ID: 1195506341

View in Genome Browser
Species Human (GRCh38)
Location X:105661632-105661654
Sequence CTATAAAAATACATGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 0, 2: 3, 3: 62, 4: 461}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195506334_1195506341 25 Left 1195506334 X:105661584-105661606 CCATAATGGGATAAAACTAGAAA 0: 2
1: 58
2: 586
3: 1443
4: 2641
Right 1195506341 X:105661632-105661654 CTATAAAAATACATGGAGGCTGG 0: 1
1: 0
2: 3
3: 62
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195506341 Original CRISPR CTATAAAAATACATGGAGGC TGG Intronic
900550769 1:3253402-3253424 CAATAAAAACACATGGACACAGG - Intronic
900828956 1:4950323-4950345 CTATAAGAACACATGGACACAGG + Intergenic
901182831 1:7353182-7353204 CAATAAAATTACATGAGGGCAGG + Intronic
901535499 1:9880172-9880194 CAATAAGAATACATGGACACAGG - Intronic
902100853 1:13987365-13987387 CAATAAGAATACATGGACACAGG - Intergenic
903350646 1:22714449-22714471 CCATAGAAAGACATGGAGGCAGG + Intronic
903686428 1:25135537-25135559 CTATACCAGGACATGGAGGCTGG + Intergenic
903709904 1:25315790-25315812 CTAGAAAAATAAATTAAGGCCGG - Intronic
903717211 1:25376616-25376638 CTAGAAAAATAAATTAAGGCCGG + Intronic
903997570 1:27317206-27317228 CTATAAAATGGAATGGAGGCCGG + Intergenic
904725206 1:32541552-32541574 CTATAAAAATACTTTGGGACTGG + Intronic
905459075 1:38109799-38109821 ATATAAAAATACCTTAAGGCTGG - Intergenic
905877397 1:41441597-41441619 CTGTAAATATTCATGTAGGCTGG + Intergenic
906221631 1:44084776-44084798 CTAAAAACATACATGAAGGCAGG + Intergenic
906483306 1:46215600-46215622 AAATTAAAAGACATGGAGGCTGG + Intronic
908189919 1:61691617-61691639 ATATAAAAATATAAGGAGGCTGG + Intronic
908203396 1:61820636-61820658 TAATAAAAATAAATGTAGGCCGG - Intronic
908305773 1:62814392-62814414 CAATGAGAATACATGGAGACTGG + Intronic
908496920 1:64703766-64703788 CTACAAAAACACATGGGGCCAGG + Intergenic
908635113 1:66154890-66154912 CTATAAAATTGCATGTAGGCTGG + Intronic
909076320 1:71054090-71054112 GCATGAAAATACAGGGAGGCCGG + Intergenic
911085251 1:93971724-93971746 CTAAAAGGAGACATGGAGGCTGG - Intergenic
913252607 1:116924439-116924461 CTTTAAAACTACATGCAGGTTGG - Intronic
914262699 1:146012202-146012224 ATATAAAAATACAACTAGGCTGG + Intergenic
914397190 1:147281158-147281180 GTATGAAAATACATGCAGCCAGG - Intronic
914776811 1:150743424-150743446 GTTTAAAAATACATCTAGGCTGG + Intronic
915391997 1:155552168-155552190 CTAAATAAATATATGAAGGCCGG + Intronic
915828103 1:159100526-159100548 CTATTAAAAAAGGTGGAGGCAGG + Intronic
916679707 1:167093291-167093313 CTATTAAAAGAAATGCAGGCAGG + Intergenic
917748695 1:178035681-178035703 CTATCACAAAACATAGAGGCTGG - Intergenic
917769108 1:178257539-178257561 TTATAAAAATTAATGTAGGCTGG + Intronic
917964605 1:180170377-180170399 CCATAAAAATATCTGGAGGCTGG + Intronic
919338160 1:196266725-196266747 TGAAAAAAATAAATGGAGGCTGG + Intronic
919705482 1:200670893-200670915 TTATAAAAATACATATAGCCTGG + Intergenic
920242829 1:204566023-204566045 CTATAAAAATCTAAGGGGGCGGG + Intergenic
923415433 1:233753372-233753394 CTAAAAAAATAAATGGACACAGG + Intergenic
923945414 1:238881250-238881272 CAATAAGAATACATGGACACAGG + Intergenic
924323404 1:242871596-242871618 TTCTAAAAATACATTGAAGCAGG + Intergenic
1063172354 10:3520292-3520314 TAATACAAATACATGAAGGCAGG - Intergenic
1063593886 10:7415536-7415558 TTTTAAAAGTACATGAAGGCCGG + Intergenic
1064616874 10:17168005-17168027 TTATAAATATGAATGGAGGCTGG + Intronic
1064797760 10:19032727-19032749 CAATGAAAATACATGGACACAGG - Intergenic
1065071719 10:22031896-22031918 TTAAAAAAATACCTGAAGGCAGG + Intergenic
1065274893 10:24075898-24075920 CAATAAAAATAGATTAAGGCTGG - Intronic
1068472205 10:57479793-57479815 CTATAAAAGAACCTGGCGGCCGG + Intergenic
1069183055 10:65387011-65387033 TTATAAAACTAGTTGGAGGCAGG - Intergenic
1069562572 10:69441226-69441248 CTATAAAAGAACATGGTGGAAGG - Intergenic
1070044306 10:72816021-72816043 ATACAAAAATATATGGTGGCGGG + Intronic
1071808977 10:89157373-89157395 CTTTAAAAATAAATAGAGTCAGG + Intergenic
1072140765 10:92587261-92587283 TTAAAGAAAAACATGGAGGCTGG - Intergenic
1072370510 10:94762053-94762075 CTAAAAAAACACGTGAAGGCAGG - Intronic
1073553391 10:104424908-104424930 CTAAAAACATACATTAAGGCAGG + Intronic
1073968930 10:109024678-109024700 CAATAAGAACACATGGATGCAGG + Intergenic
1074447905 10:113535298-113535320 CAATAAGAATACATGGACACAGG - Intergenic
1074741976 10:116493985-116494007 TTATAAAGATACATGCACGCAGG - Intergenic
1076044476 10:127280328-127280350 ACATAAAAATATATGAAGGCCGG - Intronic
1077828984 11:5842676-5842698 CAATAAGAATACATGGACACAGG - Intronic
1078209746 11:9261145-9261167 CAACAAATAAACATGGAGGCTGG - Intronic
1078484494 11:11708929-11708951 CTTTAAAAATAAATGGATGAGGG - Intergenic
1079676570 11:23234878-23234900 GGAGCAAAATACATGGAGGCTGG - Intergenic
1079741683 11:24070068-24070090 CTATATAAAAACATGCTGGCCGG - Intergenic
1080525334 11:33110932-33110954 CTATAAAAATAAAAGCAGGCCGG + Intronic
1081100134 11:38991001-38991023 CTACAAAAATACATAGAGAAAGG - Intergenic
1081141654 11:39508738-39508760 CCATAAAAGTACATGAGGGCTGG + Intergenic
1081210174 11:40323478-40323500 CAATGAAAATACATGAAGTCTGG - Intronic
1081753016 11:45525484-45525506 CTCTCACAATACATGGAGGGAGG - Intergenic
1082172650 11:49024836-49024858 CTATGAAAATGCTTTGAGGCTGG + Intergenic
1083481775 11:62953046-62953068 CAATAAAAAGAAATGGGGGCCGG - Intronic
1084230630 11:67750128-67750150 TTAGAAAAATAAGTGGAGGCTGG + Intergenic
1085594338 11:77794384-77794406 CCATACAAATACATGGGGCCAGG + Intronic
1085872868 11:80371128-80371150 AAATAGAAATACATGCAGGCAGG + Intergenic
1086074632 11:82836842-82836864 CAACAAAAATGCAAGGAGGCTGG - Intronic
1086428513 11:86712425-86712447 CTTTAAAAATAAATGAATGCTGG - Intergenic
1086693116 11:89811216-89811238 CTATGAAAATGCTTCGAGGCTGG - Intergenic
1086712689 11:90028441-90028463 CTATGAAAATGCTTCGAGGCTGG + Intergenic
1087402172 11:97681672-97681694 CTGTAAAAAGACAAAGAGGCTGG - Intergenic
1087654823 11:100909629-100909651 CTATAAAAATCCTAGAAGGCTGG - Intronic
1088366851 11:109048920-109048942 CTATAAAAAAACATGGTGCCAGG - Intergenic
1088404816 11:109462494-109462516 CAATAAGAAAACATGGAGACAGG + Intergenic
1090244017 11:125202884-125202906 CTCTAAAAATACCTGGCAGCTGG - Intronic
1090541736 11:127713331-127713353 CTATAGACATCCAGGGAGGCTGG + Intergenic
1090741240 11:129662661-129662683 CAATAAGAATACATGGACACAGG + Intergenic
1092615150 12:10210288-10210310 GTATAAAAATTCATGAGGGCAGG + Intergenic
1092866386 12:12765346-12765368 ATATAAAAATATATTGAGCCGGG - Intronic
1093011005 12:14106861-14106883 CTACTAAAATACATGGTGGCAGG + Intergenic
1093941297 12:25057552-25057574 CTAAAAAAATACATGCAGCTGGG - Intronic
1094565259 12:31592630-31592652 CTATAAAAATAAAATGAGGCCGG + Intergenic
1095101688 12:38191363-38191385 CTATAAAAATAATTGGTGGCTGG - Intergenic
1097676819 12:62611886-62611908 GTTTAAAAATAAATAGAGGCAGG + Intergenic
1097698750 12:62799658-62799680 CAATGAAAATACCAGGAGGCTGG - Intronic
1098103936 12:67049508-67049530 CAATGAGAATACATGGACGCAGG + Intergenic
1098207662 12:68130063-68130085 CTCTAAAAACACATATAGGCGGG - Intergenic
1098546980 12:71722218-71722240 CTATAAATATCCATGAAGGGGGG - Intergenic
1098690141 12:73477101-73477123 CCAAAAAAATACATGAAGTCAGG - Intergenic
1098974119 12:76884569-76884591 ACATAAAAATAAATGTAGGCTGG + Intergenic
1099462026 12:82934423-82934445 CTATGAGAACACATGGACGCAGG - Intronic
1099599332 12:84712642-84712664 TTAAAAAAATACATATAGGCCGG - Intergenic
1099765944 12:86984367-86984389 GTATAAAAATACCTGGAAACTGG + Intergenic
1100316362 12:93448500-93448522 CTATAAAAGTAAATGGAGCCGGG + Intergenic
1100434976 12:94562829-94562851 CTAAGAAAATCCATGGAGGCCGG - Intergenic
1101122175 12:101593688-101593710 TTAAAAATATATATGGAGGCTGG - Intronic
1101321526 12:103677089-103677111 CTATAAAAAGACATGAACCCGGG - Intronic
1101389764 12:104289690-104289712 TTAGAAAAATGCTTGGAGGCTGG + Intronic
1101626317 12:106445754-106445776 CTGTAAAAATACAGAGAGGGAGG + Intronic
1102337363 12:112093241-112093263 ATATAAAACATCATGGAGGCCGG + Intronic
1102350374 12:112187532-112187554 CCATAAAAATAAATACAGGCCGG - Intronic
1102609800 12:114101807-114101829 CAATGAAAATACATGGACACAGG + Intergenic
1103315996 12:120056422-120056444 CTATAAGAATGAATTGAGGCCGG + Intronic
1103386589 12:120537328-120537350 CTGTAAAAACTCATGTAGGCCGG + Intronic
1103491279 12:121322453-121322475 TTATAAAAATATATGTAAGCTGG - Intronic
1103684893 12:122724113-122724135 CTATAAAATGACATAGAGGGAGG - Intergenic
1105045435 12:132999549-132999571 CTTTAAAAACACATGGCGGCTGG - Intronic
1105384058 13:19913858-19913880 CTATCAACATAGATGCAGGCAGG - Intergenic
1105478379 13:20749024-20749046 CTTTAAAACTACATTGGGGCTGG - Intronic
1105482391 13:20790581-20790603 CTATTAAAATAAAAGGATGCAGG + Intronic
1107587337 13:41865418-41865440 TTATAAAAATACAGGTAGGTGGG - Intronic
1107854724 13:44603490-44603512 CTATAAAAATAAATTGAGGCCGG + Intergenic
1108741176 13:53339938-53339960 CTATGAACATTCATGAAGGCAGG - Intergenic
1109281206 13:60357708-60357730 CTGTAAGAACACATGGACGCAGG - Intergenic
1109489393 13:63076251-63076273 CTATAGAAATAGATGGATGCTGG - Intergenic
1109514739 13:63427507-63427529 CTATAAACAGACATGCAGGTAGG - Intergenic
1109675713 13:65673659-65673681 GGATAAAAATACATGGATGGAGG - Intergenic
1109752694 13:66717153-66717175 CTTTAAAAATACAATGAAGCTGG + Intronic
1110692794 13:78451610-78451632 TTCTAAAAATACATGCAGGATGG + Intergenic
1110709055 13:78629846-78629868 CTATAAAAATAGAGGGATGATGG + Intronic
1111263785 13:85779130-85779152 CTATAAAGATAAAAGGAGGTTGG - Intergenic
1111284579 13:86072144-86072166 CTATGAGAATACATGGACACAGG + Intergenic
1111298057 13:86309084-86309106 TTATAAATATAAATGTAGGCCGG + Intergenic
1111570449 13:90077751-90077773 CAATGAGAATACATGGACGCAGG - Intergenic
1111757121 13:92412575-92412597 CAATAAAAATTTATGGAGACAGG - Intronic
1112548343 13:100393898-100393920 CTACAAAACTAGTTGGAGGCTGG + Intronic
1112554410 13:100453203-100453225 ATATGAAAACAAATGGAGGCCGG + Intronic
1112753952 13:102609691-102609713 GTTTAAAAATGCATGGGGGCTGG - Intronic
1113407779 13:110057355-110057377 CTATAAAAAGCCAGGGAGGGAGG + Intergenic
1113538320 13:111085364-111085386 CTATAAACATTCATGTATGCAGG + Intergenic
1114366503 14:22032711-22032733 CTATAAGAACACATGGACACAGG - Intergenic
1115415193 14:33124148-33124170 CTATAAAACTTCATAGAGGCTGG - Intronic
1115818978 14:37193753-37193775 CAATGAGAATACATGGACGCAGG + Intergenic
1119694260 14:76700159-76700181 CTAGAACAGTACATGGAGTCAGG - Intergenic
1119882976 14:78116181-78116203 GAATAAAAATACATGGAGAAGGG - Intergenic
1120407477 14:84106840-84106862 AGATAAAAATAAATGGAGGCTGG + Intergenic
1121127130 14:91415423-91415445 TTATTAAAATAAAAGGAGGCCGG + Intronic
1121446067 14:93980052-93980074 ATATGAAAAAAGATGGAGGCTGG - Intergenic
1121938362 14:98042778-98042800 CTATAAAAGTCCAAGGTGGCAGG - Intergenic
1123690554 15:22835188-22835210 CCATAAAAATACTTGCAGGCCGG - Intergenic
1123951774 15:25285667-25285689 CTAGAAAGCTACATGCAGGCTGG + Intergenic
1125139849 15:36392806-36392828 GTAAAAAAGTACATGGAAGCAGG - Intergenic
1125432503 15:39609595-39609617 CTAGAGAAACACATGGATGCAGG - Intronic
1125658795 15:41379842-41379864 CTAAAATCATGCATGGAGGCCGG - Intronic
1125810763 15:42539180-42539202 CTCAAAAAATACATATAGGCTGG + Exonic
1126076346 15:44914134-44914156 AAACAAAAATACATGGTGGCGGG - Intergenic
1126349161 15:47726775-47726797 AAATAAAAATAAATGCAGGCTGG + Intronic
1127100741 15:55562369-55562391 CTATAAAAATACATGCACACTGG + Intronic
1127186116 15:56482473-56482495 CAATAAAAGTCCAGGGAGGCCGG - Intergenic
1127359716 15:58234635-58234657 CTTTAAAAAGAAATGTAGGCTGG + Intronic
1128377103 15:67084815-67084837 CCATAAAAATACAGGAAGGAAGG + Intronic
1129353081 15:74968815-74968837 TTAAAAAAATAAAAGGAGGCTGG - Intronic
1129798268 15:78394504-78394526 ATAAAAGAATAAATGGAGGCTGG + Intergenic
1129873365 15:78956065-78956087 ATAAATCAATACATGGAGGCAGG + Intergenic
1130230002 15:82089478-82089500 CTCAAAAAATAAATGGAGGTTGG + Intergenic
1130246900 15:82260290-82260312 TTATAAAAACTCATGGAGGCAGG + Intronic
1130453749 15:84082735-84082757 TTATAAAAACTCATGGAGGCAGG - Intergenic
1130721817 15:86394643-86394665 CTATAAAAGTAGAGGGAGCCAGG - Intronic
1132460328 16:50253-50275 CTATAAAAGAACATATAGGCTGG - Intronic
1133557084 16:6915846-6915868 CTATAAAAAGGAATGAAGGCTGG - Intronic
1134689200 16:16179885-16179907 CAATAATAATACAAGTAGGCCGG - Intronic
1134760303 16:16708720-16708742 CAATGAAAACACATGGACGCAGG - Intergenic
1134985768 16:18650485-18650507 CAATGAAAACACATGGACGCAGG + Intergenic
1136865675 16:33750925-33750947 CTAAAAAAAATCATGGAGGCTGG + Intergenic
1137066723 16:35854115-35854137 CAATAAGAACACATGGATGCAGG - Intergenic
1138419446 16:56889769-56889791 CTATAAAGATGTCTGGAGGCCGG - Intronic
1138951243 16:61916131-61916153 ATATAGAAATACTTGGAGGAAGG - Intronic
1139687100 16:68612554-68612576 TAAAAATAATACATGGAGGCTGG - Intergenic
1139744079 16:69060312-69060334 ATATAAAAGTGAATGGAGGCTGG - Intronic
1140243444 16:73226151-73226173 CTATAAATAGCCATGTAGGCAGG + Intergenic
1142619466 17:1155667-1155689 CGATAAAAAGACATCTAGGCCGG + Intronic
1144093529 17:11879384-11879406 CTAAAAGAATACAGTGAGGCTGG - Intronic
1145977211 17:28991199-28991221 ATAAATAAATAAATGGAGGCTGG - Intronic
1146015182 17:29227495-29227517 CAAAAAAAGTACATGTAGGCCGG - Intergenic
1146783172 17:35694555-35694577 CTTTAAAAATACATTTAGGCTGG - Intronic
1148968440 17:51457870-51457892 TTATAAAAAGACATGAAGGTCGG + Intergenic
1150372365 17:64651046-64651068 TACTAAAAATACATGGTGGCGGG + Intronic
1150597752 17:66621903-66621925 CTTTAAAAATAAGTTGAGGCTGG + Intronic
1151033540 17:70771152-70771174 TTTTAAAAATATCTGGAGGCCGG - Intergenic
1151723599 17:75872456-75872478 CTTTAAAAAAATATTGAGGCTGG - Intergenic
1151800356 17:76375870-76375892 CTGGAAAAAGACATGGAGCCCGG - Intronic
1152479902 17:80543794-80543816 CTATAAAACCAAATGTAGGCAGG - Intergenic
1152692082 17:81723032-81723054 TTAAAAAAATGCATGGAGGCTGG - Intergenic
1153482306 18:5559267-5559289 CTTTACAAATAAATGGAGGAGGG + Intronic
1155097154 18:22567929-22567951 CTTGACAAATACATGGAGTCAGG + Intergenic
1155181002 18:23346414-23346436 CTATAAAAATAGTTGAAGGCAGG - Intronic
1155391701 18:25345130-25345152 CTTTAAAAATAGAGGGAGGCAGG + Intronic
1156345933 18:36257239-36257261 CTATAAAGATGAATGGAAGCTGG - Intronic
1157659519 18:49427784-49427806 CAATAAAAAGGAATGGAGGCTGG + Intronic
1158461877 18:57653580-57653602 CTATGAAGATACCTGAAGGCAGG - Intronic
1160364941 18:78315828-78315850 ATAAAAAAATAAATGGAAGCTGG + Intergenic
1161002090 19:1915648-1915670 TTATAAGAAGAGATGGAGGCCGG + Intronic
1161246884 19:3257770-3257792 AAATAAAAAAAAATGGAGGCTGG - Intronic
1161324030 19:3654466-3654488 CTACAAAAATAGGTGGTGGCCGG - Intronic
1162270675 19:9612512-9612534 CTATAAAAATAAATTGAGGCTGG - Intronic
1162275903 19:9654741-9654763 CTATAAAAATAAATTGAGGCCGG - Intronic
1162611561 19:11758884-11758906 TTATAAAATTACATTGAGGCCGG + Intergenic
1163819658 19:19488755-19488777 CTACAAAAATCCCTGGAAGCAGG - Intronic
1164262656 19:23581574-23581596 CTAAAAAATTACATTGAAGCTGG - Intronic
1165020550 19:32920778-32920800 CTATAAAATAAGAGGGAGGCTGG - Intronic
1166132359 19:40753691-40753713 CTCTAAAAACATATGCAGGCCGG - Intronic
1166847810 19:45740452-45740474 CTATTAAAACAAATGAAGGCCGG + Intronic
1168096310 19:54117159-54117181 CTGTACAAAGACCTGGAGGCGGG + Intronic
1168447825 19:56437398-56437420 CTATAAAAATAAAATGGGGCTGG - Intergenic
925390110 2:3488805-3488827 CTATAATAATAAAGGCAGGCAGG + Intergenic
925930425 2:8702921-8702943 CTTTAAATAGACAGGGAGGCAGG + Intergenic
925948354 2:8887601-8887623 TAATAAAAATACATGGAAACAGG + Intronic
926626178 2:15091827-15091849 TTAAAAAAACACAAGGAGGCTGG - Intergenic
927443291 2:23135251-23135273 CTTTAAAAATACATGGGATCAGG - Intergenic
928531390 2:32196016-32196038 CTTTAAAAAAAAATGAAGGCTGG + Intronic
929111454 2:38408487-38408509 AAAGAGAAATACATGGAGGCAGG + Intergenic
929173108 2:38950911-38950933 CTACAAAAATACATGCAGCAGGG - Intronic
929214438 2:39396333-39396355 GTATACAAATACTTGTAGGCCGG - Intronic
929325330 2:40603689-40603711 ATATAAAAATAAATGTAGGCTGG + Intronic
930286612 2:49436982-49437004 CAATAAAAACACATGGACGTAGG + Intergenic
930645065 2:53897468-53897490 CTTTAAAAATACCCTGAGGCTGG - Intronic
931074500 2:58694430-58694452 CTATGAAAACACATGGACACAGG + Intergenic
931528272 2:63183411-63183433 CTATACAAATACATGGAAATTGG - Intronic
931595262 2:63935180-63935202 CTAAAAAAATACACAGAGGTAGG - Intronic
932225643 2:70038248-70038270 CTAAAGAAATGCATGAAGGCTGG + Intergenic
932553418 2:72796117-72796139 TTTTAAAAATACCTGAAGGCTGG - Intronic
932614532 2:73223511-73223533 CTATACAAGGACATCGAGGCAGG + Exonic
933648843 2:84832859-84832881 CTCTGAAAAAACAGGGAGGCTGG + Intronic
936554699 2:113484959-113484981 ATGTAAAAATACATTGAGGCCGG - Intronic
937027772 2:118713421-118713443 CGAGAAAAATAAATTGAGGCAGG + Intergenic
937306693 2:120876043-120876065 TTACAAAAATAAATGCAGGCCGG + Intronic
937690990 2:124754847-124754869 CTAAAAAAAAAAATGTAGGCTGG - Intronic
937836068 2:126471401-126471423 CTAGAAAAATACCTGGAAGAAGG + Intergenic
938019226 2:127892537-127892559 CCATCAGAATACATGAAGGCTGG + Intergenic
939051824 2:137316595-137316617 CTATAAAAATACAAAAAGCCAGG + Intronic
939096354 2:137837413-137837435 CTGGAAAAATACATGGGGACAGG + Intergenic
939527385 2:143314000-143314022 CAATAAAATTACAAGGAGGCTGG - Intronic
940776061 2:157884967-157884989 CTTTAAGGATACATGGAAGCTGG - Intronic
941174584 2:162180976-162180998 CTTAAATAATAAATGGAGGCCGG + Intronic
941266658 2:163371453-163371475 TTATAAAAATAAAAAGAGGCTGG + Intergenic
941720136 2:168803929-168803951 CTATACAAAAACATTGAGGTAGG - Intronic
942649347 2:178150319-178150341 CAATGAGAATACATGGACGCAGG + Intergenic
943459164 2:188148779-188148801 TTATAAAAATTCAAGGGGGCAGG - Intergenic
943792851 2:191954181-191954203 CTATAAAAATGAATGCAGGCCGG - Intronic
944008632 2:194943231-194943253 CTATAAAAATAAAATAAGGCAGG - Intergenic
944548426 2:200821772-200821794 CTTCAAAGTTACATGGAGGCTGG + Intronic
945948833 2:216019799-216019821 CAATAAAAATAGTTTGAGGCTGG - Intronic
1169032274 20:2418778-2418800 CTTTAAAAATATATTGAGGCCGG + Intronic
1169441331 20:5636211-5636233 CTTTTAAAACCCATGGAGGCCGG - Intergenic
1169931100 20:10833988-10834010 CTATAAAAATACATGCTGGGAGG + Intergenic
1170203537 20:13770999-13771021 TTTTAAAAATGCATGGAGGAAGG - Intronic
1170504764 20:17013758-17013780 CAATAAAAACACATGGCAGCTGG + Intergenic
1170583208 20:17714454-17714476 CTATAAAATTCCATCTAGGCTGG - Intronic
1170913414 20:20598261-20598283 CTAGAAAAATGTATGTAGGCGGG - Intronic
1172057416 20:32164224-32164246 ATATAACAAGAGATGGAGGCTGG + Intronic
1172623202 20:36332898-36332920 CCATGAATATACATGGTGGCAGG - Intronic
1173012379 20:39193690-39193712 ATAGAAAAATACATCGTGGCCGG - Intergenic
1173296297 20:41761482-41761504 CAATAAGAACACATGGACGCAGG - Intergenic
1173304694 20:41837080-41837102 CCATAAAAACAAATGGAGCCCGG - Intergenic
1173521226 20:43701722-43701744 CTATAAAAATATCTGCAGGCTGG + Intronic
1174405394 20:50299566-50299588 TTAAAAAAAAAAATGGAGGCCGG + Intergenic
1174798387 20:53541495-53541517 ATATAAAAATAGGTGGGGGCTGG + Intergenic
1175096380 20:56544520-56544542 CAATAAAAAAACAAGGCGGCTGG + Intergenic
1176737463 21:10564211-10564233 CCATAAAGACACATGTAGGCTGG + Intronic
1177087221 21:16721058-16721080 CGATAAAAACACATGGACACAGG + Intergenic
1177088496 21:16736905-16736927 CAATGAAAATACATGGACACAGG + Intergenic
1178377673 21:32081098-32081120 ATTGAAAAATACATTGAGGCCGG - Intergenic
1179079226 21:38154780-38154802 CAATGAGAATACATGGATGCAGG - Intronic
1179521281 21:41946994-41947016 CTAGAACAATACAAGGAGACAGG + Intronic
1182040509 22:27235579-27235601 CAATAAGAATACATGGACACAGG + Intergenic
1182380045 22:29880465-29880487 ATATAAAAATAAAAAGAGGCCGG + Intergenic
1182565215 22:31193495-31193517 CTATAAAAACACATTTTGGCCGG + Intronic
1183156555 22:36080053-36080075 CAATAAAAACACATGGACACAGG - Intergenic
1183265952 22:36825567-36825589 CCCAAAAAACACATGGAGGCTGG - Intergenic
1183531661 22:38358373-38358395 CCATAAAGACACATGTAGGCTGG - Intronic
1183611431 22:38909346-38909368 CCATAAAAAGGAATGGAGGCCGG - Intergenic
1183988622 22:41583450-41583472 CCAAAAAAATAGATAGAGGCTGG - Intronic
1184263254 22:43331959-43331981 CTAAAAAAAGACAGTGAGGCTGG + Intronic
949273783 3:2254083-2254105 CTATAAGAACACATGGACACAGG - Intronic
951157898 3:19376985-19377007 CCATAAACATACATGGAAGAGGG + Intronic
951868891 3:27338131-27338153 CTATGAGAATACATGGACACAGG - Intronic
951994583 3:28713184-28713206 CAATAAAAACACATGGACACAGG - Intergenic
954286597 3:49623921-49623943 ACATAAAAATCTATGGAGGCAGG - Intronic
954482614 3:50815117-50815139 CTATAAAAATAAAATGAGGCTGG - Intronic
955174527 3:56600440-56600462 CTATAAAGATACATGCAGCCGGG - Intronic
955914686 3:63894819-63894841 CAATAAAAATATGTTGAGGCTGG - Intronic
956825782 3:72996257-72996279 ATATAAAAATAAATACAGGCCGG - Intronic
956946481 3:74229008-74229030 GTATAAAAACACATGGAAGGAGG + Intergenic
957761196 3:84559297-84559319 GTATAGAAAAACATGGAGGCAGG + Intergenic
957891955 3:86370844-86370866 TTATAAAAATCAGTGGAGGCTGG - Intergenic
959287024 3:104427874-104427896 GGATAAAAATAGATGGAGACAGG + Intergenic
959938133 3:112051792-112051814 CTATAATATCACATGGAGACAGG + Intronic
960755854 3:121011372-121011394 CTATAAAAATAAAGGGTTGCAGG - Intronic
960878809 3:122323915-122323937 ATATAAAAATAATTGGAGGCTGG - Intergenic
961879262 3:130049244-130049266 TTAGAAAAATAAGTGGAGGCTGG + Intergenic
961981719 3:131086415-131086437 CTGAAAAAATACATGGATGGAGG - Intronic
962261525 3:133911958-133911980 ATTTAAAACTACATGCAGGCTGG + Intergenic
963398198 3:144760094-144760116 CTATGAAAAAAAAAGGAGGCTGG - Intergenic
964258653 3:154808862-154808884 CTATAAAGATACACATAGGCTGG - Intergenic
964581579 3:158245307-158245329 CCATACAAGTACATGGAAGCTGG - Intronic
965568207 3:170144028-170144050 CTGTAAGAATATATCGAGGCCGG + Intronic
965853840 3:173064409-173064431 CTATAAATGTACATGAAAGCTGG - Intronic
965909764 3:173758688-173758710 CTACAAATATACATGGAGGGGGG - Intronic
966191542 3:177276298-177276320 CAACAAAAACACAGGGAGGCAGG - Intergenic
967329452 3:188275968-188275990 CTAGAAAAGTTCCTGGAGGCTGG - Intronic
967783596 3:193466318-193466340 CTAGAAAAATACATAAATGCTGG + Intronic
968991491 4:3916268-3916290 TTAGAAAAATAAGTGGAGGCTGG + Intergenic
969648852 4:8451060-8451082 TTAAAAAAATACATGGAAGCCGG - Intronic
969834382 4:9828141-9828163 CAACAAAAACACTTGGAGGCAGG + Intronic
970654848 4:18219503-18219525 CAATAAAAACACATGGACACAGG - Intergenic
970998544 4:22295963-22295985 CAATAAGAATACATGGACACAGG + Intergenic
972008321 4:34140666-34140688 CTATAAAAATACATGGTGTAAGG + Intergenic
972462504 4:39317858-39317880 CTATACAAAGAAATGGCGGCCGG + Intronic
973146153 4:46830027-46830049 CTATAAAAATGGATAGAGGCCGG + Intronic
973226366 4:47789722-47789744 CTATAAAAATGCTAAGAGGCCGG + Intronic
973314037 4:48741109-48741131 CCATAAAAAGCCATGGAGGCCGG + Intronic
973678766 4:53293924-53293946 CAATTAAAATACATGGACACAGG - Intronic
973873991 4:55195912-55195934 CAATAAGAACACATGGAGTCAGG + Intergenic
974062205 4:57045534-57045556 CTCTTAGAGTACATGGAGGCGGG + Intronic
974440057 4:61904063-61904085 TTATAAAAATATTTGTAGGCTGG - Intronic
975339927 4:73227447-73227469 CTATAAAATTAGGTTGAGGCTGG - Intronic
976595172 4:86889051-86889073 AAACAAAAAAACATGGAGGCCGG + Intronic
978227206 4:106351314-106351336 CCATAAAAATATTTGGAGGAAGG + Intergenic
979575068 4:122280512-122280534 TAATAAAAATACGTGGTGGCAGG + Intronic
981752657 4:148107793-148107815 CAATAAAAACACATGGACACAGG + Intronic
982528813 4:156511819-156511841 CTATAAGAACACATGGACACAGG + Intergenic
982731694 4:158963137-158963159 ATTTAAAAATCCATGCAGGCAGG + Intronic
982744727 4:159094763-159094785 CTAGAAAAAAAAATGCAGGCCGG - Intergenic
982744750 4:159094895-159094917 CTAGAAAAAAAAATGCAGGCCGG - Intergenic
982900219 4:160989489-160989511 CTTTAAAATTACATGGAAGAGGG - Intergenic
983329947 4:166313029-166313051 TAATAAAAACACATGCAGGCTGG - Intergenic
983353176 4:166620661-166620683 CCATAAAAATACACGCAGGAAGG - Intergenic
984281116 4:177672009-177672031 CTATAAAAATGGTTGAAGGCTGG - Intergenic
1202753338 4_GL000008v2_random:30265-30287 CAATGAGAATACATGGATGCAGG + Intergenic
986288613 5:6379439-6379461 TTATAAAACAAGATGGAGGCTGG + Intergenic
987131124 5:14861072-14861094 CTTAAAAAATATATGTAGGCCGG - Intronic
987492186 5:18595172-18595194 CTATAAAGAAACAGGGAGACTGG + Intergenic
987563085 5:19549449-19549471 CTATAAAAATACCTGAAGCTGGG - Intronic
987639533 5:20594865-20594887 CAATGAAAACACATGGACGCAGG - Intergenic
987790581 5:22562019-22562041 ATTTAAACATACATAGAGGCCGG + Intronic
987966924 5:24889435-24889457 CTATAAAAATACTGTGAGACTGG - Intergenic
988570099 5:32356713-32356735 TAATAAAAATACTTGGAGGCCGG - Intronic
990313381 5:54561335-54561357 TTAAAAAAATAAAAGGAGGCCGG - Intergenic
990734808 5:58848150-58848172 ATATAAAAATTTATGGAGGCTGG - Intronic
991379217 5:66002008-66002030 CAATCAGAATACATGGACGCAGG - Intronic
993475260 5:88356613-88356635 CCATAAAAAGGCATGGAGGAAGG - Intergenic
993477153 5:88379956-88379978 CTTTAAAAATAAAAGTAGGCTGG - Intergenic
993562638 5:89429822-89429844 GTATAGAATTACATTGAGGCTGG - Intergenic
994049117 5:95342850-95342872 CAATAAGAATACATGGACACAGG - Intergenic
994580913 5:101640818-101640840 CTATAATACTATATGCAGGCAGG + Intergenic
995336964 5:111010806-111010828 CTTATAAAATACATGGGGGCTGG - Intergenic
995734793 5:115288275-115288297 TTTTAAAAGTACATGGTGGCTGG - Intronic
996049526 5:118916367-118916389 CTATTAAAAGACATTAAGGCCGG + Intronic
996877531 5:128255730-128255752 TTTTAAAAAAAAATGGAGGCTGG + Intergenic
997480566 5:134181283-134181305 CTTTAAAATTTCATGCAGGCTGG + Intronic
998918370 5:147040865-147040887 ATTTAAAAATACCTTGAGGCTGG + Intronic
999137362 5:149331322-149331344 AAATAAAAATAAATTGAGGCTGG + Intronic
999510067 5:152240912-152240934 CAATAAGAATACATGGACACAGG + Intergenic
1000222303 5:159225461-159225483 CTATTAAAATACAAACAGGCCGG - Intergenic
1000414751 5:160972118-160972140 CTTTAAAAAAAAATGGAGCCAGG - Intergenic
1000570600 5:162908797-162908819 CTATAAAAATATATAGATGGGGG + Intergenic
1000733863 5:164873743-164873765 CCACAAAAAGACATGGAGGAAGG + Intergenic
1001848772 5:174944541-174944563 CAGTAAAAAGACATGGAGGATGG + Intergenic
1002367771 5:178726594-178726616 CTATAAAAAGCCATGTAGGCTGG - Intronic
1002444799 5:179283619-179283641 ATATAACAATAAATGTAGGCTGG + Intronic
1003380845 6:5623415-5623437 TTAAAAAAATACTTGTAGGCCGG + Intronic
1003537787 6:6990802-6990824 CCTCAAAAATACATGGGGGCTGG - Intergenic
1004884620 6:20039652-20039674 CTATAAAAACAGAATGAGGCCGG + Intergenic
1005119703 6:22376364-22376386 CAATAAAAAAACATGGACACAGG - Intergenic
1007671329 6:43556830-43556852 CAATAAAAAGAAATGAAGGCCGG + Intronic
1007844943 6:44746106-44746128 CTATAAAAACACATGCAGCCGGG - Intergenic
1008069986 6:47089793-47089815 CAATAAAAACACATGGACACAGG + Intergenic
1008824264 6:55673201-55673223 GTATAAATATGCAAGGAGGCAGG + Intergenic
1009000405 6:57706330-57706352 CAATGAAAACACATGGACGCAGG + Intergenic
1009665089 6:66667590-66667612 CTTTCAAAATTCATGGAAGCTGG - Intergenic
1009708289 6:67284319-67284341 CAATAAAAACACATGGACACAGG + Intergenic
1009808217 6:68629557-68629579 TTAAAAAAATAAAAGGAGGCCGG + Intergenic
1010032310 6:71284115-71284137 CTATAATAAAAAATGCAGGCTGG + Intergenic
1010038203 6:71351076-71351098 CTTTACATTTACATGGAGGCAGG - Intergenic
1010375434 6:75163459-75163481 CAATAAGAATACATGGACACAGG + Intronic
1010633799 6:78231753-78231775 CAATAAAAACACATGGACACAGG - Intergenic
1011910217 6:92426448-92426470 AAAAAAAAATACAAGGAGGCCGG - Intergenic
1012231556 6:96766106-96766128 CTTTAAATATACAAGTAGGCTGG - Intergenic
1012400473 6:98838548-98838570 AAATAAATATACATTGAGGCAGG - Exonic
1012958551 6:105597262-105597284 ATATCAAAATATATAGAGGCCGG - Intergenic
1013178516 6:107698544-107698566 CAGCAAAAAAACATGGAGGCAGG + Intergenic
1013447057 6:110240440-110240462 CTTTATAACTATATGGAGGCTGG - Intronic
1013529970 6:111009967-111009989 CTTTTAAAAATCATGGAGGCTGG - Intronic
1013930245 6:115522035-115522057 CAATGAAAATACATGGACACAGG + Intergenic
1015287372 6:131501984-131502006 CTATGAAAAAACATCGAGACTGG - Intergenic
1015338882 6:132074724-132074746 GTACAAAAATGCATGGGGGCAGG - Intergenic
1016152481 6:140759716-140759738 TTACAAAAATACATGGGGGCTGG + Intergenic
1016922779 6:149312657-149312679 GTTTCAAAACACATGGAGGCAGG - Intronic
1017119452 6:151009930-151009952 CTCTGAAGATGCATGGAGGCGGG + Exonic
1017480690 6:154851310-154851332 TTAAAAAAATACAGGAAGGCTGG - Intronic
1018780012 6:167054773-167054795 GTAGAAAAATAAATGTAGGCCGG - Intergenic
1020285677 7:6678138-6678160 CTATTAAGATACAAAGAGGCCGG - Intergenic
1021170381 7:17392135-17392157 CTATAAAAGAACATTGAGACTGG + Intergenic
1021397927 7:20173134-20173156 TTATAAAAATAAATGAAGCCTGG - Intronic
1021721474 7:23508792-23508814 CTACAAAAATAAATGCATGCAGG - Intronic
1022126280 7:27360770-27360792 ATATAAAAATGAATGGTGGCTGG + Intergenic
1022855248 7:34307748-34307770 CTATAAAAATATAAGGAGTGTGG + Intergenic
1022961925 7:35435393-35435415 TTTTAAAAATACACAGAGGCCGG + Intergenic
1023567170 7:41534810-41534832 CTATTAAAAATCATAGAGGCTGG - Intergenic
1024162548 7:46692098-46692120 ATATAAAAAAAATTGGAGGCTGG + Intronic
1024489347 7:49960121-49960143 CTATTAAAAAACACAGAGGCCGG + Intronic
1024515507 7:50251038-50251060 CTACAAAAATAGATGGCAGCTGG - Intergenic
1025870518 7:65428263-65428285 CAATAAGAATACATGGACACTGG + Intergenic
1025931930 7:66002235-66002257 CAATAAAATTTCATGGCGGCTGG + Intergenic
1027899570 7:84093743-84093765 CAATGAGAATACATGGACGCAGG + Intronic
1028046415 7:86126278-86126300 TGATAAAAATACAAAGAGGCCGG + Intergenic
1028170923 7:87594813-87594835 CTATAAAAATAGTTGTAGGTAGG - Intronic
1028768411 7:94586796-94586818 ATTTAAAACTAAATGGAGGCTGG - Intronic
1028947484 7:96596985-96597007 CTATAAAATTACACTGAAGCTGG + Intronic
1029682057 7:102118112-102118134 CTAATAAAATACATGTAGGTTGG - Intronic
1030465686 7:109900877-109900899 TTATAAAAATACATGGACACAGG + Intergenic
1030478075 7:110062867-110062889 CAGTAAAAATACATGGAGCAAGG - Intergenic
1030885673 7:114933551-114933573 TTATAAAAAGGAATGGAGGCTGG - Intronic
1031252155 7:119398432-119398454 CCATAATTATAGATGGAGGCGGG - Intergenic
1031306506 7:120133458-120133480 CTAAAAAAATACAGGAAGGAAGG + Intergenic
1031506619 7:122592784-122592806 CAATAAGAATACATGGACACAGG + Intronic
1031610805 7:123824780-123824802 CTGTTAAATTACATGAAGGCAGG + Intergenic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1032440648 7:131940653-131940675 GTCAAAAACTACATGGAGGCTGG + Intergenic
1032476541 7:132215066-132215088 GCAGAAAATTACATGGAGGCAGG - Intronic
1032978279 7:137251059-137251081 CTTTAAAAATACTTTGAAGCAGG - Intronic
1034082772 7:148295785-148295807 CTTTAAAAATTAATTGAGGCCGG - Intronic
1034652438 7:152702060-152702082 TATTAAAAACACATGGAGGCTGG - Intergenic
1034752776 7:153586512-153586534 CAATGAAAACACATGGGGGCAGG - Intergenic
1035158097 7:156930396-156930418 CTTTAAAAATGCATTTAGGCTGG - Intergenic
1036468356 8:9024719-9024741 CTATAAAAACATAAAGAGGCTGG - Intronic
1038063794 8:23940441-23940463 AGATGAAAATACAAGGAGGCTGG - Intergenic
1038472212 8:27834595-27834617 CTATGAAAATAAAATGAGGCCGG + Intronic
1038846827 8:31237772-31237794 CTATGAAAACACATGGACACAGG - Intergenic
1040122370 8:43697362-43697384 ATATCAAATTACTTGGAGGCAGG - Intergenic
1040370104 8:46761626-46761648 CTATAACAATACATGCAAGTAGG - Intergenic
1040450160 8:47538246-47538268 CTATGAAAATAAATTAAGGCTGG + Intronic
1040659688 8:49556915-49556937 ATAAAGAAATACAAGGAGGCTGG + Intergenic
1040677328 8:49766117-49766139 CTATAAAGATACATGAAGATGGG + Intergenic
1040778970 8:51083367-51083389 CTTGAAAAATAAATAGAGGCCGG - Intergenic
1041384678 8:57288414-57288436 CTTTAAAAATTCAAGGAGGAGGG - Intergenic
1041870595 8:62630297-62630319 CTATAAAAACATATGTAGGATGG + Intronic
1042240324 8:66657199-66657221 CTTTAAAAATACATTTTGGCTGG - Intronic
1042276261 8:67008153-67008175 CAATAATAATAAATGGAGGCTGG - Intronic
1042369496 8:67975339-67975361 CTATATAAGTACCTGTAGGCAGG + Intronic
1042814168 8:72860013-72860035 CAATAAAAAGAAATGAAGGCCGG - Intronic
1043104089 8:76085929-76085951 CTATATAAATACATGGAAGAAGG - Intergenic
1043585544 8:81765080-81765102 CTATAAATATACATGATGACAGG - Intergenic
1045715545 8:105039474-105039496 CAATTAAAATACATGGACACAGG + Intronic
1046026560 8:108730924-108730946 TTATAAGAACACATGGTGGCAGG - Intronic
1046911223 8:119629751-119629773 CCATAAGAAACCATGGAGGCAGG + Intronic
1047316325 8:123737155-123737177 CTTTTAAAATGCATTGAGGCCGG - Intronic
1047612968 8:126539071-126539093 ATTTAAAAATAGATGCAGGCCGG + Intergenic
1047649185 8:126901205-126901227 CTTTAAAAAAAGATGGAGGCTGG + Intergenic
1047907916 8:129492694-129492716 CAACAAAAATACATGGACACGGG + Intergenic
1047999729 8:130368466-130368488 CTAGAAAATTACCTGGAGTCAGG - Intronic
1048231206 8:132643582-132643604 ATATGAAAATACACGGAGGGTGG + Intronic
1049898313 9:132225-132247 ATGTAAAAATACATTGAGGCCGG + Intronic
1050343524 9:4663664-4663686 CTGTAAATATACATGCAGACAGG + Exonic
1050510111 9:6385248-6385270 CAATAAAAAGACATAGAGGCTGG + Intergenic
1051033365 9:12711493-12711515 ATTTAAAAATACATATAGGCTGG + Intergenic
1051048579 9:12904907-12904929 CTAGGAAAAGACATGAAGGCTGG + Intergenic
1051112654 9:13657021-13657043 TTTTAAAAATACACTGAGGCTGG + Intergenic
1051228849 9:14932236-14932258 CTAAAAACATACATTGAGGCTGG - Intergenic
1051579034 9:18650540-18650562 CAATAAAATTCCATGGAGGAGGG - Intronic
1051776283 9:20637651-20637673 CTATAAAAAGACATAGAGAGAGG + Intergenic
1051952737 9:22656582-22656604 CTATGAAAATCAATGGAGTCTGG - Intergenic
1052649785 9:31287587-31287609 CGATAAGAACACATGGACGCAGG + Intergenic
1053528284 9:38852003-38852025 GTTTAAAAATGCATGCAGGCCGG + Intergenic
1053563329 9:39219578-39219600 TTAGAAAAATACCTAGAGGCTGG - Intronic
1053741376 9:41142505-41142527 ATGTAAAAATACATTGAGGCCGG + Intronic
1053829118 9:42057499-42057521 TTAGAAAAATACCTAGAGGCTGG - Intronic
1054133818 9:61399488-61399510 TTAGAAAAATACCTAGAGGCTGG + Intergenic
1054200506 9:62076436-62076458 GTTTAAAAATGCATGCAGGCCGG + Intergenic
1054346588 9:63972008-63972030 ATGTAAAAATACATTGAGGCCGG + Intergenic
1054444365 9:65298657-65298679 ATGTAAAAATACATTGAGGCCGG + Intergenic
1054485907 9:65722848-65722870 ATGTAAAAATACATTGAGGCCGG - Intronic
1054601443 9:67129948-67129970 TTAGAAAAATACCTAGAGGCTGG + Intergenic
1054637850 9:67511925-67511947 GTTTAAAAATGCATGCAGGCCGG - Intergenic
1054686973 9:68288789-68288811 ATGTAAAAATACATTGAGGCCGG - Intronic
1054749794 9:68893626-68893648 ATTTAAAAAAACAGGGAGGCTGG - Intronic
1054897590 9:70330837-70330859 CTACAAAGTTACATGTAGGCTGG - Intronic
1054960994 9:70969221-70969243 CAATAAGAATACATGGACACAGG + Intronic
1055694801 9:78872334-78872356 ATATAAAAATATATGCAGGTTGG + Intergenic
1056198136 9:84248643-84248665 CAATGAGAATACATGGACGCAGG + Intergenic
1057754268 9:97819292-97819314 GTAGAAAAATATCTGGAGGCTGG + Intergenic
1057771364 9:97970984-97971006 CTAAAAAGAAACCTGGAGGCCGG + Intergenic
1058156856 9:101525409-101525431 CTATGAAAATAAATGTTGGCGGG + Intronic
1058545233 9:106053989-106054011 CAATAAGAATACATGGACACAGG - Intergenic
1059080089 9:111239520-111239542 CTATAAAAATAATTGGACACCGG - Intergenic
1059109716 9:111544153-111544175 CTAGGAAAATAGATGGGGGCTGG + Exonic
1060693658 9:125687477-125687499 CTATAAAACAAAATAGAGGCTGG + Intronic
1061156203 9:128863334-128863356 TAATAATAATTCATGGAGGCTGG + Intronic
1203692751 Un_GL000214v1:60877-60899 CTATAAGAACACATGGACTCGGG + Intergenic
1203556936 Un_KI270744v1:7769-7791 CTATAAGAACACATGGACTCGGG + Intergenic
1203643544 Un_KI270751v1:43314-43336 CTATAAGAACACATGGACTCGGG - Intergenic
1185789260 X:2916191-2916213 CCATAAAAAAGAATGGAGGCTGG + Intronic
1186382836 X:9078966-9078988 CTCAAAAATTATATGGAGGCTGG + Intronic
1187293823 X:17979919-17979941 CAATGAAAACACATGGATGCAGG - Intergenic
1189160070 X:38802345-38802367 AAAGAAAAATACAGGGAGGCAGG - Intronic
1189914896 X:45847365-45847387 CTTAAAAAATAAATGGAAGCTGG - Intergenic
1190101390 X:47525076-47525098 ATAGAAGAATAAATGGAGGCTGG - Intergenic
1190238917 X:48641500-48641522 ATTTAAAAATAAATGTAGGCCGG - Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1190339998 X:49288837-49288859 CTTTAAGAATACAATGAGGCAGG + Intronic
1190411776 X:50143700-50143722 CTATAAAAACACATTGAGTTTGG + Intergenic
1191056081 X:56242737-56242759 CCACAAAAATAAATGAAGGCTGG - Intronic
1191657823 X:63617726-63617748 CAATAAGAATACATGGACACAGG + Intergenic
1192392023 X:70739704-70739726 CTTTAAAAATAGATTCAGGCTGG - Intronic
1193275592 X:79583824-79583846 CTAGAAAAATACTTTAAGGCCGG + Intergenic
1193292183 X:79788169-79788191 CAATAAGAATACATGGACGCAGG - Intergenic
1194771211 X:97908360-97908382 TTATAAGAAGACAAGGAGGCCGG + Intergenic
1194986954 X:100501118-100501140 CTATGAGAATACATGGACACAGG - Intergenic
1195267362 X:103195831-103195853 CTTTAAAAATAGATAGTGGCCGG + Intergenic
1195321717 X:103726559-103726581 CTCTGAAAATCCAAGGAGGCTGG + Intronic
1195506341 X:105661632-105661654 CTATAAAAATACATGGAGGCTGG + Intronic
1195631547 X:107060621-107060643 CAATAAAAAAAAATGGAGGCAGG - Intergenic
1195812128 X:108845846-108845868 CAATAAGAATACATGGATACAGG + Intergenic
1196499653 X:116364963-116364985 CAATAAAAACACATGGACACAGG + Intergenic
1198063408 X:133070918-133070940 CTATAAAATTAAATGGTGGCCGG + Intronic
1198543948 X:137671621-137671643 TTATAAAGATACATGTGGGCTGG - Intergenic
1199085611 X:143626924-143626946 CTATATATATATATGCAGGCAGG + Exonic
1200847646 Y:7848679-7848701 CTTGAAAACAACATGGAGGCAGG + Intergenic
1201492836 Y:14561274-14561296 CAATGAGAATACATGGAGACAGG - Intronic
1201760275 Y:17529679-17529701 CTATAAAAATAGTTGGTGACTGG + Intergenic
1201841279 Y:18376311-18376333 CTATAAAAATAGTTGGTGACTGG - Intergenic
1202595725 Y:26537505-26537527 CCATAAAGACACATGTAGGCTGG + Intergenic