-225545320 AAGAGTGATTGGCCTTAAAGAGG - Intronic
947505060 2:230702150-230702172 AAGAGTTGCTGGCCTTAAAGAGG - Intergenic
947686975 2:232096532-232096554 ACGAGTTATTGGCTTTAAAGAGG - Intronic
947892897 2:233642119-233642141 AATAGTTATTGCCCATAAAGTGG - Intronic
948475322 2:238214970-238214992 CAGAGTTATTGTCCTTAAAGAGG - Intergenic
1168743978 20:220310-220332 AAGAGTTATTGGTCTTAAAGAGG + Intergenic
1168899827 20:1353971-1353993 AAGAGTTACTGGCCATAAAGAGG - Intronic
1168917061 20:1498713-1498735 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1169617758 20:7469663-7469685 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1169628847 20:7602111-7602133 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
1170086789 20:12543052-12543074 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1170668546 20:18407961-18407983 AAGAGTATTTGGCCTTAAAGAGG + Intronic
1171819548 20:29821972-29821994 AAGTGTTATTGGCCTTAAAGAGG - Intergenic
1171898283 20:30831210-30831232 AAGAGTTATTGGTCTTAAAGAGG + Intergenic
1172419177 20:34799364-34799386 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1172825878 20:37785374-37785396 AATAGTTACTGGCCTTAAAGAGG - Intronic
1173127057 20:40346998-40347020 AAGAGTTATTGGCCTTTAAAAGG + Intergenic
1174691032 20:52504747-52504769 AAGAGTTATTGACATTAAAGAGG + Intergenic
1174831636 20:53818912-53818934 CTGAGTTATTGGCCTTAAAGAGG - Intergenic
1174938735 20:54899932-54899954 AAGAATTATTGGCCTTAAAGAGG + Intergenic
1175410581 20:58765180-58765202 AAGACTTACTGGCCATTAGGAGG + Intergenic
1175632006 20:60549003-60549025 AAGAATTATTGGCCTTAAAGAGG - Intergenic
1176737338 21:10562794-10562816 AAGTGGTATTGGCCTTAAAGAGG + Intronic
1176917734 21:14646044-14646066 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1176935055 21:14858022-14858044 AAGACTTATTGGCAGAGAAGAGG - Intergenic
1177023925 21:15897510-15897532 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1177121907 21:17147556-17147578 AAAAGTTATTGGTCTTAAAGAGG + Intergenic
1177401218 21:20607265-20607287 GCAACTTATTGGCCTTAAAGAGG + Intergenic
1177456485 21:21345645-21345667 AAGAGTTATTGTCCTTAAAAAGG + Intronic
1177592373 21:23186851-23186873 AAGAGTGACTGGCCTTAAAGTGG + Intergenic
1177771490 21:25520759-25520781 AAGAGTTATTGGCCTTAAAGGGG + Intergenic
1177970228 21:27779543-27779565 AAGAATGACTGGCCATAAAGAGG + Intergenic
1178503822 21:33147151-33147173 AAGACATATTTGACCTAAAGTGG + Intergenic
1179232857 21:39520722-39520744 AATAGTTATTAGCCTTAAAGAGG - Intergenic
1179396006 21:41040469-41040491 AAGTGTTATTGGCCTTAAAGAGG + Intergenic
1180323532 22:11346666-11346688 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1180563341 22:16640331-16640353 AAGTGGTATTGGCCTTAAAGAGG + Intergenic
1182178889 22:28323647-28323669 AAGAGTTATTAGCCTTAAAGAGG + Intronic
1183531785 22:38359803-38359825 AAGTGGTATTGGCCTTAAAGAGG - Intronic
1184862679 22:47183203-47183225 AAGAGTTATTGACCTTACAGAGG + Intergenic
949428675 3:3948145-3948167 AACAGTTATTGGCCTTAAAGAGG - Intronic
949448326 3:4160168-4160190 AAGAGTTATTGGCCTTAAAGAGG - Intronic
949452673 3:4204591-4204613 AAGAGTTACTGGCCTTAAAGAGG - Intronic
949622929 3:5836428-5836450 AAGAGTAATTGGCCTTAAAGAGG - Intergenic
950800498 3:15548270-15548292 AAAAGTTATTGGCCCTAAAGAGG - Intergenic
951032070 3:17894026-17894048 AAGATTTATTGGCCTTAAAGAGG - Intronic
951125122 3:18975564-18975586 AAGAGATATTGGCTTTAAAGAGG - Intergenic
951255166 3:20440100-20440122 GAGATTTATTGGCCTTAAAAAGG + Intergenic
951259739 3:20494022-20494044 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
951375921 3:21917084-21917106 AAGAATTATTATCCCTAAAATGG + Intronic
951392819 3:22128488-22128510 AAGAGTTATTGATCTTAAAGAGG - Intronic
951435291 3:22656015-22656037 AAAAGTTATTGGCCTTTAAGAGG - Intergenic
951436807 3:22675027-22675049 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
951494842 3:23315065-23315087 AAGAGTTACTGCCCTTAAAGAGG - Intronic
951929627 3:27950820-27950842 AATAGTTATTGGCCTTAAAGAGG - Intergenic
951972930 3:28468342-28468364 AACAGTTATTGGCCTTAAAGAGG + Intronic
952139660 3:30464757-30464779 AAGAGTTGTTGGCCTTAAAGAGG - Intergenic
952202968 3:31150267-31150289 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
952566978 3:34670541-34670563 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
952676906 3:36043520-36043542 AAGAGTTATTGGCCTTGAAAAGG - Intergenic
952811670 3:37409830-37409852 AAGATTTATTGGCCTTAAAGAGG - Intronic
953088340 3:39696941-39696963 ATGAGTTATTGGCCTTAAAATGG + Intergenic
953217384 3:40932136-40932158 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
953309286 3:41861754-41861776 AAACGTTATTGGCCTTAAAGAGG - Intronic
953362260 3:42308236-42308258 AAGAGTTATTGGCCTTGAGGAGG - Intergenic
953375362 3:42423713-42423735 AAGGCTTATTGGTCCTGAATGGG - Intergenic
953722847 3:45371269-45371291 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
955274187 3:57531946-57531968 AAGAGTAATTGGCCTTAAAGAGG - Intronic
955585045 3:60469264-60469286 AAGAGTTATTGGCCTTAAAGAGG - Intronic
956476291 3:69623274-69623296 AAGAACAATTGGCCTTAAAGAGG + Intergenic
957087410 3:75693983-75694005 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
957537840 3:81529942-81529964 AAAAGTGATTGGCCTTAAAGAGG - Intronic
957672425 3:83323012-83323034 AACACTTATTGACCTTAAAGAGG - Intergenic
957745622 3:84338703-84338725 AAAAGTTATTGGCCTTAAACAGG - Intergenic
957753967 3:84463037-84463059 AAGAGTTATTGGCTCTAAAAAGG + Intergenic
957925621 3:86806545-86806567 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
957966296 3:87324987-87325009 AAGAGTTATTGGCCTTTAAGAGG + Intergenic
957976014 3:87446327-87446349 AAGATATATTGGCCTTAAAGAGG - Intergenic
957976020 3:87446438-87446460 AAAAGATATTGGCCTTAAAGAGG - Intergenic
957977256 3:87462175-87462197 ATGAAATATTGGCCTTAAAGAGG + Intergenic
958078515 3:88714211-88714233 AAGAATTGTTGGCTTTAAAGAGG + Intergenic
958154216 3:89731879-89731901 AAGAGTTATTGACCTTATAGAGG + Intergenic
958617698 3:96516191-96516213 AAGAGTTATTGGCCTTAACGAGG + Intergenic
958631044 3:96684417-96684439 AAGAGTTATTGGCCTTCAAGAGG - Intergenic
958683007 3:97354635-97354657 AAGAATTATTGGCCTTAAAGAGG + Intronic
959113567 3:102149562-102149584 AAGAGTAATTGGCCTTAAAGAGG + Intronic
959191296 3:103114456-103114478 AAGAGTTCTTGGCCATTAAGAGG + Intergenic
959216001 3:103450762-103450784 AAGAGCTATTGACCCTAAAAAGG + Intergenic
959414184 3:106063297-106063319 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
959646104 3:108703584-108703606 AGGAGTTATTGGCCTTAAAGAGG - Intergenic
959724843 3:109531873-109531895 GAGAATTATTGACCTTAAAGAGG - Intergenic
959766408 3:110035429-110035451 AAGAATTATTGGCATTCAAGAGG - Intergenic
959797962 3:110455777-110455799 AAGAGTTTTTGACCTTAAAGGGG - Intergenic
959841871 3:110985529-110985551 AAGAGTTATTGGCTTTAAAAAGG + Intergenic
959868373 3:111298650-111298672 AAGAGTTACTGACCTTAAAGAGG - Intronic
960095320 3:113684467-113684489 AAGAGTTATTGGTCTTAAAGAGG - Intronic
960565117 3:119124697-119124719 AAGAGTTATTGGCGTTAAAGAGG + Intronic
960792415 3:121448125-121448147 AAGAGTTATTGGCCTTAAAGAGG - Intronic
961986411 3:131139420-131139442 AAGAGTTATTGGCCTTAAAGAGG + Intronic
962015336 3:131433272-131433294 AAAAGTTATTGGTCTTAAAGAGG + Intergenic
962078568 3:132113138-132113160 AAGAGTTATTGGTCTTAAAGAGG - Intronic
962143534 3:132816448-132816470 AAGATTTATTGGCCTAAAAGAGG - Intergenic
962193759 3:133338087-133338109 AAGAGTTATTGGCCTTAAAGAGG + Intronic
962483505 3:135818002-135818024 AAGATGTATTGGTCTTAAAGAGG + Intergenic
962584662 3:136830031-136830053 CAGAGTTATTGGCCTTAAAGAGG - Intronic
962688545 3:137870319-137870341 AACAGTTATTGGCCTTAAAGAGG + Intergenic
962767785 3:138581365-138581387 AAGAGTTATTGGCCTTAAAGAGG + Intronic
963310271 3:143701693-143701715 AAGAGTTATTGGCCTTAAAGAGG + Intronic
963330697 3:143911487-143911509 AAGAGTTATTGGCCTTAAGGAGG + Intergenic
963354677 3:144196474-144196496 AAGAGTTATTGGCTCGAAAGAGG - Intergenic
963365208 3:144325130-144325152 AACAGTTATTGTCCTTAAAGAGG + Intergenic
963434324 3:145248953-145248975 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
963515475 3:146302687-146302709 AAGAGTTATTGGACTAAAAGAGG + Intergenic
963528551 3:146445758-146445780 AAGAGTTATTTGTCCTAAAGAGG - Intronic
963591960 3:147271183-147271205 AAGAGTTATTGGCCTTGAAAAGG + Intergenic
963692429 3:148520804-148520826 AAGAGTTATTGACCTTAAAGAGG + Intergenic
963701577 3:148632304-148632326 AAGAGTTATTGTCCTTAAAGAGG + Intergenic
964059417 3:152504002-152504024 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
964179572 3:153866818-153866840 AAGAGTTCGTGGCCTTAAAGAGG + Intergenic
964239645 3:154576108-154576130 AAGAGTTATTGCCCTTAAAGAGG + Intergenic
964339148 3:155689809-155689831 AAAAGTTATTGGCCTTAAAGAGG + Intronic
964398270 3:156271295-156271317 AAGAGTTATAGGCCCTAAAAAGG - Intronic
964582720 3:158258657-158258679 AAGCGTTATTGGCCTTAAAGAGG - Intronic
964759157 3:160116968-160116990 ATGACTTACTGGCCTTATAGAGG + Intergenic
964804239 3:160589083-160589105 AAGAGTTATTGGCTTTAAAGAGG + Intergenic
964810257 3:160655512-160655534 AAGAGTGATTGGCCTTAAAGAGG + Intergenic
964961204 3:162428704-162428726 AAGAGTAATTGGCCTTAAAGAGG + Intergenic
965014419 3:163139029-163139051 AAGAGGTATTGGCCTTAAAGAGG - Intergenic
965026335 3:163305523-163305545 AAGAATTACTGGCTTTAAAGAGG + Intergenic
965044280 3:163553962-163553984 AAGAGTTATTGGCTGTAAAGAGG - Intergenic
965156069 3:165057366-165057388 CTGAGTTATTGGCCTTAAAGAGG + Intronic
965251015 3:166343925-166343947 AAGAGTCATTGGCCTTGAAGAGG + Intergenic
965257122 3:166427223-166427245 AAGAATTGTTGGGCTTAAAGTGG + Intergenic
965273859 3:166654771-166654793 AAGACTTACTGGCCTTAAAGAGG + Intergenic
965349204 3:167593214-167593236 AAGAGTTATTGGACTTAAAGAGG - Intronic
965358862 3:167711546-167711568 AAGAGTTACTGGCATTAAAGAGG + Intronic
965464509 3:169011129-169011151 AAGAGTTATTGGCCTTAAATAGG - Intergenic
965464526 3:169011360-169011382 AAGAGTTATTGGCCTCAAAGAGG + Intergenic
965526946 3:169730787-169730809 AAGAGCTATTAGCCTTAAAGAGG - Intergenic
965527037 3:169731829-169731851 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
965844750 3:172948013-172948035 AAGAGTTATTGGCTTTAAAGAGG + Intronic
965980473 3:174683289-174683311 AAGAATTATTGACCTTAAAGAGG + Intronic
966312835 3:178613916-178613938 AAGAGTTATTGTCCTCAAAGAGG - Intronic
966329155 3:178791511-178791533 AAGAGTTATTGGCCTTAAGGAGG + Intronic
966463756 3:180205546-180205568 AAGAGTGATTGTCCTTAAAGAGG + Intergenic
966468287 3:180257187-180257209 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
966491258 3:180530894-180530916 AAAAGTTATCAGCCCTAAAGAGG + Intergenic
967636776 3:191810355-191810377 AAGTGTTATTGGCATTAAAGAGG + Intergenic
967655703 3:192045368-192045390 GAGAATTATTGGCCTTGAAGAGG + Intergenic
967677657 3:192318614-192318636 AAGAGTTGTTGGCCTTAAGGAGG + Intronic
968004782 3:195234971-195234993 AAGAGTTACTGGCTTTAAAGAGG - Intronic
968218777 3:196917346-196917368 GAGAGTTATTGGTCTTAAAGAGG + Intronic
968428954 4:543629-543651 AAGAGTTATTGGCCTTTAAGAGG - Intergenic
970442714 4:16095818-16095840 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
970821696 4:20223645-20223667 AAGAGTTATTGGCATTAAAGAGG - Intergenic
971665015 4:29472253-29472275 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
971690500 4:29828192-29828214 ATTAGTTATTGGCCTTAAAGAGG + Intergenic
971914364 4:32849484-32849506 AAGACTTACTGGTTTTAAAGAGG - Intergenic
972103988 4:35460240-35460262 AAAAGTTACTGGCCTTAAAGTGG - Intergenic
972142984 4:35984525-35984547 AAGAGTAATTAGCCTTAAAGAGG + Intronic
972253998 4:37334089-37334111 AAGAATTGTTGGCATTAAAGAGG + Intronic
972270624 4:37508318-37508340 AAAAGTTATTGGTCCTAAAGAGG - Intronic
972468510 4:39382084-39382106 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
972843377 4:42957537-42957559 AAGAGTTATTGGCCTTAAAGTGG - Intronic
972856703 4:43115553-43115575 AAGAGTTACTGGTCTTAAAGAGG + Intergenic
972902574 4:43702726-43702748 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
972909711 4:43798971-43798993 AAGAGTTATTGGTGTTAAAGAGG + Intergenic
972960109 4:44444248-44444270 AACACTTCTTGGCCCTGAATCGG + Intronic
973852921 4:54978834-54978856 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
973919627 4:55672108-55672130 AGGAGCTATTGGCCTTAAAGAGG - Intergenic
974301181 4:60068767-60068789 AAGAGTTATTGGACTTAAAGAGG + Intergenic
974414815 4:61593918-61593940 AAGAGTTATTGTCTTTAAAGAGG - Intronic
974469826 4:62303845-62303867 AAGAGCTATTGGCCTTAAAAAGG + Intergenic
974559380 4:63496790-63496812 AAGAGATATTGGCCTTAAAGAGG + Intergenic
974593105 4:63981956-63981978 AAGAGTTATTGACCTTAAAGAGG - Intergenic
974597096 4:64028759-64028781 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
974630113 4:64478468-64478490 AAGAATTATTGATCTTAAAGAGG - Intergenic
974893084 4:67905949-67905971 AAGAGTTTTTGGCCTTAAAGAGG - Intergenic
975026921 4:69560459-69560481 AAAAATTATTTGCCTTAAAGAGG + Intergenic
975252891 4:72199660-72199682 GAGAGTTATTGGCCTTAAAGAGG + Intergenic
975335640 4:73171948-73171970 AAAAGTTATTGGCCTTAAAGAGG + Intronic
975502097 4:75098651-75098673 AAGAGTTATTGACCTTAAAGAGG - Intergenic
975675078 4:76819803-76819825 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
975972064 4:80051339-80051361 AAGACATATTCTCTCTAAAGGGG - Intronic
976041244 4:80887109-80887131 AAGAATTATTGGCCTTAAAGAGG + Intronic
976082652 4:81373988-81374010 AAGAGTTATTAACCTTAAAGAGG - Intergenic
976171453 4:82309237-82309259 CAGAGTTATTGGCCTTAAAGTGG - Intergenic
976451647 4:85197936-85197958 AAGAGTTTTTGGCCTTAAAGAGG - Intergenic
976453774 4:85222257-85222279 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
976574417 4:86652855-86652877 AAGAATTATTGGCCTTAAAGAGG - Intronic
976722234 4:88179966-88179988 AAGAGTTATTGGCCTTAAAGAGG + Intronic
976728325 4:88238532-88238554 AAGAGTTATTGGCCTTAAAAAGG - Intergenic
976762668 4:88567394-88567416 AAGAGTTATTGGCCTTAAAGAGG - Intronic
977185055 4:93926415-93926437 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
977307622 4:95343971-95343993 AAGAGTTATTGGCCTTAAAGAGG + Intronic
977396892 4:96482882-96482904 AAGAGTTCTTGGCCTCAAAGAGG - Intergenic
977458509 4:97295350-97295372 AAGAGTTTTTGGCCTTAAGGAGG - Intronic
977502442 4:97858074-97858096 AAGAGTTATTGGCCATACAGAGG + Intronic
977812632 4:101374935-101374957 AAGAGTTGTTGGCCTTAAAAAGG + Intergenic
977873464 4:102122136-102122158 AAGAGTCATTGGCCTTAAAGAGG - Intergenic
977985787 4:103381202-103381224 AAGAGTCATTGGCCATATAGAGG + Intergenic
978031094 4:103940605-103940627 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
978037720 4:104016610-104016632 AATATTTAATGCCCCTAAAGAGG - Intergenic
978212507 4:106155494-106155516 AAGAGTTACTGGACTTAAAGAGG - Intronic
978297771 4:107227785-107227807 AAGAGTTATTGGCCTTACAGAGG + Intronic
978520234 4:109607999-109608021 AAGAGTTATTGGCCTTGAAGAGG - Intronic
978922267 4:114199352-114199374 AAGAATTATTAGCCTTAAAGAGG - Intergenic
979100112 4:116602464-116602486 AAGGGTTATTGTCCTTAAAGTGG - Intergenic
979111556 4:116763374-116763396 AAAATGTATTGGCCTTAAAGAGG + Intergenic
979142985 4:117201762-117201784 AAGAATTATTGGCCCAACAGAGG + Intergenic
979564908 4:122144282-122144304 AAGAGTTATTGGCCTCAAGGAGG - Intergenic
979913039 4:126395061-126395083 AAGAATTATTGACCTTAAAGAGG - Intergenic
979946001 4:126831733-126831755 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
980227077 4:130000189-130000211 AAAAGCTATTGGCCTTAAAGAGG + Intergenic
980442717 4:132869103-132869125 AAGAGTTATTGGCTTTAAAAAGG + Intergenic
980538489 4:134161309-134161331 AAGAGTTATTGGTTATAAAGAGG + Intergenic
980597084 4:134968171-134968193 AAGAGTTAGTGGCCTTAAAAAGG + Intergenic
980683084 4:136188729-136188751 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
980860145 4:138489584-138489606 AATACTTATTGGCACTAAGATGG - Intergenic
981140404 4:141260848-141260870 AAGAGTTATTGGCCTTTAAGGGG + Intergenic
981154789 4:141422211-141422233 AAGAGCTATTGGCCTTAAAGAGG - Intergenic
981203611 4:142013813-142013835 AAGAATTACTGGCCTTAAAGAGG - Intergenic
981297934 4:143154888-143154910 AAGAATTATTGGCTTTAAAGAGG - Intergenic
981394867 4:144235462-144235484 AAGAGTCATTGGCCTTAAAGAGG + Intergenic
981518083 4:145632616-145632638 AAGAGCTATTGGCCTTAAAGAGG - Intronic
981837096 4:149066517-149066539 AAGTGTTATTGACCTTAAAGAGG + Intergenic
981886386 4:149678059-149678081 AAGAATTATTGGTGCTTAAGAGG + Intergenic
981895818 4:149797449-149797471 AAGAGTTCTTGGCCTTAAAGAGG + Intergenic
981996323 4:150978918-150978940 GAGAGTTATTGTCCTTAAAGAGG + Intronic
982375008 4:154680439-154680461 AAGATTTATGGGACCTGAAGAGG - Intronic
983050386 4:163039272-163039294 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
983165797 4:164476207-164476229 ATGAGTTATTGGCCTTAAAGAGG - Intergenic
983389083 4:167104616-167104638 AAGAGTTATTGCCCTTAAAGGGG + Intronic
983456430 4:167970166-167970188 AAGAGTTATTGTCCTTAAAGAGG + Intergenic
983493297 4:168413763-168413785 AAGATTTATTGGCCTTAAAGGGG + Intronic
984310448 4:178051742-178051764 AAGAGTCATTGGCCCTAAAGAGG - Intergenic
984424784 4:179569359-179569381 AAGAATTATTGGCCTTAAAGAGG - Intergenic
985229658 4:187800753-187800775 AAGGGTTATTGGCCTTAAGGAGG + Intergenic
986046795 5:4045928-4045950 AAGAGGTATTAGCCCTAAAGAGG + Intergenic
986492898 5:8310229-8310251 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
986885062 5:12224645-12224667 AAAAGTTATTGGCCTTAAAGAGG - Intergenic
987823262 5:22992804-22992826 AAGAGTTGCTGGCCTTAAAGAGG + Intergenic
988236753 5:28556020-28556042 AAGAGTCATTGACCTTAAAGAGG - Intergenic
988340283 5:29961628-29961650 AAGAGTAATTGGCCTTAAAGAGG + Intergenic
988608162 5:32700307-32700329 AAGAGTTACTGGCCTTAAAGAGG - Intronic
988939577 5:36129136-36129158 AAGAGTTCTTGGCCTTAAAGAGG + Intronic
989083105 5:37646979-37647001 AAGAGTTATTGGCCTTAAAGAGG - Intronic
989504672 5:42214108-42214130 AAAAGTTATTGGCCCTACGGAGG - Intergenic
989690832 5:44142096-44142118 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
989970582 5:50520012-50520034 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
990853966 5:60241704-60241726 TAGAGTTATTGGCCATGAAGAGG + Intronic
990923645 5:60994802-60994824 AAGAGTTACTGGCCTTAATGAGG - Intronic
991169423 5:63603939-63603961 AAAAGTTATTGGCCTTAAAGAGG - Intergenic
991180429 5:63745394-63745416 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
991208929 5:64082635-64082657 GAGAATTATTGGCTTTAAAGAGG - Intergenic
991395076 5:66196826-66196848 AAGAGTTATTGACCATAAAGTGG - Intergenic
992291557 5:75284794-75284816 ACGACTCACTGGCCTTAAAGAGG + Intergenic
992345369 5:75870541-75870563 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
992692482 5:79254754-79254776 AAGAGTTATTGGCCTTAATGAGG - Intronic
992934693 5:81689251-81689273 AAGAGTTATTGGCTGTAAAGAGG + Intronic
993257221 5:85606642-85606664 AAGAGTCATTGGCTTTAAAGAGG + Intergenic
993269054 5:85769776-85769798 AAGAGTTATTGGTCTTTAAGAGG - Intergenic
993473677 5:88337412-88337434 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
993623490 5:90194553-90194575 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
993677493 5:90834757-90834779 AAGAGGTATTGGCCTTAAAGGGG - Intronic
994217680 5:97157728-97157750 TAGAGTTATTGGCCTTAAAGAGG - Intronic
994229405 5:97296658-97296680 AAGAGTTGTTGGCCTTAAAGAGG - Intergenic
994234052 5:97340923-97340945 AAGAATTATTGGCCTCAAAGAGG + Intergenic
994265102 5:97705654-97705676 AAGAGCTATTGGCTTTAAAGAGG + Intergenic
994319961 5:98382887-98382909 AAGAATTATTGGCCTTAAAGAGG - Intergenic
994428564 5:99626817-99626839 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
994457439 5:100029104-100029126 AAGATTTCTTGGTCTTAAAGTGG + Intergenic
994477463 5:100289324-100289346 AAGAGATACTGGCCTTAAAGAGG - Intergenic
994531091 5:100972209-100972231 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
994538555 5:101062926-101062948 CAGAGTTATTGACCTTAAAGAGG - Intergenic
994633788 5:102319360-102319382 AAGAGTTATTGGCCTTAAAAAGG - Intergenic
994660174 5:102643348-102643370 AAGAGTTATTGACCTTAAAAAGG + Intergenic
994845574 5:104985281-104985303 AAGAGTTATTGGTCTTAAAAAGG - Intergenic
994893409 5:105669078-105669100 GAGAGTTATTGGCCTTAAAGAGG - Intergenic
994974282 5:106781494-106781516 AAGAATCACTGGCCTTAAAGAGG + Intergenic
995268486 5:110193557-110193579 AAGAGTTATTGGCCCTAAAGAGG - Intergenic
995432041 5:112090254-112090276 AAGAGTTATTGGCTTTAAAGAGG + Intergenic
995557721 5:113346252-113346274 AAGAGGTATTGGCCTTAAAGAGG + Intronic
995697616 5:114898178-114898200 AAGTGTTATTGGCCTTAAGGAGG - Intergenic
996116246 5:119623247-119623269 AAGAGTTGTTGGCCTTAAAGAGG - Intronic
996161797 5:120175156-120175178 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
996259476 5:121447634-121447656 GAGTGTTATTGGCCTTAAAGGGG + Intergenic
996906584 5:128607877-128607899 AGGAATTATTGGCCTTAAGGAGG - Intronic
996961357 5:129254208-129254230 AAGAGTTATTGACCTTAAAGAGG - Intergenic
996962326 5:129265975-129265997 AATAGTTATTGGCCTTAAAGAGG + Intergenic
996962514 5:129268567-129268589 AAGAGCTATTGACCTTAAAGAGG - Intergenic
997071839 5:130631926-130631948 AAGAATTATTGACCTTAAATAGG - Intergenic
997180436 5:131823300-131823322 AAGAGTTATTGGTCTTAAAGAGG - Intronic
997832839 5:137165943-137165965 AAGAGTTATTGGCCTTAAAGAGG + Intronic
997834775 5:137183395-137183417 GAAAGTTATTGGCCTTAAAGAGG + Intronic
998634189 5:143933863-143933885 AAGAGTTACTGGCCTTAGAGAGG + Intergenic
998639785 5:143996375-143996397 AGGAGTAATTGGCCCTTAAGTGG - Intergenic
998695383 5:144632253-144632275 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
999919349 5:156302120-156302142 AAGAGTTATTGGCCTTACAGAGG - Intronic
1000159694 5:158585417-158585439 AAGCATCATTGGCCTTAAAGAGG - Intergenic
1000271503 5:159688418-159688440 AAGAGTTATTGGTATTAAAGAGG + Intergenic
1000455109 5:161438934-161438956 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1000651154 5:163820758-163820780 AAGAGTTATTGGCCATAAAGAGG - Intergenic
1001177834 5:169488294-169488316 AAGAGGTATTGGCCTTAAAGAGG + Intergenic
1004795108 6:19073537-19073559 AAGAGTTATTGTCCAAAAAGAGG + Intergenic
1005037223 6:21568069-21568091 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1006018324 6:31101131-31101153 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1006088124 6:31611407-31611429 AATATTTATTGATCCTAAAGTGG - Intergenic
1006237263 6:32644836-32644858 AACACTTATGGGCCATAAGGAGG - Intronic
1006554010 6:34850468-34850490 AAGAATTATTGGCCTTAAGGAGG - Intronic
1006963908 6:37962375-37962397 AAGAGTTACTGGGCTTAAAGGGG + Intronic
1007001429 6:38317604-38317626 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1007863515 6:44940564-44940586 AAGACATATTGGACTTAAATTGG - Intronic
1008192542 6:48477051-48477073 AAGAGTTAATGGCCTTAAAGAGG + Intergenic
1008239075 6:49085944-49085966 AAGAGTTTTTGGCCTTAAAGAGG + Intergenic
1008250193 6:49230689-49230711 AAGAGTTATTGGCTTTAAGGTGG - Intergenic
1008312376 6:49991574-49991596 AAGAGTTATTGGCCTTAAAAAGG + Intergenic
1008785732 6:55165197-55165219 AAGAGTTACTGGCCTTAAAAAGG + Intronic
1008822393 6:55649692-55649714 AAGAGGTTTTGGCCTTAAAGAGG - Intergenic
1008882010 6:56389463-56389485 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1009783340 6:68298277-68298299 AAGAGTTATTGTCCTTAAATAGG + Intergenic
1009847183 6:69149146-69149168 AAGAGTTATTTTCCTTAAAGGGG - Intronic
1010264199 6:73850056-73850078 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1010474746 6:76273602-76273624 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1010514393 6:76755052-76755074 AAGAGTCATTGGCCTTAAAGGGG + Intergenic
1010560128 6:77339338-77339360 AAGAGTTACTGGCCTTTAAGAGG - Intergenic
1010626447 6:78141128-78141150 AAGAGTTATTGCTCTTAAAGAGG + Intergenic
1010676820 6:78755033-78755055 AAGAATTATTGGCCTCGAAGAGG + Intergenic
1010772655 6:79849144-79849166 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1010775513 6:79880314-79880336 AAGAGTTATTGGCCCTAAAGAGG + Intergenic
1010838996 6:80624863-80624885 AAGAGTTATTGGCCTTAAAAAGG + Intergenic
1010975697 6:82311274-82311296 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1011024102 6:82846974-82846996 AAGAGTTATTAGCCTTAAAGAGG + Intergenic
1011033374 6:82946037-82946059 AAGAGTTACAGGCCTTAAAGAGG + Intronic
1011102753 6:83742754-83742776 AAGAGTTATTGACCTTAAAGAGG - Intergenic
1011236194 6:85219685-85219707 AAGAGTTATTGGCCATAAAGAGG + Intergenic
1011271264 6:85581871-85581893 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1011291006 6:85777391-85777413 AAGAGTTATTGGTCTTAAAGAGG - Intergenic
1011333081 6:86232192-86232214 AAGAGTTATTGGCCATAAAGAGG - Intergenic
1011341142 6:86315267-86315289 AGGAGTTATTGGACTTAAAGAGG + Intergenic
1011386113 6:86800491-86800513 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1011791682 6:90905891-90905913 AAGAGTTATTGGACTTAAAGGGG - Intergenic
1011901509 6:92303596-92303618 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1012003774 6:93686466-93686488 AAAACTTGTTGGCCTTAAACAGG + Intergenic
1012224669 6:96690180-96690202 AAGAGTTATTGGCCTTGAACAGG + Intergenic
1012288234 6:97420359-97420381 AAGAGATATTGGCCTTAATGAGG - Intergenic
1012712592 6:102627549-102627571 AAGCGTTATTGGCCTTAAAGAGG - Intergenic
1012806950 6:103907106-103907128 AAGAGTTATTGGCCTTCAAGAGG - Intergenic
1012827511 6:104164367-104164389 AAGACTTATTGGCCTTAAAGAGG + Intergenic
1012892282 6:104909760-104909782 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1012940656 6:105411162-105411184 AAGAGTTGTTGGCCTTAAAGAGG + Intergenic
1013908714 6:115248115-115248137 AAGAGTTATTAGCCTTAAAGTGG + Intergenic
1013925461 6:115466906-115466928 AAGAGTTATTGGCCTCAAAGAGG - Intergenic
1014102041 6:117521964-117521986 ATGATTCATTGGCCCTATAGTGG - Intronic
1014118606 6:117696295-117696317 CTGAGTTATTGGCCTTAAAGAGG + Intronic
1014186744 6:118443858-118443880 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1014583209 6:123163309-123163331 AAGAATTATTGGCCTTAAAGAGG + Intergenic
1015030475 6:128588164-128588186 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1015460892 6:133489285-133489307 AAGAGTTATTGGCCTTAAACAGG + Intronic
1015578605 6:134700017-134700039 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1016054400 6:139564500-139564522 AAGAGTTATTGGTCCTAAAGAGG - Intergenic
1016185573 6:141194497-141194519 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
1016229969 6:141790647-141790669 AAGTGTTATTGGCCTTAAAGAGG + Intergenic
1016251726 6:142050568-142050590 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1016541658 6:145172179-145172201 AAGAGTTATTGGTCTCAAAGAGG + Intergenic
1016623645 6:146141498-146141520 AAGAGTTTTTGGCCTTAAAGAGG - Intronic
1016712534 6:147190143-147190165 AAGGCTTCTTGGCCCTAGTGTGG + Intergenic
1017243217 6:152194616-152194638 AAGACTTATTGGCCTTCAAAAGG - Intronic
1017387534 6:153903033-153903055 AAGAGTTATTGGTCTTAAAGAGG + Intergenic
1017398019 6:154026549-154026571 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1017491428 6:154948939-154948961 AAGACTTATTGGCCTTAAAGAGG - Intronic
1018917451 6:168145130-168145152 AAGAGTCGTTGGCCTTAAAGAGG - Intergenic
1020515172 7:9108424-9108446 AAAAGTTATTGGCCTTAAAGAGG + Intergenic
1020574668 7:9911826-9911848 AAGAGTTATTGGCCTTAAAGGGG - Intergenic
1020613100 7:10425839-10425861 AAGAGTTACTGGTCTTAAAGAGG - Intergenic
1020624397 7:10559506-10559528 AAGAGTTATTGGCCTTAAACAGG + Intergenic
1021123907 7:16827795-16827817 AAGAGTTATTGGCCTTAAGGAGG + Intronic
1021211952 7:17864537-17864559 ACGATTTATTGGCCTTAAAGAGG + Intronic
1021214420 7:17899422-17899444 AAGAGTTATTGTCCTTAAAGAGG - Intronic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1021641158 7:22737247-22737269 AAGAGTTATTGGACTTAAAGAGG + Intergenic
1021842843 7:24734828-24734850 AAGAGGTATTGGCCTTAAAGAGG + Intronic
1021884701 7:25127298-25127320 AAGAGTTACTGGCCATAAAGAGG - Intergenic
1022080391 7:27014113-27014135 ATGAGTTATTGGCCTTAAAGAGG + Intergenic
1022223417 7:28338729-28338751 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1022348419 7:29540591-29540613 AAGAGTTATTGGCCTCAAAGAGG + Intergenic
1023145520 7:37147008-37147030 AAGACCTTTTGAACCTAAAGGGG - Intronic
1023208791 7:37781014-37781036 AAGAGTTATTGGCCTTAATAAGG - Intronic
1024368891 7:48557910-48557932 AAGAGTTATTGACCTTAAAGTGG - Intronic
1024425289 7:49217858-49217880 AAAACTTATAAACCCTAAAGAGG + Intergenic
1024661089 7:51496072-51496094 AAGAGTTATTGGCCTCAAAGAGG - Intergenic
1024705724 7:51957877-51957899 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1025800102 7:64778773-64778795 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
1027524256 7:79246680-79246702 AAGAGTCATTAGCCTTAAAGGGG + Intronic
1027605065 7:80289491-80289513 AATAGTTATTGGCCTTAAAGAGG + Intergenic
1027808423 7:82860102-82860124 AATAGTTATTGGCCTTAAAGAGG + Intronic
1027826263 7:83120060-83120082 AAGAGTTATTGACTTTAAAGTGG + Intronic
1028001544 7:85503511-85503533 AAGAGTTATTGGCTTTAAAGAGG + Intergenic
1028169602 7:87580665-87580687 AAGAGTTATTGGCCTTAAATAGG - Intronic
1028281517 7:88935588-88935610 AAGACTTTCTGACCCTAATGTGG - Intronic
1028284505 7:88979826-88979848 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1028365404 7:90023506-90023528 AAGAGCTATTGGCATTAAAGAGG + Intergenic
1028521822 7:91740752-91740774 AAGAGTTATTGTCCTTAAGGAGG - Intronic
1028645506 7:93092326-93092348 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
1029042493 7:97592426-97592448 AAGAATTATTGGCCTTACAGAGG - Intergenic
1029797025 7:102907237-102907259 AAGAATTGTTGGCCTTAAGGAGG - Intronic
1029825479 7:103188164-103188186 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1030370311 7:108692758-108692780 AAGAGTTATTGACCTTTAAGAGG - Intergenic
1030390713 7:108924694-108924716 AAGAGTAATTGGCATTAAAGAGG - Intergenic
1030408129 7:109141348-109141370 GAGAGTTATTGGCCTTAAAGAGG - Intergenic
1030629495 7:111879959-111879981 AAGAGTTATTGGTCTTAAAGAGG + Intronic
1030723683 7:112899462-112899484 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1030752679 7:113249570-113249592 AAGAGTTATTGGCCATAAAGAGG + Intergenic
1030966474 7:115997984-115998006 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1030990486 7:116293065-116293087 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1031288163 7:119899090-119899112 AGCAGTTATTGGCCTTAAAGAGG - Intergenic
1031306449 7:120132543-120132565 CAGAATTATTGACCCTAAAGAGG + Intergenic
1031862452 7:126995744-126995766 AAGAGTTCTTGGCCTTAAAGAGG + Intronic
1033500075 7:141938514-141938536 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1033541813 7:142364265-142364287 AAGAGTTATTGACCTTAAAGAGG - Intergenic
1033867615 7:145712250-145712272 AAGAGTTATTGGCATTAAAGAGG - Intergenic
1033877494 7:145841042-145841064 AAGCGTTATTAGCCTTAAAGAGG - Intergenic
1033882303 7:145901155-145901177 AAGAGTTATTGGCCTTAATCAGG - Intergenic
1034019066 7:147620773-147620795 AAGAGTTATTGGCCATAAAGAGG + Intronic
1034126385 7:148675414-148675436 AACAGTTATTGGCCTTAAAGAGG + Intergenic
1034126634 7:148677423-148677445 AAGAGTTATTGGCCTTAGAGAGG + Intergenic
1034398246 7:150843893-150843915 AAGAGTTGTTGGCCTTAAAGAGG + Intronic
1035084350 7:156245556-156245578 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
1035139255 7:156740279-156740301 AAGAGTTATTGGCAGCAAAGAGG + Intronic
1037295824 8:17398582-17398604 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1037366709 8:18129978-18130000 AAGATTTATTGGCCTTAAAGAGG + Intergenic
1039002175 8:32994068-32994090 CAGAGTTATTGGCCTTAAAGAGG - Intergenic
1039281724 8:35993303-35993325 AAGACTTAATGGACTTAGAGAGG - Intergenic
1039640622 8:39217473-39217495 AGGAGTTATTGGCCTTAAAGAGG - Intronic
1039647303 8:39301989-39302011 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1040511286 8:48098505-48098527 AAGACTTACTGGCCTTAAATAGG - Intergenic
1041140967 8:54819079-54819101 AAGAGTTATTGGTCTTAAAAAGG - Intergenic
1041851758 8:62401043-62401065 AAGAGTTCTTGGCCTTAAAGAGG - Intronic
1042082377 8:65069698-65069720 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1042428356 8:68674677-68674699 AAGAGTTATTGAACTTAAAGAGG + Intronic
1043015798 8:74939345-74939367 AAGAGTTATTGCCCTTAAAGAGG - Intergenic
1043042239 8:75277437-75277459 AAGAGTTACTGGCCTTCAAGAGG + Intergenic
1043134047 8:76499404-76499426 CAGAGTTATTGGCCTTAAAGAGG - Intergenic
1043311847 8:78870590-78870612 AAAAGCTATTGGCCTTAAAGAGG - Intergenic
1043367054 8:79544716-79544738 AAAAGTTATTGGCCTTAAAGAGG + Intergenic
1043554157 8:81410538-81410560 AAGAGCTATTGGCCTTAAAGAGG + Intergenic
1043600390 8:81929848-81929870 AAGAGTTATTGGCCTTACAGAGG + Intergenic
1043627152 8:82275254-82275276 AAGAGTTAATGACCTTAAAGTGG + Intergenic
1043760399 8:84061581-84061603 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1043945805 8:86251297-86251319 AAGAGTTATTGGCCTTAAATAGG - Intronic
1044192861 8:89340837-89340859 AAGAGTTATTGGCTTTAAAGAGG - Intergenic
1044395050 8:91701708-91701730 AAGAGCTATTGGTCTTAAAGAGG - Intergenic
1044635308 8:94318339-94318361 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
1045041117 8:98225825-98225847 AAGAGTTATTGGCCTTAAAGAGG - Intronic
1045147820 8:99367607-99367629 AAGAGTTATTTGCCTTAAAGTGG - Intronic
1045207607 8:100058232-100058254 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1045590120 8:103583804-103583826 AAGTGTTATTGTCCTTAAAGAGG + Intronic
1045777287 8:105820827-105820849 AAGAGTTCTTGGCCTTAAAGAGG - Intergenic
1046169571 8:110487100-110487122 AAGAGTTATTGGTCTTTAAGAGG + Intergenic
1046228354 8:111316967-111316989 AAGAATTATTGTCCCTAGGGTGG + Intergenic
1046267831 8:111854523-111854545 AAGAGTTACTGGACTTAAAGAGG + Intergenic
1046335602 8:112782471-112782493 AAGAGTTATTGCCTTTAAAGAGG + Intronic
1046448549 8:114358024-114358046 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1047185083 8:122625817-122625839 AAAATTTATTGGCCCAGAAGAGG + Intergenic
1047342603 8:123997624-123997646 GAGAATTATTGGCCTCAAAGAGG - Intronic
1047352241 8:124087192-124087214 AAGAGTTACTGGCCTTAAAGAGG - Intronic
1047901277 8:129424623-129424645 AAGATTTATTGGCCATAAAGTGG + Intergenic
1050121769 9:2315522-2315544 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1050145378 9:2561537-2561559 AAGAGTTACTGGCCTTAAAAGGG + Intergenic
1050248340 9:3715110-3715132 AAGAGTTTTTGACCTTAAAGAGG + Intergenic
1050356139 9:4784177-4784199 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1050439073 9:5641535-5641557 AAGAGGTATTGGCCTTAAAGAGG - Intronic
1051465353 9:17370085-17370107 AGGAGTTATTGGCCTTAAACAGG + Intronic
1051704499 9:19861975-19861997 AAGAGTTATTGGCCTTTGAGAGG + Intergenic
1051923621 9:22297604-22297626 AAGAGTTATTGACCTTAAAGAGG - Intergenic
1051992239 9:23164952-23164974 AAGAGTTATTGGGCTTAAAGAGG + Intergenic
1052063487 9:23988538-23988560 CTGAATTATTGGCCTTAAAGAGG + Intergenic
1052258588 9:26489138-26489160 AAGAGTTACTGGCGTTAAAGAGG - Intergenic
1052420403 9:28235857-28235879 AAGAGTTATTGACCGTAAGGAGG + Intronic
1052585883 9:30426737-30426759 AAGAGTTATTGGCTTTAAAGAGG + Intergenic
1052607613 9:30724519-30724541 AAGAGTTATTGACCTTAAAGAGG + Intergenic
1052733068 9:32312052-32312074 GAGAGTTATTGGCATTAAAGAGG + Intergenic
1053110437 9:35455113-35455135 GAGAGTTATTGGCCTTAAACAGG + Intergenic
1053171000 9:35883340-35883362 CAGAGATATTGGCCCTTAAGCGG + Intergenic
1053204838 9:36177156-36177178 AACAGTCATTGGCCTTAAAGAGG + Intergenic
1053750859 9:41253008-41253030 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
1054256374 9:62817350-62817372 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1054334935 9:63798263-63798285 AAGAGTCATTGGCCTTAAAGAGG - Intergenic
1054956410 9:70915765-70915787 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1054982759 9:71224989-71225011 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1055181060 9:73387607-73387629 AAGAGATATTGACCTTAAAGAGG - Intergenic
1055910983 9:81350917-81350939 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1056339005 9:85605017-85605039 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1057288893 9:93787431-93787453 GAGAGTTATTGGCCTTAAGGAGG - Intergenic
1058248935 9:102668009-102668031 AAGAATTATTGGCCATAGAGAGG - Intergenic
1058522655 9:105827684-105827706 AAGACTTATTGGCCTTAAAGTGG - Intergenic
1058665750 9:107313832-107313854 CAGACTTACTGGGCCAAAAGAGG - Intronic
1058767968 9:108200228-108200250 AAGAGCTATTGGCCTTAAAGAGG + Intergenic
1059041960 9:110824172-110824194 AAAAGTTATTGGCCTTAAATAGG + Intergenic
1059094783 9:111400796-111400818 AAGAGTTATTTGCCTTAAAGAGG + Intronic
1059515559 9:114891016-114891038 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1059555283 9:115274796-115274818 AAGAGTTATTGGCCTTAACGAGG - Intronic
1060126971 9:121056753-121056775 AAGAGTTACTAGCCTTAAAGGGG + Intergenic
1060166520 9:121421630-121421652 AAGAGTTGCTGGCCTTAAAGAGG - Intergenic
1060623435 9:125088854-125088876 AAGACTTATTTGGCCCAAAATGG - Intronic
1061915403 9:133750122-133750144 AAGAGTTATTAGCCTTGAAGAGG - Intergenic
1062739507 9:138160858-138160880 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1203371213 Un_KI270442v1:307239-307261 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1186911457 X:14172491-14172513 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1186994653 X:15106933-15106955 AAGAATTATTGGCATTCAAGAGG - Intergenic
1187133016 X:16520176-16520198 AAGAGGTATTGGCATTAAAGAGG + Intergenic
1187315054 X:18185181-18185203 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1187613040 X:20962787-20962809 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1187889315 X:23919182-23919204 AAGAATTATTGGCCCTAAAAAGG - Intronic
1188068632 X:25693340-25693362 AAGAATTATTGGCCTTAAAGAGG - Intergenic
1188071596 X:25725146-25725168 AAGAATTACTGGCCTTAAAGAGG - Intergenic
1188161678 X:26812895-26812917 AAGAGTTATTGGCCTCAGAGAGG - Intergenic
1188210794 X:27420831-27420853 AAGTGTTATTGGCCTTAAAGAGG + Intergenic
1188579088 X:31687995-31688017 AAGAGTTATTGGCCTTAAACAGG - Intronic
1188716173 X:33462527-33462549 AAGAGTCATTGGCCTTAAGGAGG - Intergenic
1188733880 X:33687553-33687575 CTGAGTTATTGGCCTTAAAGAGG - Intergenic
1188814341 X:34693055-34693077 AAGAGTTACTGGCCTAAAAGAGG - Intergenic
1188815151 X:34704305-34704327 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
1188840531 X:35011530-35011552 AAGAATTATTGGCCATAAAGAGG + Intergenic
1188854093 X:35170928-35170950 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1188924457 X:36022582-36022604 AAGAGTTACTGCCCTTAAAGAGG - Intergenic
1188930056 X:36097923-36097945 AAGAGTTACTGGCCTTACAGAGG - Intronic
1188972147 X:36631390-36631412 AAGAGTTATTGGCCTTAAACAGG - Intergenic
1188996267 X:36889221-36889243 AAGAGTTATTGGGCTTAAAAAGG + Intergenic
1189019753 X:37321863-37321885 AACATTTATTGGCCATAAAGAGG + Intergenic
1189628365 X:42923001-42923023 AAGAGTTATTGGTCTTAAAGGGG + Intergenic
1189640970 X:43069640-43069662 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1189690343 X:43611414-43611436 AAGAGTTATTGGCTTTAAAGTGG - Intergenic
1189769900 X:44415334-44415356 TAGGGTTATTGGCCTTAAAGAGG - Intergenic
1189868636 X:45359117-45359139 AAGAGTTATTTGCCTTAAAGAGG - Intergenic
1189870194 X:45373101-45373123 AAGAGTTATTGACCTTAAAGAGG + Intergenic
1189875497 X:45432353-45432375 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1189881327 X:45496658-45496680 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1190015303 X:46821341-46821363 AAGAGCTATTGGCCTTAAAGAGG + Intergenic
1190038043 X:47044054-47044076 AAGAATGACTGGCCTTAAAGAGG + Intronic
1190046496 X:47115326-47115348 AAAAGTTATTGGCCTTAAAAAGG + Intergenic
1190485335 X:50917986-50918008 AAGACTTACTGGCCCCTTAGGGG - Intergenic
1190498492 X:51052231-51052253 AAGAGTCATTGGCCTTAAAGAGG + Intergenic
1190507749 X:51144401-51144423 AAGAGTCATTGGCATTAAAGAGG - Intergenic
1190523252 X:51301003-51301025 GAGAGTTATTTGCCTTAAAGAGG + Intergenic
1190907728 X:54744988-54745010 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
1190911857 X:54778663-54778685 AAGAGTTAGTGGCCCTAATGAGG + Intronic
1190919396 X:54837890-54837912 AAGAGTTAGTGGCCCTAAAAAGG - Intergenic
1191030726 X:55967146-55967168 AAAAGTTATTGGCCTTAAAGGGG + Intergenic
1191116588 X:56859149-56859171 AAGGGTTATTGGCCTTAAAAAGG - Intergenic
1191198759 X:57753848-57753870 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1191589305 X:62863371-62863393 GAGATATATTGGCCATAAAGAGG - Intergenic
1191646783 X:63489913-63489935 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1191774976 X:64803720-64803742 AAGATTTATTGGACTTAATGTGG + Intergenic
1191781716 X:64875500-64875522 AAGAGTTATTGACCTTAAAGAGG + Intergenic
1191800100 X:65069238-65069260 AACAGTTATTGGCCTTAAAGAGG - Intergenic
1191813536 X:65217830-65217852 AAGAGCTATTGGCCTTAAAGAGG + Intergenic
1191827079 X:65377295-65377317 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1191950010 X:66580403-66580425 AAGAGTTATTGGTCTTAAAGAGG - Intergenic
1191973990 X:66850090-66850112 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1192002679 X:67171960-67171982 AAGACTTATTAGTCTTAAAGAGG - Intergenic
1192027348 X:67467818-67467840 AAGAGTTATTGGCTGTAAAGAGG + Intergenic
1192062320 X:67840240-67840262 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1192073339 X:67963787-67963809 AAGAGTTATTGGCCTTATAAAGG + Intergenic
1192088200 X:68122878-68122900 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1192400397 X:70828620-70828642 AAGATCCATTGGCCTTAAAGAGG + Intronic
1192672498 X:73160530-73160552 AAGAGTTATTCGCTTTAAAGAGG - Intergenic
1192680103 X:73243408-73243430 AAGAGTTACTGGCCTTAAAAAGG + Intergenic
1192714613 X:73626406-73626428 AAGAGTTATTGGCCTTAAAAAGG - Intronic
1192836293 X:74803093-74803115 ATGAATTACTGGCCTTAAAGAGG + Intronic
1192858329 X:75038516-75038538 AAGAGATAATGGCCCTGAAGAGG - Intergenic
1192887764 X:75354458-75354480 AAGTGTTATTAGCCTTAAAGAGG - Intergenic
1192891095 X:75391250-75391272 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1192959447 X:76111762-76111784 AAGAGTCATTGGCCTTAAAAAGG + Intergenic
1192968405 X:76204959-76204981 AAAAGTTATTGGCCTTAAAGAGG - Intergenic
1192992765 X:76479301-76479323 AAGAGTTATTGGCTTTAACGAGG - Intergenic
1193003944 X:76595257-76595279 AAGACTTATTGGCCTTAAAAAGG - Intergenic
1193078889 X:77384562-77384584 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1193088583 X:77469590-77469612 AAGAATTATTGGCCTTAAACAGG + Intergenic
1193092745 X:77511851-77511873 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1193163389 X:78255550-78255572 AAGAGTTACTGGCCTTAAAGAGG - Intergenic
1193185216 X:78503450-78503472 AGGAGTTATTGGCTTTAAAGAGG + Intergenic
1193192688 X:78591408-78591430 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1193204691 X:78734982-78735004 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1193243120 X:79196131-79196153 AAGAGTAATTGGCCTTAAAGAGG + Intergenic
1193246011 X:79231023-79231045 AAGAGTTATTGACCTTGAAGAGG - Intergenic
1193247502 X:79245870-79245892 AAGAGTTATTGGTCATAAAGAGG + Intergenic
1193252708 X:79310595-79310617 AAGAGTTATTGGCCTTGAAAAGG + Intergenic
1193260959 X:79405545-79405567 AAGAGGTATTGGCTTTAAAGAGG + Intergenic
1193366052 X:80635719-80635741 AAGAATTATTGGCCTTTAAGAGG - Intergenic
1193447698 X:81624808-81624830 CAGAATTATTAGCCTTAAAGAGG - Intergenic
1193487209 X:82101377-82101399 AAGAGTTATTGGCCTGAAATAGG - Intergenic
1193488173 X:82114015-82114037 AAAATTTATTGGCCTTAAAGAGG - Intergenic
1193504822 X:82329300-82329322 AAGAGTTATTGGCCTTAAAAAGG - Intergenic
1193528866 X:82628608-82628630 GAGACTTATTGGCCTTAGAGAGG + Intergenic
1193665575 X:84311502-84311524 AAGGATTATTGGCCTTAAAGAGG + Intergenic
1193683584 X:84551578-84551600 AAGAGTCACTGGCCTTAAAGAGG - Intergenic
1193691819 X:84655477-84655499 AAGAGTTATTGCCCATATAGAGG - Intergenic
1193738047 X:85184439-85184461 AAGAGTTACTAGCCTTAAAGAGG - Intergenic
1193742513 X:85233821-85233843 AAGAATTATTGGTCTTAAAGAGG + Intergenic
1193756598 X:85417160-85417182 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1193856396 X:86609083-86609105 AGGAGTTATTGGCATTAAAGAGG - Intronic
1193899478 X:87160023-87160045 AAGAGTTATTGGTCTTAAAGAGG - Intergenic
1193980738 X:88179334-88179356 AAAAGTTATTGGCCTTAAAGAGG - Intergenic
1194016768 X:88631238-88631260 AAGAGTTTTTGGCCTGAAAGAGG + Intergenic
1194083423 X:89497397-89497419 AAGAGTTATTGGCCTTAAAGTGG - Intergenic
1194096033 X:89639620-89639642 AAGAATTATTGGCCTTAAAGTGG + Intergenic
1194110373 X:89825987-89826009 AAGACATATTGCCCTTAAAGAGG + Intergenic
1194157727 X:90414178-90414200 AAGAGTAGTTGGCCTTAAAGAGG - Intergenic
1194165220 X:90507248-90507270 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1194228188 X:91287778-91287800 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1194253346 X:91604616-91604638 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1194257355 X:91651345-91651367 AGGAGTTATTGGCCTTAAAAAGG - Intergenic
1194274648 X:91864618-91864640 AAGAGTGACTGGCCTTAAAGAGG - Intronic
1194288059 X:92035754-92035776 AAGAGTTATTGGCCTTCAAAAGG - Intronic
1194290880 X:92070779-92070801 AAGAGTTACTGGCCTTAAAGAGG - Intronic
1194322994 X:92475794-92475816 AAGAGTAACTGGCCTTAAAGAGG - Intronic
1194329352 X:92561683-92561705 AAGAGTTATTGGCCTTAAAGGGG + Intronic
1194358361 X:92917092-92917114 AAGAGCTATTGGCCTTACAGAGG - Intergenic
1194398372 X:93413673-93413695 GAGAGTTATTGGCCTTAAAAAGG + Intergenic
1194398608 X:93415870-93415892 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1194431626 X:93814367-93814389 AAGAGTTATTGGCCTTGAAAAGG + Intergenic
1194447023 X:94001077-94001099 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1194493462 X:94579530-94579552 AAGAGTTATTGGACTTAAAGAGG + Intergenic
1194500741 X:94678005-94678027 AAGCATTATTGGCCTTAAAGAGG - Intergenic
1194506632 X:94741846-94741868 AAGACGTATTGAACTTAAAGAGG - Intergenic
1194558773 X:95395074-95395096 AAGAGCTATTGGCCTTAAAGAGG + Intergenic
1194561710 X:95429502-95429524 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1194568633 X:95524256-95524278 AAAAGTTATTGGCCTTAAAGAGG + Intergenic
1194591724 X:95807185-95807207 AAGAGTTATTGACTTTAAAGAGG + Intergenic
1194695384 X:97042682-97042704 AATAATTATTGTCACTAAAGTGG + Intronic
1194787453 X:98104891-98104913 AAGAGTTATTAGCCTTAAAGAGG - Intergenic
1194877385 X:99206962-99206984 AAGAGTTAATGGTCTTAAAGAGG - Intergenic
1194882925 X:99275647-99275669 AAGAGTTATTGGTCTTAAAGAGG + Intergenic
1194889979 X:99366100-99366122 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1194892126 X:99393499-99393521 AAGAGTTATTGGCCTTGAAGAGG - Intergenic
1194921817 X:99776913-99776935 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1194990933 X:100545685-100545707 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1195122774 X:101773655-101773677 CAGAGTTAGTGGCCTTAAAGAGG - Intergenic
1195172079 X:102279771-102279793 AAGAGTTATTAGGCTTAAAGAGG - Intergenic
1195186781 X:102407322-102407344 AAGAGTTATTAGGCTTAAAGAGG + Intronic
1195199518 X:102534190-102534212 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
1195312453 X:103644757-103644779 AAGAGTTAGTGGCCTTAAAGAGG + Intergenic
1195396313 X:104413819-104413841 AAGTGTTATTGGCCTTTAAGAGG + Intergenic
1195455331 X:105063045-105063067 AAGAGTTATTGGCCTTGAAAAGG - Intronic
1195489231 X:105448350-105448372 AAAAGTTATTGGCCTTAAAGAGG - Intronic
1195506230 X:105659908-105659930 AAGACTTATTGGCCCTAAAGAGG + Intronic
1195542901 X:106083591-106083613 AAGAGTTATTGGCCTTTAAGAGG - Intergenic
1195559267 X:106264883-106264905 AAGAATTATTGTCATTAAAGAGG - Intergenic
1195601455 X:106753091-106753113 AAGAGTTATTTGCCTTAAAGAGG + Intronic
1195823481 X:108971719-108971741 AAGTGTTATTGGCCTAAAAGAGG + Intergenic
1195828717 X:109032353-109032375 AAGAGTAATTGGCCTTAAAGAGG - Intergenic
1195848978 X:109262922-109262944 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1195851914 X:109293129-109293151 AAGAGTTATTGACCTTAAAGAGG - Intergenic
1196163741 X:112515040-112515062 AATAATTATTGGCCTTCAAGAGG + Intergenic
1196233328 X:113251436-113251458 ATGAGTTATTGGCCTTAAAGAGG - Intergenic
1196233653 X:113254519-113254541 AACAGTTATTGGTCTTAAAGAGG - Intergenic
1196242875 X:113364596-113364618 AAGAATTTTTGGCCTTAAAGAGG - Intergenic
1196248601 X:113430156-113430178 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1196368905 X:114953490-114953512 AAGAGTTATTAGCATTAAAGAGG + Intergenic
1196399373 X:115298407-115298429 AAGAGTTATTGGCTGTAAAGAGG - Intronic
1196415171 X:115463734-115463756 AATAATTATTGGCCCGATAGTGG - Intergenic
1196461212 X:115934010-115934032 AAAAGTTATTGGCCTTAAAGAGG - Intergenic
1196466350 X:115974899-115974921 AAGAGTTATTGGCTTTAAGGAGG + Intergenic
1196485458 X:116202168-116202190 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1196486914 X:116222471-116222493 AAGAGTTATTGACCTTAAAGAGG - Intergenic
1196494205 X:116305587-116305609 AAGAGTTATTTGCCTTAAAGAGG - Intergenic
1196547320 X:116977161-116977183 GAGAGTGATTGGCCTTAAAGAGG + Intergenic
1196576436 X:117324361-117324383 AAGAGTTATTGGCCTTAAACCGG - Intergenic
1196580285 X:117371032-117371054 AAGAATGATTGGTCCTAAACTGG - Intergenic
1196600755 X:117599389-117599411 AAGAATTATTGGACTTAAAGGGG - Intergenic
1196609733 X:117697263-117697285 AAGAGTAATTGGCCTTAAAGAGG + Intergenic
1196613934 X:117745266-117745288 AAGAGTTATTGACCTTAAAGAGG + Intergenic
1196922287 X:120596284-120596306 AAGAGTTATTGGCCTTAAGGAGG + Intronic
1196961951 X:121013196-121013218 AAGAGTTATTGGACATAAAGAGG - Intergenic
1196984382 X:121252429-121252451 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1197010232 X:121552106-121552128 GAGAGTTATTGGCCTTACAGAGG + Intergenic
1197011740 X:121572133-121572155 AGGAATTATTGGCCTTAAAGAGG + Intergenic
1197025168 X:121739358-121739380 AAGAGGTATTGGCCTTAAAGAGG + Intergenic
1197054071 X:122095672-122095694 AAGAGTTATTGGAATTAAAGAGG + Intergenic
1197099409 X:122635227-122635249 AACAGTTACTGGCCTTAAAGAGG - Intergenic
1197307827 X:124864636-124864658 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1197360940 X:125503351-125503373 AAAAGTTATTGGCCATAAAGAGG - Intergenic
1197382608 X:125764232-125764254 AAGATGTAGTGGCCTTAAAGAGG - Intergenic
1197403140 X:126018147-126018169 AAGAGTTACTGACCTTAAAGAGG - Intergenic
1197429591 X:126343918-126343940 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1197440188 X:126477754-126477776 AAGAGTTATTGGCCTTTAAGAGG + Intergenic
1197458135 X:126703023-126703045 AAGAGTTATTATCCTTAAAGAGG + Intergenic
1197470152 X:126857136-126857158 AGGAGTTATTTGCCTTAAAGAGG + Intergenic
1197481919 X:126996712-126996734 AAGAGTTATTGGTCCTAAAAAGG + Intergenic
1197514516 X:127409652-127409674 AAGAGTTACTGGCCTTAAACAGG - Intergenic
1197520231 X:127488755-127488777 AAGAGGTATTGTCCTTAAAGAGG - Intergenic
1197537745 X:127710415-127710437 AAGACTTATTACCCTTAAAGAGG + Intergenic
1197581537 X:128289682-128289704 AAGAGTTACTGGCCATAAAGAGG + Intergenic
1197661361 X:129177538-129177560 AAGAGTTATTGACCTTAAAGAGG - Intergenic
1197670466 X:129271936-129271958 AAGGGTTATTGGACTTAAAGAGG - Intergenic
1197677819 X:129348829-129348851 AAGAGTTATTGGCCTTCAGGAGG + Intergenic
1197876377 X:131113284-131113306 AAGAGTTATTTGCCTTAAAGAGG - Intergenic
1198274063 X:135084787-135084809 AAGAGGTATTGGCCTTAAAAAGG - Intergenic
1198293890 X:135265233-135265255 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1198430631 X:136563313-136563335 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1198537826 X:137603327-137603349 AAGAGTTATTGGTCTTAAATAGG + Intergenic
1198664565 X:139005960-139005982 AAGAGTTACTGGCCTTAAAGAGG + Intronic
1198702401 X:139412399-139412421 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1198770365 X:140124440-140124462 AAGAGTTATTGGCCTAAAATAGG - Intergenic
1198781639 X:140243643-140243665 AAGAGTTATTATCCTTAAAGAGG - Intergenic
1198817905 X:140612970-140612992 AAGAGTTATTAGCATTAAAGAGG - Intergenic
1198855973 X:141017051-141017073 AAGAGTTATTGGCCTTAAGGAGG - Intergenic
1198876159 X:141229060-141229082 AAGAGTTATTGGCCTTAAGGAGG + Intergenic
1198906719 X:141570316-141570338 AAGAGTTATTGGCCTTAAGGAGG + Intergenic
1198917014 X:141683988-141684010 AAGAGTTATTGGCCTTAAGGAGG + Intronic
1198925438 X:141786918-141786940 AAGAGTTATTGGCCTAAAAGAGG - Intergenic
1199035981 X:143051614-143051636 AAGAATTATTGGCCTTACATAGG - Intergenic
1199050741 X:143233797-143233819 AAGAGGTCTTGGCCTTAAAGAGG + Intergenic
1199058936 X:143330273-143330295 AAGAGTCATTGCCCTTAAAGTGG + Intergenic
1199076058 X:143528371-143528393 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1199138745 X:144285746-144285768 AAGAATTATTTGCCTTAAAGCGG - Intergenic
1199145724 X:144363920-144363942 AAGAGTTATTGGCCTCAAAGAGG + Intergenic
1199148459 X:144398887-144398909 AAGAGTTACTGGCCTTAAAGAGG + Intergenic
1199156305 X:144552574-144552596 AAGACTTATTGCCCTTAAATAGG + Intergenic
1199162521 X:144629790-144629812 AACAGTTATTGGCCTTAAAAAGG + Intergenic
1199163692 X:144645983-144646005 AAGAGTTATTGGCCTTTAAAAGG - Intergenic
1199173750 X:144760212-144760234 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1199176075 X:144788495-144788517 AAGAATTATTGGCCATAAAGAGG + Intergenic
1199196390 X:145036235-145036257 ATGAGTTATTGGCCTTAAGGAGG - Intergenic
1199239310 X:145527776-145527798 AAAAGTTATTGGCCTTAAAGAGG + Intergenic
1199274794 X:145927962-145927984 AAGTGTTATTGGCCTTAAAGAGG + Intergenic
1199316227 X:146380883-146380905 AAGAGTAACTGGCCTTAAAGAGG + Intergenic
1199334172 X:146599562-146599584 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1199358471 X:146888140-146888162 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1199374071 X:147086989-147087011 GCGAGTTATTGGCCTTAAAGAGG - Intergenic
1199415248 X:147574495-147574517 AAGAATTACTGGCCTTAAAGGGG + Intergenic
1199442888 X:147888682-147888704 AAGGGTTATTGGCCTTAAAGAGG - Intergenic
1199454873 X:148017480-148017502 AAGAGTTAGTGGCCTTAAAAAGG - Intronic
1199485263 X:148339805-148339827 AAATGTTATTGGCCTTAAAGAGG + Intergenic
1199568592 X:149245059-149245081 AAGAGTTATTGGTCTTAAAGAGG - Intergenic
1199908934 X:152263608-152263630 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1200332053 X:155308441-155308463 AAGAGTTATTGGCCTTAAAGAGG + Intronic
1200370703 X:155721329-155721351 AAGAGTTATTGATCTTAAAGAGG + Intergenic
1200436075 Y:3153276-3153298 AAGAGTTATTGGCCTTAAAGTGG - Intergenic
1200449036 Y:3300999-3301021 AAGAATTATTGGCCTTAAAGTGG + Intergenic
1200463035 Y:3480726-3480748 AAGACATATTGCCCTTAAAGAGG + Intergenic
1200504061 Y:3991153-3991175 AAGAGTAGTTGGCCTTAAAGAGG - Intergenic
1200511483 Y:4085058-4085080 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1200591890 Y:5086021-5086043 AAGAGTGACTGGCCTTAAAGAGG - Intronic
1200605582 Y:5260306-5260328 AAGAGTTATTGGCCTTCAAAAGG - Intronic
1200608392 Y:5295356-5295378 AAGAGTTACTGGCCTTAAAGAGG - Intronic
1200631094 Y:5588954-5588976 AAGAGTAACTGGCCTTAAAGAGG - Intronic
1200638052 Y:5680873-5680895 AAGAGTTATTGGCCTTAAAGGGG + Intronic
1200666537 Y:6032785-6032807 AAGAGCTATTGGCCTTACAGAGG - Intergenic
1201067130 Y:10107846-10107868 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1201372456 Y:13280083-13280105 AAGAGTTATTGGCATTAAAGAGG + Intronic
1201554564 Y:15255006-15255028 TAGACTTATAAGCCCTTAAGAGG + Intergenic
1201760736 Y:17535491-17535513 AAGAGTTATTGGCCTTAAAGAGG - Intergenic
1201840816 Y:18370499-18370521 AAGAGTTATTGGCCTTAAAGAGG + Intergenic
1202023953 Y:20500622-20500644 TGGAGTTATTGGCCTTAAAGAGG - Intergenic
1202595606 Y:26536075-26536097 AAGTGGTATTGGCCTTAAAGAGG + Intergenic