ID: 1195508030

View in Genome Browser
Species Human (GRCh38)
Location X:105681248-105681270
Sequence GAGAACAAGGAGGAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1581
Summary {0: 1, 1: 0, 2: 7, 3: 163, 4: 1410}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195508020_1195508030 23 Left 1195508020 X:105681202-105681224 CCTCTTTGGAGAAGAGGAATTCT 0: 1
1: 6
2: 34
3: 111
4: 403
Right 1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG 0: 1
1: 0
2: 7
3: 163
4: 1410
1195508026_1195508030 -5 Left 1195508026 X:105681230-105681252 CCATGACTTGCTTTGGGGGAGAA 0: 1
1: 2
2: 10
3: 31
4: 189
Right 1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG 0: 1
1: 0
2: 7
3: 163
4: 1410
1195508019_1195508030 24 Left 1195508019 X:105681201-105681223 CCCTCTTTGGAGAAGAGGAATTC 0: 1
1: 1
2: 12
3: 93
4: 409
Right 1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG 0: 1
1: 0
2: 7
3: 163
4: 1410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195508030 Original CRISPR GAGAACAAGGAGGAGGAGAC AGG Intronic
900247119 1:1641697-1641719 GAAGAGGAGGAGGAGGAGACCGG - Exonic
900258343 1:1708829-1708851 GAAGAGGAGGAGGAGGAGACCGG - Exonic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
900623406 1:3597434-3597456 CAGAACAAGCAGCGGGAGACAGG - Intronic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901150192 1:7096241-7096263 GGAAACCAGGAGGAGGAGAGTGG - Intronic
901159370 1:7163322-7163344 GAGACCAAGGAGCGGGAGGCCGG + Intronic
901629750 1:10642296-10642318 GAGGAGGAGGAGGAGGAGCCGGG + Intronic
901644011 1:10706958-10706980 GAGAGGATGGAGGAGGAGGCCGG + Intronic
901735676 1:11310630-11310652 GAGAAGGAGGAGGAGCAGAAAGG - Intergenic
901829354 1:11882811-11882833 GAGGAGAGGGAGGAGGAGATGGG - Intergenic
902371274 1:16008553-16008575 GAGGCCAAGGAGGGGGAGGCGGG + Exonic
902554521 1:17239078-17239100 GAGAGGAAGGAGGAGAAGCCAGG + Intronic
902688989 1:18097900-18097922 GAGAAAGAGGAGGAGGTGTCAGG - Intergenic
902792000 1:18775718-18775740 AAGCTGAAGGAGGAGGAGACAGG - Intergenic
902961569 1:19967053-19967075 GAGAAGGAGGAGGAGGAAACAGG - Intergenic
903004772 1:20291418-20291440 GAGAAGAGGGAGCAGGAGAAGGG - Intronic
903281038 1:22250200-22250222 CAGGACCAGGAGGAGGAGCCGGG + Intergenic
903337226 1:22633269-22633291 GAGGAGGAGGAGGAGGAGACTGG + Intergenic
903363286 1:22790568-22790590 GAGAACAGGGATCTGGAGACAGG - Intronic
903389922 1:22956389-22956411 GAGAAAGAGGAGGAGGAGGAAGG + Intronic
903879916 1:26501240-26501262 GAGGGGAAGGGGGAGGAGACAGG + Intergenic
904045519 1:27606037-27606059 GAGAGAAAGGAGGAGGAACCTGG - Intergenic
904053549 1:27655711-27655733 GGGAAGACAGAGGAGGAGACAGG + Intergenic
904355660 1:29937445-29937467 AAGAGCTAGGAGAAGGAGACTGG + Intergenic
904362990 1:29990568-29990590 CAGATTAAGGAGGTGGAGACAGG - Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904715254 1:32463176-32463198 GAGGACGAGGAGGAGGAGAGAGG - Intergenic
904867946 1:33596701-33596723 GAGAACAGGATGGAGGAAACTGG + Intronic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905258786 1:36703088-36703110 GAGAAAGAGGAGGAGGTGCCAGG + Intergenic
905462016 1:38128117-38128139 GAGGACAAGGAGGGGGAGGAAGG + Intergenic
905587669 1:39133530-39133552 GAGGAGGAGGAGGAGGAGAAAGG - Intronic
905791009 1:40789533-40789555 GAGTGCAAGGAGGAGGAGGAAGG - Intronic
905971693 1:42146631-42146653 GAGAACTACAAGGAGGACACGGG - Intergenic
906066510 1:42984849-42984871 GGGAAGAAGGAGGAGGAGCGGGG + Intergenic
906127383 1:43435454-43435476 GAGAGCAAGGAGGATAGGACAGG + Intronic
906180847 1:43817597-43817619 GAGAAGGAGGAGAAGGAGAAGGG - Intronic
906180854 1:43817625-43817647 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906414934 1:45614105-45614127 GAAAATGAGGAGGAGGAGATTGG + Exonic
906415360 1:45617574-45617596 GAAAACATGGAGGAGGAGGTGGG + Exonic
906606734 1:47178010-47178032 GAGAAAAAGGGGAATGAGACAGG - Intergenic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906708071 1:47909495-47909517 GAGAAGGAGGAGAAGGAGAAGGG + Intronic
906776683 1:48536114-48536136 GAGAACATGGACAAGGAAACAGG + Intronic
906803089 1:48754577-48754599 GAGAAAAAGGAAAAGGGGACTGG + Intronic
907144945 1:52223271-52223293 GGGAACAGGGAGGGGGAGAAGGG - Intronic
907611895 1:55879574-55879596 GAGAAGAGGGATGAGAAGACAGG - Intergenic
907621300 1:55983482-55983504 GGGAAGAAAGAGGAGGAGAGGGG + Intergenic
907650731 1:56292307-56292329 GAGAAAAATGAGGTGGAGAAGGG - Intergenic
907858495 1:58327318-58327340 GAGAAGGAAGAGGAGGAGGCAGG + Intronic
908349165 1:63267111-63267133 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
908553614 1:65234581-65234603 GACCACAAGGAGTTGGAGACAGG + Intergenic
908812890 1:68002011-68002033 GAGGAGAAGGAGGAGGAGAAAGG - Intergenic
908903573 1:68983174-68983196 GAGAAAAGGGGGCAGGAGACAGG + Intergenic
909686550 1:78355217-78355239 CAAAAAAAGGAGGAGGAGAAAGG - Intronic
909740476 1:79023649-79023671 GAGAAAAAGGAGCAGGTGAAAGG - Intergenic
909754120 1:79201811-79201833 GAGGAGGAGGAGGAGGAGAAAGG + Intergenic
909787645 1:79635823-79635845 GTGGAGAAAGAGGAGGAGACAGG + Intergenic
909862792 1:80630134-80630156 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
909957841 1:81801332-81801354 GGGAAGGAGGAGGAGGAGGCTGG + Intronic
909975926 1:82046154-82046176 GTGAAAAAGGAAGAGGAGGCAGG - Intergenic
910033321 1:82759024-82759046 GAGAAACAGGAGGAGGAAGCAGG - Intergenic
910080062 1:83330987-83331009 AAGAACTTGGAGGAGGAGAATGG - Intergenic
910241637 1:85093040-85093062 AAAATAAAGGAGGAGGAGACAGG + Intronic
910663272 1:89696493-89696515 GAGAAGAGGGAGGAAGAGAGAGG + Intronic
910664324 1:89708097-89708119 GAGAAAAAGGGGGAAGAAACTGG - Intronic
911023761 1:93414920-93414942 AAGAAGGAGGAGGAGGAGAAAGG + Intergenic
911709547 1:101054298-101054320 GTGAAGAAGGAAGACGAGACTGG + Intergenic
912551932 1:110490293-110490315 AAGAAGGAGGAGGAGGAGCCCGG - Intergenic
912749190 1:112271502-112271524 GAGAAGACGGAGGCGGAGATTGG - Intergenic
912850947 1:113123918-113123940 GGGAAAAAGGAGGATGAGGCAGG - Exonic
912961423 1:114198810-114198832 GAGAAAATGGAGGATCAGACTGG + Intergenic
913070227 1:115292005-115292027 GAGATGGAGGAGGAGGAGGCTGG - Intronic
913122926 1:115758348-115758370 GAGAAGAGGAAGGAGGAGAAGGG - Intronic
913245905 1:116869735-116869757 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
913384187 1:118241713-118241735 GAGAAAAAGAGGGAGGAGTCAGG - Intergenic
913961312 1:143339847-143339869 GAGGACAAGAAGGGGGAGATGGG + Intergenic
914055665 1:144165420-144165442 GAGGACAAGAAGGGGGAGATGGG + Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914123481 1:144800942-144800964 GAGGACAAGAAGGGGGAGATGGG - Intergenic
914263615 1:146019622-146019644 GAGGAGGAGGAGGAGGAGGCCGG - Exonic
914764920 1:150629427-150629449 GAGAACCCTGCGGAGGAGACCGG - Exonic
914857275 1:151361980-151362002 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915460979 1:156070526-156070548 GAGAAGAGGGAGGAACAGACGGG - Intergenic
915507444 1:156366795-156366817 GAAAACAAGGAGGAGTAGGCTGG - Intronic
915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG + Intronic
915743477 1:158138175-158138197 GAGGATAAGGAGGAAGAGATGGG - Intergenic
915751133 1:158212465-158212487 GAGAACAGTGAGGCGGAGCCAGG - Intergenic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916007325 1:160674456-160674478 GAGAAGATGGTGGAGGAGAGAGG + Intergenic
916412363 1:164559079-164559101 GAGGACGAGAAGGAGGAGAGGGG - Intronic
916895650 1:169159296-169159318 GGTACCAAGGAGGAGGAGACTGG + Intronic
917803567 1:178593467-178593489 GAGAAGCAGAAGGAGGAAACAGG - Intergenic
917952855 1:180058558-180058580 GAGAGGAAGGAGGAAGAGATTGG + Intronic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
918388542 1:184036161-184036183 GAGGACAAGGAGGTGGATGCTGG - Intronic
918632780 1:186738551-186738573 GAGAATTAGGAGCAGGAAACTGG - Intergenic
919257454 1:195142377-195142399 AAGAAGGAGGAGGAGGAGAAAGG - Intergenic
919491036 1:198205034-198205056 GAGAAGAAGGAAGGGGGGACGGG - Intronic
920088843 1:203437985-203438007 GAGAAGTAGGATGAGGGGACAGG - Intergenic
920089540 1:203442477-203442499 GGAAAGAAGGAGGAGGAGAGAGG - Intergenic
920182746 1:204142666-204142688 GAGAAGGATGAGGATGAGACCGG + Intronic
920313434 1:205061712-205061734 GAGGACAAAGAGGAGGGGGCCGG - Intronic
920400828 1:205675388-205675410 GAGAATAAGGGGTAAGAGACAGG + Intronic
920503667 1:206501389-206501411 CAGAGCACAGAGGAGGAGACAGG + Intergenic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921163224 1:212487511-212487533 GGGAGCAAGGAGGAGGAGAGAGG - Intergenic
921326370 1:213989131-213989153 GGGAACTGGGAGGAGGAGAGAGG + Intronic
921397088 1:214679865-214679887 GAGGAGGAGGAGGAGGAGAAGGG - Intergenic
921490479 1:215769843-215769865 AAGAACCAGGAGGATGAGAGTGG + Intronic
921671350 1:217927265-217927287 GAGAGCAAAGAGAAGGAGAGTGG + Intergenic
921921286 1:220672916-220672938 GAGGAGAAGGAGGAGGGGAAAGG + Intergenic
922272893 1:224050834-224050856 CAGAACAAGGAGGACCAGATGGG + Intergenic
922754652 1:228089011-228089033 GAGAACACGCAGGAGGAGGCTGG + Intronic
922766289 1:228158215-228158237 GAGGAGGAGGAGGAGGAGACGGG + Exonic
922804497 1:228378431-228378453 GGGGAGAAGGAGGAGGAGAGGGG - Intronic
922936293 1:229425710-229425732 GAGAAGAAAGAGGAGGAGGGGGG + Intergenic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923145941 1:231197871-231197893 GAGAAGAAGGAGAAGAAGAAAGG + Intronic
923517732 1:234711607-234711629 GGGAAGAAGGAGGAGGAGGATGG - Intergenic
923834144 1:237591163-237591185 GAGAAGGGGGAGGAGGAGAAGGG - Intronic
923834150 1:237591178-237591200 GAGAAGGGGGAGGAGGAGAAGGG - Intronic
923834156 1:237591193-237591215 GAGAAGGGGGAGGAGGAGAAGGG - Intronic
923834162 1:237591208-237591230 GAGAAGGGGGAGGAGGAGAAGGG - Intronic
923908047 1:238407864-238407886 GTGAAGAAAGAGGAAGAGACAGG + Intergenic
924010743 1:239662951-239662973 GAGGAGAAGGAAGAGGAGAAAGG - Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924928098 1:248703101-248703123 GAGAACAAGGAGGTGAAGATGGG - Intergenic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1063039031 10:2317965-2317987 AGGCACAAGGAGGAGGACACAGG + Intergenic
1063105375 10:2987511-2987533 GAGAAAAAAGAGGAAGAGAGAGG - Intergenic
1063373576 10:5538068-5538090 GAGAAGGAGGAGGAGGACAAAGG - Intergenic
1063379711 10:5576720-5576742 GGGGACAAGGAGGAGCAGTCAGG + Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063729639 10:8681617-8681639 GAGAAGGAGGAGAAGGAGAAGGG - Intergenic
1064001277 10:11665561-11665583 GAGGAGGAGGAGGAGGAGGCCGG - Intergenic
1064305127 10:14158639-14158661 GAGGAGAAGGAGGAGGAGAAGGG + Intronic
1064515880 10:16147378-16147400 GAGAGGAAGGAAGAGGAGAAAGG + Intergenic
1064759214 10:18601553-18601575 CAGAACTAGGAGCAGGAAACAGG + Intronic
1064850843 10:19707077-19707099 GAGGAAGAGGAGGAGGAGAAGGG - Intronic
1065205228 10:23350995-23351017 AAGAAGGAGGAGGAGGAGAAGGG - Intergenic
1065768442 10:29053912-29053934 GAGAACAAGAAGCAGGTGAGAGG + Intergenic
1065850427 10:29783131-29783153 AATAAAAAGGAGGAAGAGACAGG - Intergenic
1066109823 10:32185964-32185986 GGGAACAGGGAAGAGGGGACAGG + Intergenic
1066242976 10:33555783-33555805 GAAAGCAAGGAGGAGGTGCCAGG - Intergenic
1066264424 10:33761923-33761945 AAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1067029762 10:42872245-42872267 GAGGACAAGAAGGGGGAGATGGG + Intergenic
1067246408 10:44550329-44550351 GACACCAAGCAGGAGGAGAGAGG + Intergenic
1067558167 10:47286648-47286670 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1067656511 10:48196191-48196213 GAGACCAGAGAGGAGGAGTCAGG + Intronic
1067820418 10:49524089-49524111 GAGAAGGAGGAGGAGGAGGTCGG - Exonic
1068316522 10:55350994-55351016 GAGAGGGAGGGGGAGGAGACAGG - Intronic
1068652987 10:59543000-59543022 GTGAAGATGGAGGTGGAGACTGG - Intergenic
1068803753 10:61171666-61171688 AAGAAAAATGAGGAGGGGACTGG + Intergenic
1069634647 10:69917909-69917931 GAGGAGGAGGAGGAGGAGATGGG - Intronic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069677586 10:70259701-70259723 GAGAACAAGGAGGAGGGGATGGG + Intronic
1069772361 10:70907864-70907886 GAGACCAGGGAGGAGGACAGAGG - Intergenic
1069845612 10:71368819-71368841 GAGAAAATGGAGGAGGGGATTGG - Intergenic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1069942342 10:71964333-71964355 GAGGAGGAGGAGGAGGAGAAGGG + Intergenic
1069999307 10:72364491-72364513 AACAGGAAGGAGGAGGAGACAGG - Intergenic
1070326122 10:75390395-75390417 GAGAAAAAGGAAGAGGAGGAGGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070469416 10:76764047-76764069 GAGAAGGAGGAGGAAGAGAGAGG + Intergenic
1070543837 10:77437288-77437310 GAGAAAAAGGAAGGGGAGAGTGG + Intronic
1070680551 10:78446080-78446102 GAGAAGGAGGAGAAGGAGAAGGG + Intergenic
1070802344 10:79251057-79251079 GAGATCGAGGAGGTGAAGACTGG + Intronic
1070810945 10:79297910-79297932 GAAAACAAGGAGAGGGAGAGGGG + Intronic
1071090162 10:81909168-81909190 GTGAAGAAGGAGGTGGAGATTGG - Intronic
1071294178 10:84207250-84207272 GAGAGTGAGGAGGAGGAGAGGGG + Intronic
1071333056 10:84580181-84580203 GGCCACCAGGAGGAGGAGACTGG - Intergenic
1071746594 10:88426742-88426764 GACAGTAAGGAGGAGGAGCCAGG + Intronic
1072068880 10:91897355-91897377 GAGGAGGAGGAGGAGGAGAAAGG + Intergenic
1072407854 10:95171146-95171168 CAGAACAAGGAGGAAGAATCAGG + Intergenic
1072445743 10:95497189-95497211 GTAAACAAGGAGGAGGAGGCAGG + Intronic
1072479572 10:95797659-95797681 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1072497162 10:95973131-95973153 GTGAGCAAGGAGGAGGGGGCGGG + Intronic
1072535296 10:96357947-96357969 GAGAGGAAGGAGGAAGAGACAGG + Intronic
1072543346 10:96414891-96414913 GGGAACAAGGAGGAGGGTATGGG - Intronic
1072711554 10:97718788-97718810 GGGCACAGGGAGGAGGAGCCTGG - Intergenic
1072822953 10:98576525-98576547 GAGGACAAGGAGAAGCAGAGAGG + Intronic
1073060832 10:100732514-100732536 GGGAACAAGGGGGAAGAGAGAGG - Intergenic
1073201546 10:101739844-101739866 GAGGAGAGGGAGGAGGAGAAGGG + Intergenic
1073249851 10:102114746-102114768 GAGAAGGAGGAGGAGGAGAGAGG - Intronic
1073337224 10:102718846-102718868 GAGAGAAAGGAGGTGGAGACAGG - Intronic
1073424813 10:103449971-103449993 GAGAGGAGGCAGGAGGAGACGGG + Exonic
1073443577 10:103567610-103567632 GAGACCTAGGAGTTGGAGACCGG - Intronic
1073448985 10:103598330-103598352 GAGAATAGTGAGGAGGAGAGGGG + Exonic
1073531731 10:104238658-104238680 GAGAAACAGGGGCAGGAGACAGG - Intronic
1073586466 10:104715278-104715300 TAGAACAAAAAGGAGGAGAAAGG + Intronic
1073643409 10:105275683-105275705 GTGAAGATGGAGGTGGAGACTGG - Intergenic
1073784611 10:106875114-106875136 GAGACTCAGGAGGAGGAGAGTGG - Intronic
1073941192 10:108700369-108700391 GAGAAGGAGGAGGAGGAGAAGGG + Intergenic
1074093142 10:110282577-110282599 GGGTACAAGGAGGAGGTAACAGG - Intronic
1074155018 10:110790376-110790398 GAGAGCAAAGAGGAGGAGACAGG + Intronic
1074495968 10:113980479-113980501 TAGAACAGAGAGGTGGAGACAGG - Intergenic
1074561899 10:114542572-114542594 GAGGACGAGGAGGAGGAGGAAGG + Intronic
1074691141 10:116005100-116005122 GAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1075427252 10:122351384-122351406 GAGGCCAAGGAGGAGAAGGCAGG - Intergenic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1076001677 10:126917764-126917786 GGGAAGGAGGAGGAGGAGAGTGG + Intronic
1076251905 10:128991405-128991427 GAGAAAATGGAAGAGGAGATAGG - Intergenic
1076267145 10:129117674-129117696 GAGAAGAAGGACCAAGAGACAGG + Intergenic
1076502066 10:130945060-130945082 GTGAGCAAAGAAGAGGAGACAGG - Intergenic
1076568473 10:131414817-131414839 GGGTCCAAGGAGGAGGCGACTGG + Intergenic
1076777629 10:132706824-132706846 GGGGACCAGGAGAAGGAGACAGG + Intronic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1076909561 10:133380109-133380131 GAGAACCAGCTGGTGGAGACCGG + Exonic
1077280260 11:1741436-1741458 GAGGAGAGGGAGGAGGAGAGCGG + Intronic
1077323949 11:1955496-1955518 GAGAAGAGGGAGGAGGAGTGAGG - Intronic
1077762551 11:5118984-5119006 GAGAAGAGAGAGGAGGAGAGGGG + Intergenic
1077906991 11:6542272-6542294 GAGATCAAGTAGGAGCAGACTGG - Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078025974 11:7696066-7696088 GACAACCATGAGAAGGAGACAGG - Intronic
1078245262 11:9568412-9568434 GAGAACAAGCATAAGGAGAAAGG + Intergenic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1079152408 11:17912170-17912192 GAGAAGATGGTGAAGGAGACAGG + Intronic
1079360305 11:19765418-19765440 AAGAAGGAGGAGGAGGAGAGAGG - Intronic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079703937 11:23589050-23589072 GAGAAGGAGGAGGAGGAGGGAGG + Intergenic
1079926112 11:26493753-26493775 AACAAGAAGGAGGAGGAGAAAGG - Intronic
1080290546 11:30666053-30666075 TAGAACAAGAAGAAGGAGAAGGG + Intergenic
1080786883 11:35483527-35483549 GAGAAGGAGGAGGAGAAGACAGG - Intronic
1080859627 11:36142072-36142094 GTGAAGAAGGGGGAGGCGACTGG - Intronic
1080894730 11:36439730-36439752 GAGAACAAAAAGGAGGAGGAAGG - Intronic
1081060590 11:38470566-38470588 AAGAAAAAGGAGGAGGGGAAGGG - Intergenic
1081354809 11:42099565-42099587 GAGAGCAAGGAGAAGGAGAGTGG + Intergenic
1081896817 11:46593881-46593903 GGGAAAAAGAAAGAGGAGACAGG + Intronic
1081915260 11:46726500-46726522 GAGGCCGTGGAGGAGGAGACAGG + Exonic
1081997578 11:47375227-47375249 GAGAACAGAGAGGAGGAGGTGGG + Intronic
1082892424 11:58154177-58154199 GAGGGGAAGGAGGAGGAGAAGGG + Intronic
1083010650 11:59395204-59395226 GAGGAAATGGAGGGGGAGACAGG - Intergenic
1083264815 11:61541832-61541854 GAGCAGAAGGGGGAGGAGAGAGG + Intronic
1083334215 11:61913408-61913430 GAGACCATGGAGGAGGAGTGGGG + Intronic
1083573431 11:63772133-63772155 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1083813835 11:65120772-65120794 GAGAAGAAGAAGAAGAAGACAGG - Exonic
1083934494 11:65863231-65863253 GAAAACAGGGAGGAGGGGATGGG + Intronic
1084093419 11:66894289-66894311 GAGAACAAAGAGGAGGCAGCTGG - Intronic
1084370210 11:68736784-68736806 GAGAACAAAGAGGAGGAGGAGGG + Intronic
1085040529 11:73323952-73323974 GAGAACAGGGAGAAGGACAGAGG - Intronic
1086056117 11:82649068-82649090 GAGAAGAAGGAGCAGAAGAAAGG - Intergenic
1086426472 11:86688723-86688745 GTGAACAAGGAGAGGGAGAGAGG + Intergenic
1086458656 11:86984108-86984130 GAGATGAAGCAGGAGGAGAGGGG + Intergenic
1086948243 11:92865695-92865717 TAGAACAAGGTGGACGACACAGG + Intronic
1088224003 11:107599096-107599118 GAGGACAAGTAGGAGGAGGTGGG + Intronic
1088423652 11:109676264-109676286 GAAGAGAAGGAGGAGGAGAGAGG - Intergenic
1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG + Intergenic
1088608827 11:111557583-111557605 GACCACAAGGAGGAGGAGAAGGG - Exonic
1088706033 11:112465534-112465556 GAGAACAGGGAGGTGGAAATCGG + Intergenic
1088789383 11:113211053-113211075 GAGAGAAAGGAGGATGAGAAGGG - Intronic
1089170537 11:116508425-116508447 GAGGGCAAGGAGGATTAGACAGG - Intergenic
1089417684 11:118306193-118306215 AAGAAGGAGGAGGAGGAGAAGGG + Intronic
1089513791 11:119018683-119018705 GAGGAGGAGGAGGAGGAGGCTGG + Exonic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089691787 11:120191410-120191432 GAGACCAGGGAGGAGGAAACTGG + Intergenic
1089702327 11:120252970-120252992 GGGAAAAAGGAGGGGGAGCCTGG + Intronic
1090274751 11:125411520-125411542 AAGGACAAGGAGGAAGAGATGGG - Intronic
1090466445 11:126938924-126938946 CAGAACAAGTAGGATGAGACAGG + Intronic
1090697547 11:129263587-129263609 GAGGAGAAGGAGGAGGAAAATGG + Intronic
1091016663 11:132057632-132057654 GAGACCATGAAGGAGAAGACAGG - Intronic
1091282716 11:134391091-134391113 GAGAAAAGGGAGGGGGAGAGAGG + Exonic
1202806935 11_KI270721v1_random:10691-10713 GAGAAGAGGGAGGAGGAGTGAGG - Intergenic
1091796499 12:3300293-3300315 GAGAACACGAAGGAGGGGCCAGG + Intergenic
1091916841 12:4275829-4275851 AAGAACAAAGATGAGGAAACTGG - Intronic
1092053359 12:5489211-5489233 GAATACAGGGAGGAGGACACAGG + Intronic
1092173680 12:6388873-6388895 GGGTACAAGGTGGAGCAGACAGG + Intronic
1092283409 12:7114442-7114464 AAGAACAAGGATGAGGACAACGG + Intergenic
1092452024 12:8611272-8611294 GAGAACAGGGAGCTGGAAACAGG - Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093271768 12:17071572-17071594 GAGTAATAGGAGGAGGAGAAGGG - Intergenic
1093457072 12:19374985-19375007 GAGAAGGAGGAGGAGGAGGAAGG + Intronic
1093530409 12:20155068-20155090 GAGGAGGAGGAGGAGGAGAAAGG + Intergenic
1093535485 12:20218102-20218124 GAGACGAGGGAGGAGGAGATGGG + Intergenic
1093754949 12:22842108-22842130 GAGAAGGAGGAGGAGAAGAAAGG - Intergenic
1094083775 12:26566220-26566242 GAGAAGAAGGAGGAGGAAAGAGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094283644 12:28768255-28768277 GAGAAAAAGGAGAAAGACACTGG + Intergenic
1094487555 12:30937107-30937129 GAGATGAAGCAGGAGGAGATAGG + Intronic
1095296138 12:40529830-40529852 GAGGAAGAGGAGGAGGAGAAAGG - Intronic
1095471725 12:42544055-42544077 GAGAAGAAGGAAGAGAAGAAGGG + Intronic
1095579893 12:43785406-43785428 GGGTACAGGGAGGAGGAGTCAGG + Intronic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1095943649 12:47741399-47741421 GAGAAGAGGGAGGAGGGGCCTGG - Intronic
1096479700 12:51930881-51930903 GAGAAGGAGGAGGAAGAGAAGGG - Intergenic
1096518219 12:52170076-52170098 GAGAGCCAAGAGGAGGAGATAGG + Exonic
1096559318 12:52424435-52424457 GAGAGGAAGGAGGAGGACCCTGG + Exonic
1096660920 12:53123476-53123498 GAAGACAAAGAGGAGGAAACTGG + Intronic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1096973489 12:55685182-55685204 CAGTTCAAGGAGGAGAAGACGGG - Exonic
1096983540 12:55742817-55742839 TAGGAAAAGGAGGAGGAGAGAGG - Intergenic
1097033102 12:56104055-56104077 GAGAACAGGGAGGGGCAGACAGG - Intronic
1097744445 12:63285755-63285777 GAGAACAAGGTGGAGGTGAGTGG - Intergenic
1097894438 12:64810253-64810275 GAAAACATGGAGAAGGAGAATGG - Intronic
1097938381 12:65278487-65278509 GAGAAGGAGGAGGAGGAGGACGG + Intergenic
1097964422 12:65563607-65563629 GAGGACGAGGAGGAGGAGGAGGG + Intergenic
1098009369 12:66034124-66034146 GAGGAGGAGGAGGAGGATACGGG + Intergenic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098200755 12:68052759-68052781 GAGGACAAGGTGTTGGAGACAGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098268427 12:68746601-68746623 GAGGGCCAGGAGGAGGAGCCTGG - Exonic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098495903 12:71135372-71135394 GAGGAGGAGGAGGAGGAGAAGGG + Intronic
1098805538 12:75016677-75016699 GAGAGGACTGAGGAGGAGACAGG + Intergenic
1099417337 12:82407637-82407659 AAGAATAAGCAGGAGGAAACAGG + Intronic
1099721470 12:86366561-86366583 GACTACTAGGAGGAGGAGAGTGG + Intronic
1099785099 12:87252269-87252291 TAAAACAAAGAGGAGGAGAAAGG - Intergenic
1099791452 12:87339978-87340000 GAGAACAATGTGGGGGAAACTGG + Intergenic
1099851478 12:88102506-88102528 GAGAAAAAGGAGCATGAAACAGG - Intronic
1099959186 12:89380420-89380442 GAGGAGGAGGAGGAGGAGAAGGG - Intergenic
1100098926 12:91078449-91078471 GAAAAGGAGGAGGAGGAGAAGGG + Intergenic
1100207186 12:92363590-92363612 GAGAAGAATGAGGAGGAGGCAGG - Intergenic
1100647229 12:96544460-96544482 GAGAAAAAGGAGCAGGAGAAAGG - Intronic
1100685904 12:96985739-96985761 GGGGACAAGGAGGGGGAGAGGGG + Intergenic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1100963945 12:99992047-99992069 GAGAAAAAGGAGCAGGTGACAGG + Intergenic
1101122015 12:101591978-101592000 TAGAGCAAGAAGGAGGAGTCTGG + Intronic
1101371036 12:104130845-104130867 AAGATCAAGGTGCAGGAGACAGG + Intronic
1101432501 12:104638135-104638157 GGGGAAAAGGAGGAGGAGAAAGG + Intronic
1101905454 12:108821641-108821663 GAGAACTAGGATCAGAAGACAGG + Intronic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102167844 12:110820695-110820717 AAGAAGAAGAAGGAGGGGACTGG - Intergenic
1102197374 12:111034728-111034750 GAGGAGGAGGAGGAGGAGAGAGG + Intronic
1102408802 12:112698924-112698946 AAGAAGGAGGAGGAGGAGAAGGG - Intronic
1102512011 12:113422288-113422310 GTGAAGACGGAGGAGGAGAGGGG - Exonic
1102646090 12:114404990-114405012 GAGATCAGAGAGCAGGAGACAGG - Intronic
1102666493 12:114578380-114578402 GAGAACAAGGTGGAGGGCAGAGG - Intergenic
1102749148 12:115277179-115277201 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102758613 12:115365947-115365969 GAGAACAGCGTGGAGAAGACTGG - Intergenic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1102943549 12:116964767-116964789 GAGGACGAGGAGGATGAGCCTGG + Exonic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103029546 12:117601538-117601560 GAGATCACGGAGGCAGAGACTGG + Intronic
1103235367 12:119368150-119368172 GAAAAGAAGGAGGAGGAGGAAGG + Intronic
1103265469 12:119626503-119626525 GAGGAGGAGGAGGAGGAGAAGGG + Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103401903 12:120649051-120649073 GAGATGGAGGAGGAGGAGCCTGG - Intronic
1103582398 12:121925013-121925035 GAGAAAAAAGGAGAGGAGACAGG - Intronic
1103711811 12:122918264-122918286 GGGAGGAAGGAGGAGGGGACAGG - Intergenic
1103736142 12:123062032-123062054 GAGAAGGAGGAGGAGGAGCAGGG - Intronic
1103795207 12:123498623-123498645 CAGACCAAGGAGCAGGAGATGGG - Exonic
1103829572 12:123768113-123768135 GAGGAGGAGGAGGAGGAGAGAGG - Intronic
1103896629 12:124277707-124277729 GAGGAAGAGGAGGAGGAGAGAGG - Intronic
1104085139 12:125467372-125467394 GAGAAAGAGGAGGAGGAGAGGGG - Intronic
1104159381 12:126163792-126163814 AAGAAGGAGGAGGAGGAGAGAGG + Intergenic
1104225816 12:126832076-126832098 GAGAAGGAGGAGGAGGAGAAAGG - Intergenic
1104448035 12:128848602-128848624 GCGAAAAAGGTGGAGGAGGCTGG + Intergenic
1104448087 12:128848905-128848927 GAAAAAAAGGAGGAGGAAAGAGG + Intergenic
1104782783 12:131432554-131432576 GAGAATGAGGAGGAGGAGTTGGG + Intergenic
1104946734 12:132417976-132417998 GAGAGCCAGGAGGAGCAGGCGGG - Intergenic
1105328931 13:19396357-19396379 GAGAACACGGAGGCAGAGAAAGG - Intergenic
1106112446 13:26788868-26788890 TAGAGCCAGGAGGAGCAGACAGG - Intergenic
1106388514 13:29312149-29312171 GGGAGCATGGAGGAGGAGCCAGG - Intronic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106389963 13:29325507-29325529 GAGAAGGAGGAGGAGGAGGGAGG + Intronic
1106653835 13:31721053-31721075 GAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1107094156 13:36516609-36516631 TAAGACAAGAAGGAGGAGACAGG - Intergenic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107565977 13:41604953-41604975 GGGCAGAAAGAGGAGGAGACAGG + Intronic
1107879706 13:44822305-44822327 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1108020685 13:46124983-46125005 GAGAAAGAAGAGGAGGAGACAGG - Intergenic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108345257 13:49539544-49539566 GTTAACAAGGAGGAGGAGCGTGG + Intronic
1108770067 13:53688832-53688854 GGGAAAAAGGAGAAGGAGACAGG + Intergenic
1110244241 13:73303658-73303680 AAGAAGAAGGAGGAGGAGCTAGG - Intergenic
1110398527 13:75062625-75062647 GAGAAGAAGGAGGAGAAGGAAGG + Intergenic
1110516438 13:76418377-76418399 GCAAAAAAGGAGGAGGAGAGGGG + Intergenic
1110527107 13:76550897-76550919 GAGGACGAGGAAGAGGAGAAGGG + Intergenic
1110860698 13:80341816-80341838 GAGAAGAAGGGGGAGGGGAAGGG + Intergenic
1111032564 13:82623224-82623246 GAGAAGGAGGAGGAAGAGAAGGG + Intergenic
1111132935 13:83999747-83999769 GAGAGAAATGAGGAGGAGAAAGG - Intergenic
1111181012 13:84665106-84665128 GATAACAAGGAGAAGAAGACAGG + Intergenic
1111353791 13:87070318-87070340 GAGAAGAAGGAGAAGGGGAAGGG - Intergenic
1111897344 13:94157671-94157693 AAGGACTTGGAGGAGGAGACTGG + Intronic
1111959252 13:94791817-94791839 GAGAATCAGGAGGAGGAAAGAGG + Intergenic
1112228696 13:97566507-97566529 GAAGACTAGGAGGAGGAGAAGGG + Intergenic
1112308340 13:98295553-98295575 AAGAACATGGGGGAGGAGAGGGG - Intronic
1112399572 13:99064048-99064070 GAGAAAAAGGTGGAGGATAAAGG - Intronic
1112704351 13:102049783-102049805 GTGAACATGAAGGAAGAGACTGG + Intronic
1112716276 13:102189853-102189875 GAGAGCAGGGAGGAGGTGCCAGG + Intronic
1113069162 13:106402838-106402860 GAGAATGAGGAGGAGGAGATAGG - Intergenic
1113077427 13:106480864-106480886 GAGATGAGGGAGGAGGAGCCAGG + Intergenic
1113124844 13:106965841-106965863 GAGAACAGAAAGGAGGAGAAAGG - Intergenic
1113140949 13:107148503-107148525 GAGAAAAAGGAGGAGAAAAGAGG + Intergenic
1113159616 13:107365024-107365046 GAGAAGGAGGAGGAGGAGGGAGG - Intronic
1113473917 13:110566356-110566378 AAGAAAAGGGAGGAGGAGACGGG + Intergenic
1113611400 13:111647071-111647093 GAGGAAGAGGAGGAGGAGAAAGG - Intronic
1113614491 13:111671031-111671053 GGGAAAAGGGAGGAGGGGACAGG - Intronic
1113619959 13:111755945-111755967 GGGAAAAGGGAGGAGGGGACAGG - Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1113898837 13:113784545-113784567 AAGAAGAAGAAGGAGGAGAAGGG + Intronic
1114316465 14:21514355-21514377 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1114401694 14:22416145-22416167 AAGGACAAGGAGCAGAAGACTGG + Intergenic
1114528516 14:23380909-23380931 GAGAACAGGAAGCAGGAGGCAGG - Intergenic
1114541229 14:23460999-23461021 GTGACCAAGGAGGCAGAGACTGG + Intergenic
1114547818 14:23515110-23515132 GAGCAAAAGGAGGTGGAGAGAGG + Intergenic
1114554105 14:23551649-23551671 GAGGAGGAGGAGGAGGAGGCAGG - Exonic
1114730867 14:24991174-24991196 GAGGAGGAGGAGGAGGAGAGAGG + Intronic
1114788436 14:25627874-25627896 AAGCAAAAGGAGGAGGAGAAGGG + Intergenic
1114884450 14:26831118-26831140 GTGAAAAAGGAGGAAGAGATTGG + Intergenic
1115399424 14:32939833-32939855 GAGGAGCAGGAGGAGGAGGCCGG + Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1115664878 14:35534970-35534992 AAGATCAAGGAGGAGGAGCCCGG + Exonic
1116419455 14:44716022-44716044 GGGAACAAGGGGGTGGAAACAGG - Intergenic
1116766503 14:49077527-49077549 GAGAGCAAGAAGGAAGGGACGGG + Intergenic
1116797575 14:49408261-49408283 AAGAAAAAGGAGGAGGAAAGAGG + Intergenic
1116855979 14:49952700-49952722 GAGAACAAGGATCAGGAAAATGG - Intergenic
1117058140 14:51933843-51933865 GAGAATGAGGATGAGGAGAAAGG + Intronic
1117141157 14:52791832-52791854 GGGAGCGAGGAGGAGGAGCCGGG - Intergenic
1117340041 14:54784725-54784747 GAGGACAAGGAGGGGTAGGCAGG + Intronic
1117350960 14:54881258-54881280 GAGGGCAAGGAGGAGTACACAGG + Intronic
1117453267 14:55872831-55872853 GAGAACAAGGTGGTGGATGCTGG - Intergenic
1117504431 14:56388399-56388421 GAGGAAAAGGAAGAGAAGACTGG - Intergenic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1117764340 14:59064826-59064848 GAAAGCAAGGAGGAGGGGAAAGG + Intergenic
1118072565 14:62261934-62261956 GAGAAAAAGGAGGAGGAAAGTGG - Intergenic
1118171668 14:63395350-63395372 GAGGAGGAGGAGGAGGAGAAGGG + Intronic
1118171679 14:63395388-63395410 GAGGAGGAGGAGGAGGAGAGCGG + Intronic
1118171699 14:63395446-63395468 GAGAAGGAGGAGGAGGAGGGGGG + Intronic
1118459539 14:65975987-65976009 GAGAACGGGGAGGAGGAGAAGGG + Intronic
1118574223 14:67225458-67225480 CAGCACAGGGAGGAGGAGAGAGG + Intronic
1119067339 14:71542236-71542258 GAGGAGGAGGAGGAGGAGCCAGG - Intronic
1119101706 14:71885931-71885953 GAGAAAAAAGAGAAGGAGAGTGG - Intergenic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119428471 14:74550979-74551001 GAGGACAGAGAGGAGGAGAAGGG + Intronic
1119556735 14:75559214-75559236 GAGGAGGAGGAGGAGGAGAAAGG - Intergenic
1119556750 14:75559259-75559281 GAGGAGGAGGAGGAGGAGAAAGG - Intergenic
1119649029 14:76370628-76370650 GAGAAAATGAAGGAGGAGAAGGG - Intronic
1119931225 14:78549345-78549367 GTGAACAAAGAGAAGGAGAAGGG - Intronic
1119949960 14:78734839-78734861 GAGGAGAGGGAAGAGGAGACAGG + Intronic
1119999852 14:79290411-79290433 AAGGGAAAGGAGGAGGAGACAGG + Intronic
1120179552 14:81329505-81329527 GAGAAGATGGAGGCAGAGACTGG + Intronic
1120188921 14:81422278-81422300 GAGAAAAAGGAGGAGGTGCCAGG - Intronic
1120230117 14:81832907-81832929 GAGAAGGAGGAGAAGGAGAGTGG - Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120306763 14:82780824-82780846 AAAAAGAAGGAGGAGGAGAAGGG - Intergenic
1120398787 14:84002175-84002197 GAGAATGAGGAAGAGAAGACTGG - Intergenic
1120599718 14:86487097-86487119 GAGGAGAAGGAGGAGAAGAGAGG + Intergenic
1121074976 14:91060418-91060440 GAGAAGATGGAGGAGGAGGGTGG - Exonic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121170985 14:91854430-91854452 GGGAAGGAGGAGGAGGAGATAGG + Intronic
1121170996 14:91854460-91854482 GAGGGGAAGGAGGAGGAGATAGG + Intronic
1121557361 14:94848539-94848561 GAGAAAATGGAGCAGGAGAGTGG + Intergenic
1122245385 14:100399482-100399504 GAGAAAAGGCAGGCGGAGACAGG - Intronic
1122343306 14:101042883-101042905 GAGACCAAGGGGGAGGGGCCAGG - Intergenic
1122343507 14:101044104-101044126 GAGACCAAGGGGGAGGGGCCCGG - Intergenic
1122451077 14:101808094-101808116 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
1122623044 14:103070603-103070625 CAGAACAAAGAGGAGGAGAGAGG - Intergenic
1122844941 14:104488350-104488372 GAGGAGAAATAGGAGGAGACAGG + Intronic
1122885480 14:104708576-104708598 GAGCCCAAGGAGGTGGGGACGGG + Exonic
1123170131 14:106365092-106365114 GAGAAAAAGAAGGAGGGGATGGG - Intergenic
1123221422 14:106860397-106860419 GAGAAAAAGGAGGAGGGGTTGGG - Intergenic
1123539257 15:21271709-21271731 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1124013840 15:25860433-25860455 GAATAGAAGGAGGAGGAGGCTGG - Intronic
1124339311 15:28879749-28879771 GGGAACAAGGAGCCGGAGAAGGG - Intergenic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124710787 15:32008347-32008369 AAGAAATAGGAGGAGGAGAAGGG - Intergenic
1124831806 15:33156110-33156132 GAGAGAAAGGAGGAAGAGTCTGG + Intronic
1124870333 15:33535049-33535071 GAGACCAAGGAAGAGAAAACAGG + Intronic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125045258 15:35237884-35237906 GAGGACGAGGAGGAGGAGGAAGG + Intronic
1125283256 15:38066092-38066114 GAGAAAAAGGGGAAGGAGAGAGG + Intergenic
1125450082 15:39798922-39798944 GAGACCATGTAGGAAGAGACAGG + Intergenic
1125511877 15:40296565-40296587 GAGGAAGAGGAGGAGGAGTCAGG - Exonic
1125549913 15:40537466-40537488 CAGAGCAAGGGGTAGGAGACAGG - Intronic
1125593900 15:40872512-40872534 GATGACGAGGAGGAGGAGAGAGG - Exonic
1125811313 15:42543881-42543903 AAGAAAAAGGATCAGGAGACAGG - Exonic
1125891962 15:43273711-43273733 GAGAAGGAGGAGGAGGGGAGGGG + Intergenic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126550808 15:49927315-49927337 CAGAAGAGGGAGGAGGAGAAAGG + Intronic
1126673037 15:51133860-51133882 AATAATAAGGGGGAGGAGACTGG - Intergenic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127226916 15:56940737-56940759 GAGAAGGAGAAGGAGGAGAAGGG - Intronic
1127260631 15:57324054-57324076 GAGAAAAGGGAGGAGGAGAAAGG + Intergenic
1127312566 15:57765771-57765793 GTGAACAGGGAGGAGGAAAGAGG - Intronic
1127691874 15:61404549-61404571 GAAGACAAGGGGGAGGAGGCAGG - Intergenic
1127782029 15:62325439-62325461 GAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1127860409 15:62989252-62989274 GAGAAAAAGGAGGAAGAAAAAGG - Intergenic
1127907116 15:63384119-63384141 GAGAAGAAGGGGCAGGAGACAGG - Intergenic
1127939333 15:63678073-63678095 GAGAGCAAAGAGGAAGAGAAAGG - Exonic
1127965619 15:63920774-63920796 GAGAACAAGCAGGAGCAGCAGGG - Intronic
1128029611 15:64468302-64468324 AAGCAGAAGGAGGAGGAGAGAGG - Intronic
1128230058 15:66028132-66028154 GATCACCAGGAAGAGGAGACTGG - Intronic
1129504400 15:76069309-76069331 CAGAAAAAGCAGGAGGAGATAGG + Intronic
1129608994 15:77038309-77038331 GAGAGAAAGGAGGGGGAGAAAGG + Intergenic
1129830877 15:78669174-78669196 GAGGAGGAGGAGGAGGAGATGGG + Intronic
1130078374 15:80709691-80709713 GAGAACAATGAGGGAGAGGCCGG - Intronic
1130095415 15:80851910-80851932 GACTGGAAGGAGGAGGAGACTGG + Intronic
1130226062 15:82059040-82059062 GAGAAGGAGGGGGAGGAGAAGGG - Intergenic
1130529305 15:84733991-84734013 AAGGAAAAGGAGGAGGAGAAGGG + Intergenic
1130748909 15:86688255-86688277 GAGAAAGAGGAGGAGGAGAAGGG + Intronic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131297096 15:91158723-91158745 GAGAAAAAAGAGGAGAAGAGAGG - Intronic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131821740 15:96280887-96280909 AAGAAGGAGGAGGAGGAGGCAGG + Intergenic
1132352128 15:101146425-101146447 AAGAGGAAGGAGGAAGAGACAGG - Intergenic
1132764432 16:1527059-1527081 GGGAAAAAGGAGGAGGAGCCTGG - Intronic
1132857822 16:2054880-2054902 GAGAAAGAGGAGGAAGAGATCGG + Intronic
1133052600 16:3125724-3125746 GATAAACATGAGGAGGAGACTGG + Intergenic
1133205158 16:4228811-4228833 GGGAACAAGAGTGAGGAGACTGG - Intronic
1133327255 16:4949272-4949294 GAGAGCACGGAGGAGGAGCCAGG - Intronic
1133386799 16:5376491-5376513 GAGACCAGGGATGAGCAGACAGG + Intergenic
1133560567 16:6946485-6946507 TAAAACAAGGAGGAGAAAACAGG - Intronic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133690458 16:8209662-8209684 GAGGAAAAAGAGGAGGAGCCAGG + Intergenic
1133874744 16:9723201-9723223 GAGGAAGAGGAGGAGGAGACAGG + Intergenic
1133943557 16:10329924-10329946 TAGAACATGTAGGTGGAGACTGG - Intronic
1134041324 16:11070723-11070745 AAGAGCAAGGAGGCAGAGACAGG - Intronic
1134057162 16:11177781-11177803 GAGGAGGAGGAGGAGGAGACAGG + Intronic
1134449525 16:14354513-14354535 GAGAGGGAGGAGGAGGAGAGAGG + Intergenic
1134470258 16:14518701-14518723 GAGAACAGGATGGAGGAGACAGG + Intronic
1134863218 16:17579510-17579532 GAGACCATGGAGGGGGAGCCAGG + Intergenic
1135075097 16:19386424-19386446 CAGGAGAAGGAGGAGGAGAGAGG - Intergenic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135631607 16:24039855-24039877 AAGACCAAGGAGGAGGGGGCTGG - Intronic
1136141123 16:28289402-28289424 GAAAACAAGGAGGAAGGGAAAGG + Intergenic
1136230177 16:28881083-28881105 GTGATGGAGGAGGAGGAGACTGG - Intronic
1136452174 16:30359615-30359637 AAGAACAAGGAGGAGGGGTGGGG + Intronic
1136684735 16:31987447-31987469 GAGAAGGAGGAGGAAGAGAAGGG - Intergenic
1136785351 16:32930982-32931004 GAGAAGGAGGAGGAAGAGAAGGG - Intergenic
1136884423 16:33922821-33922843 GAGAAGGAGGAGGAAGAGAAGGG + Intergenic
1137029665 16:35510042-35510064 GAGAACAAACAGGAGGTGTCGGG - Intergenic
1137316013 16:47323878-47323900 GAGAACAGGGAGAGGAAGACGGG + Intronic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137667715 16:50261442-50261464 GAGAGGCAGGAGGAGGAGGCAGG + Intronic
1137763161 16:50957010-50957032 GACAAAATGGAGGAGGAGACAGG - Intergenic
1137822108 16:51456062-51456084 GAGAAGAAGAAGGAGGAGCAGGG + Intergenic
1138153944 16:54685793-54685815 AGGAAGAAGGAGGAGGAGAAAGG - Intergenic
1138170332 16:54843611-54843633 GAGAATCAGGAGGAGGGGCCAGG - Intergenic
1138265454 16:55656731-55656753 GAGAACAACGGGGCGGACACGGG + Exonic
1138293869 16:55870359-55870381 GAGGAAGAGGAGGAGGAGAAAGG + Intronic
1138618621 16:58193795-58193817 GAGAAAAAGGAGGAGGAAAATGG - Intronic
1138674382 16:58640465-58640487 GATAGCAATGAGGAGGAGAGGGG + Intergenic
1139196465 16:64924573-64924595 GAGAACACGGAGGATAAAACAGG - Intergenic
1139201383 16:64980976-64980998 GATAAGAAGGAGGTGGAGAAGGG - Intronic
1139351071 16:66336153-66336175 GAGAAGAAGGAGTAGGAAGCAGG - Intergenic
1139372995 16:66480040-66480062 AAGGCCAAGGAGGAGGACACGGG - Intronic
1139800087 16:69515452-69515474 GAGAAAAAGGGGCAGGAGATAGG - Intergenic
1140037430 16:71382041-71382063 GAGTAGGAGGAGGAGGAGAGGGG + Intronic
1140155956 16:72426972-72426994 GAGAAAAAGGAGGGAGAGAGAGG + Intergenic
1140692103 16:77494415-77494437 GTGATGAAGGAGGCGGAGACTGG - Intergenic
1140893011 16:79300972-79300994 GGGCAGAAGGGGGAGGAGACGGG + Intergenic
1141007121 16:80363056-80363078 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1141020912 16:80495666-80495688 GAGAACAGGAAGGAGGAAAGTGG + Intergenic
1141047007 16:80724260-80724282 GAGGAAGAGGAGGAGGAGAAAGG + Intronic
1141527135 16:84618536-84618558 AAGAAGAGGGAGGAGGAGAGAGG - Intergenic
1141775567 16:86120891-86120913 GAGGAAGAGGAGGAGGAGAAGGG - Intergenic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1141775801 16:86121890-86121912 GACAAGGAGGAGGAGGAGGCAGG - Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1141981256 16:87551748-87551770 GTGAAGATGGAGGAGGAGACTGG + Intergenic
1142005116 16:87686001-87686023 GAGACAGAAGAGGAGGAGACAGG + Intronic
1142264528 16:89057652-89057674 GAGAACAGGAAGGAGGACAGGGG - Intergenic
1142287565 16:89177609-89177631 GAGATGAGGGAGGAGGAAACAGG - Intronic
1142696333 17:1635724-1635746 GAGGGCAAGGATGAGGAGAGTGG + Intronic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143193781 17:5059804-5059826 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1143270060 17:5668780-5668802 GAGGAGAAGGAGGAGGACAGAGG - Intergenic
1143297739 17:5883792-5883814 GAAACCAAGGAGGAGGGGCCGGG - Intronic
1143542951 17:7580386-7580408 GGGAAGAAGGAAGAGGGGACAGG + Intronic
1143652133 17:8269701-8269723 GAGAACAATGAGGTGGTGAGGGG - Exonic
1143828175 17:9629910-9629932 GCTAACAAGGAGGAGAAGACAGG - Intronic
1143859160 17:9875363-9875385 GATAAGAAGGAGGAGGTGACAGG + Intronic
1143953811 17:10653655-10653677 GAGAAAAAGGAGGTGAGGACAGG - Intronic
1144113616 17:12063991-12064013 GAAAGCAGGGAGGAGGAGAGGGG + Intronic
1144229791 17:13190426-13190448 GGGTCCAAGGAGGAGGAGAAAGG + Intergenic
1144235668 17:13258079-13258101 GGGAAGAAGGAGAAGGAGAAGGG - Intergenic
1144288460 17:13802656-13802678 GAGAAGGAGGAGGAAGAGAGGGG + Intergenic
1145313398 17:21713070-21713092 GAGAACATGGGGCAGGTGACTGG + Intergenic
1146195932 17:30812836-30812858 GAGGACAAGGGGAAAGAGACAGG + Intronic
1146447864 17:32947138-32947160 GAGAACCAATAGGAGGAGGCTGG + Intergenic
1146471186 17:33126373-33126395 GAGACCAAAGTGGAGGAGACTGG - Intronic
1146518460 17:33508070-33508092 GAGGAGAGGGAGGAGGAGTCAGG - Intronic
1146670100 17:34731416-34731438 GACATCAAGGAAGAAGAGACTGG + Intergenic
1146679953 17:34799916-34799938 GAGAACAAGCAGGAGGAAGGGGG - Intergenic
1147145672 17:38483128-38483150 GAGAAGGAGGAGGAAGAGAAGGG - Intronic
1147157071 17:38549310-38549332 GAGGACCAGGAGGAGGTGAGAGG + Intronic
1147416865 17:40298245-40298267 GGGAAAAAGGAGGAGGAAAAGGG - Intronic
1147498716 17:40942192-40942214 GAGAAGGAGGGGGAGGAGAAAGG - Intergenic
1147632329 17:41940145-41940167 GAGATCAAGGAGGCTCAGACTGG - Intronic
1147853515 17:43460518-43460540 GAGAAAAAGGAGTGGAAGACAGG - Intergenic
1147864475 17:43543645-43543667 CAGAAGAAGGATGGGGAGACGGG + Intronic
1147945437 17:44077806-44077828 AAGAGGAAGGAGGAGGAGAGGGG + Exonic
1148074208 17:44926342-44926364 GACAAGAAGGAGGAGGGGACGGG - Intronic
1148211746 17:45813003-45813025 GAGTCCAGGGAGGAGGAGAGTGG - Intronic
1148262006 17:46192760-46192782 GAGAGCGAGGAGAAGGAGAAAGG + Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149038389 17:52158932-52158954 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
1149066382 17:52485589-52485611 GAGGAGGAGGAGGAGGAGAAAGG - Intergenic
1149373675 17:56022040-56022062 GAGAACAAAAAGGTGGAGAAAGG + Intergenic
1149456564 17:56793026-56793048 AAGAAGGAGGAGGAGGAGAGGGG + Intronic
1149785799 17:59433901-59433923 AAGAAGAAGAAGGAGGAGAGGGG - Intergenic
1149808502 17:59642137-59642159 GAAAACAATGAGGAGGAAAAAGG - Intronic
1150115034 17:62540025-62540047 GAGGAGGAGGAGGAGGAGAAAGG - Intronic
1150132002 17:62674441-62674463 GAGAACAGGGAGGTGGGGGCTGG + Intronic
1150432260 17:65127764-65127786 GAGTGCAAGGAGGAGGAGAGGGG + Intergenic
1150649627 17:67001367-67001389 GAGAACCAGGGGGAGGGGACAGG - Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1150765305 17:67997364-67997386 GAAAAGAAAGAGGAGGAGCCAGG + Intergenic
1150947629 17:69765445-69765467 GAGGAGGAGGAGGAGGAGAGGGG - Intergenic
1150964176 17:69948489-69948511 GAGGAGAAGGAGGAGGAGAGGGG + Intergenic
1151259853 17:72907888-72907910 GAGAAGTGGAAGGAGGAGACAGG + Intronic
1151561005 17:74869521-74869543 GTGAACAAAGAGGAAGAGAATGG - Intronic
1151723164 17:75869777-75869799 GAGGACAAGGATGAGGAGAAGGG + Intergenic
1152008498 17:77696852-77696874 GAGGGGAAGGAGGAGGAGAAGGG - Intergenic
1153613344 18:6910037-6910059 GATAACAAGGAGGAAGAAATTGG - Intronic
1153639784 18:7146906-7146928 GGGGACAGGGAGGAGGACACTGG - Intergenic
1153642141 18:7166305-7166327 GAGCACAAGGAGGTGAGGACAGG - Intergenic
1153751643 18:8238197-8238219 GAATACAAGAAGGAGGAGAAAGG - Intronic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1155066207 18:22271210-22271232 GAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155360490 18:24995119-24995141 TATAACAGGGAGGAGGAAACTGG - Intergenic
1155407997 18:25511648-25511670 GAGGAATAGGAGAAGGAGACAGG - Intergenic
1155565219 18:27126961-27126983 GAGAGGAAGGAAGAGGAAACTGG + Intronic
1155657638 18:28210238-28210260 GAGGACAAGGAGGTGTTGACAGG + Intergenic
1156515720 18:37678476-37678498 GTGAACAATGATGAGGAGAAAGG + Intergenic
1156768551 18:40689647-40689669 GAGAATAATGAAGGGGAGACAGG - Intergenic
1156852518 18:41745080-41745102 GAGAACAAGGGAGAGGAAAGAGG + Intergenic
1157145554 18:45158977-45158999 GAGGGAAAGGAGGAGGAGAAAGG - Intergenic
1157382022 18:47227170-47227192 GAGAAGGAGGAGGAAGAGGCAGG - Intronic
1157570257 18:48707574-48707596 GAGAAGGAAGAGGAGGAGAAGGG - Intronic
1157775350 18:50390682-50390704 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
1157990396 18:52488943-52488965 GAGAAGAAGGGGGAAGAGGCGGG - Intronic
1158077194 18:53544535-53544557 GAGAACAATGAGGAAGTTACTGG + Intergenic
1158182346 18:54730660-54730682 GAGAGTGAGGAGGAGGAGTCAGG - Intronic
1158360333 18:56665453-56665475 GAAGACTAGGAAGAGGAGACTGG - Intronic
1158855719 18:61541921-61541943 GAGAACAGAGAGCAGGAGAGCGG + Intronic
1158888230 18:61848995-61849017 GAGAACAGGGAAGGGGAGCCTGG + Intronic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1158963812 18:62606959-62606981 AAGAAGGAGGAGGAGGAGAAGGG + Intergenic
1159040535 18:63319906-63319928 CAGGACCAGGAGGAGGAGAAAGG - Exonic
1159310258 18:66698457-66698479 GAGGAGAAGGAGGAGGAGAAAGG + Intergenic
1159310289 18:66698551-66698573 AAGCAGAAGGAGGAGGAGAAAGG + Intergenic
1159517675 18:69478401-69478423 GAGAAAAAGGAGGAGAAGGAAGG - Intronic
1159996796 18:74972225-74972247 GAGAAGGAGGTGGAGGAGAAGGG - Intronic
1160068903 18:75607226-75607248 GAAAACAGGGAGAAGGACACAGG - Intergenic
1160077017 18:75687123-75687145 GGTCACAAGGAGGAGAAGACTGG + Intergenic
1160227009 18:77019419-77019441 GTGAAGATGGAGGAGGAGCCTGG + Intronic
1160679641 19:406848-406870 GAGGAGGAGGAGGAGGAGAGGGG - Exonic
1160745732 19:709967-709989 GAGCACCGGGAGGAGGGGACCGG - Intronic
1160804418 19:985741-985763 GAGAACCAGGAAGAGGAGTCGGG - Intronic
1161069367 19:2252678-2252700 GAGAACGACGAAGAGGAGCCCGG - Exonic
1161112441 19:2477747-2477769 GAGGAAGAGGAGGAGGAGAAGGG + Exonic
1161208913 19:3056284-3056306 GAGGAGGAGGAGGAGGAGATGGG + Intronic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161370542 19:3908659-3908681 GAGGAGAAGGAGGAGAAGAAAGG - Intronic
1161370550 19:3908693-3908715 GAGAAAAGGGAGGAGGAGGGGGG - Intronic
1161485146 19:4531548-4531570 TAGACCAAGGAGGATGGGACAGG + Intronic
1161564939 19:4996714-4996736 AAGAACCAGCACGAGGAGACAGG - Intronic
1161576522 19:5057630-5057652 GTGAACAAGGACGTGGAGCCAGG - Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1162203001 19:9034832-9034854 GAGAAGAAGGGGGAGGAGAAAGG + Intergenic
1162237784 19:9321872-9321894 GAGCCCACGGAGGAGGAGGCGGG - Intergenic
1162818125 19:13208185-13208207 GAGGAGGAGGAGGAGGAGAGGGG + Intronic
1163387247 19:17007405-17007427 AAGAAGAAGCAGGAGGAGAGGGG + Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163531333 19:17850819-17850841 GAGAATAAGTAAGAGGAGATTGG + Intergenic
1163611572 19:18304512-18304534 GAGGAGGAGGAGGAGGAGAGAGG + Intergenic
1163622502 19:18369291-18369313 GAGAAAGAGCAGGAGGAGAAAGG - Exonic
1163779663 19:19239741-19239763 GAGAAGGAGGAGGAGTAGAAGGG - Intronic
1163938916 19:20475351-20475373 GAGGACAAGGAGGTGCTGACAGG + Intergenic
1164056731 19:21628397-21628419 GAAAACAATGAGCAGGAGAAAGG + Intergenic
1164234942 19:23323623-23323645 GAAGAGAAGGAGGAGGAGAAAGG - Intronic
1164237455 19:23349565-23349587 GAGGACAAGGAGGTGTTGACAGG - Intronic
1164249930 19:23467535-23467557 GAGGAGAAGGAGGAGGAGTGGGG - Intergenic
1164292166 19:23878693-23878715 GAGAAGGAGGAGGAGGAGTAAGG + Intergenic
1164324772 19:24181452-24181474 GAGAAAAAGGGGGAGGGGAGAGG + Intergenic
1164588304 19:29491501-29491523 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1164591913 19:29512082-29512104 GAGAGCAAGGATGAGGAGGAAGG + Intergenic
1164592025 19:29512499-29512521 GAGAACAAGGATGAGGAGGAAGG + Intergenic
1164592065 19:29512643-29512665 GAGAACAAGAATGAGGAGGAAGG + Intergenic
1164657935 19:29938339-29938361 GAGAGGAAGGAGGAGGTGCCAGG + Intronic
1164718705 19:30415256-30415278 GAGGAGCAGGAGGAGGAGAAGGG - Intronic
1164883274 19:31754583-31754605 GAGAGCAAGGAGCAGGTGCCAGG + Intergenic
1165273534 19:34730878-34730900 TAGGGCAAGGAGGAAGAGACAGG + Intergenic
1165326122 19:35115513-35115535 GAGGAGGAGGAGCAGGAGACAGG + Intergenic
1165386211 19:35511979-35512001 AAAAAAAAGGAGGAAGAGACGGG - Intronic
1165796458 19:38522940-38522962 GAGATCTTGGAGGAGGAGATGGG - Intronic
1166093525 19:40525528-40525550 CAAAACGAGGAGGAGGAGCCCGG + Intronic
1166465478 19:43027333-43027355 GAGACGCAGGAGGAGGAGCCTGG + Intronic
1166626543 19:44362210-44362232 GAGAAGAAGATGGAGGAGAAGGG + Intronic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167108427 19:47444892-47444914 GAGAGACAGGATGAGGAGACTGG - Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167354288 19:48993672-48993694 GAGCAAAAGGAGGAGGAGCCAGG + Exonic
1167415548 19:49369536-49369558 GAGAACCAGGAGAAGGGGAAGGG + Intronic
1167461395 19:49626289-49626311 GAGAACGGGGAGGAGGGGAAAGG - Exonic
1167463375 19:49638088-49638110 GAGACGGGGGAGGAGGAGACGGG - Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1202695148 1_KI270712v1_random:118097-118119 GAGGACAAGAAGGGGGAGATGGG + Intergenic
925496218 2:4452473-4452495 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925597313 2:5568556-5568578 GAGAAGAAAGAAGAGGAGAAAGG + Intergenic
925752430 2:7101044-7101066 AAGGAGGAGGAGGAGGAGACAGG - Intergenic
926243809 2:11107399-11107421 AAAAAGAAGGAGGAGGAGAAAGG + Intergenic
926439755 2:12875459-12875481 GAGAATGAGGAGGTGGAGGCTGG + Intergenic
926756997 2:16244377-16244399 GAGGGCAAGGAGGAGGAGAAGGG + Intergenic
926890483 2:17635139-17635161 GCCAAAAAGGAGGAGGAGAAGGG + Intronic
927056797 2:19373010-19373032 GAGGAGAAGGAGGAGCAGAAGGG - Intergenic
927187353 2:20491313-20491335 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
927338208 2:21950039-21950061 GAAAAGAAAGAGAAGGAGACAGG - Intergenic
927648593 2:24897258-24897280 GAGGAGGAGGAGGAGGAGAAGGG - Intronic
927659517 2:24981048-24981070 GAGAAGAAGGAGGGGGAGGGGGG + Intergenic
927871654 2:26627947-26627969 GATACCAGGGAGGAGGAGGCTGG - Intronic
927878279 2:26673391-26673413 GAGAACAAGAATCAGGAGAAGGG + Intergenic
928040007 2:27865557-27865579 AAAAAAAAGGAGGAGGAGAAGGG - Intronic
928083104 2:28327240-28327262 GATGAGAAGGAGGAGGAGAAGGG - Intronic
928105803 2:28469991-28470013 GAGAAGAAAGAGGAGGAGGAGGG + Intronic
928106616 2:28474582-28474604 GAGAACAAGGGGGAAGGGAAGGG - Intronic
928192152 2:29181283-29181305 GAGGAGAAGGAGGAAGAGAAGGG + Intronic
928255856 2:29721893-29721915 GGGAAGAAGAAGGTGGAGACAGG - Intronic
928316999 2:30254568-30254590 GAGGACGAAGAGGAGGAGAGGGG - Intronic
928325889 2:30319195-30319217 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
928455201 2:31414511-31414533 CAGAACAAGTAAGAGGGGACAGG + Intronic
928781946 2:34833864-34833886 GAGAAGGAGGAGGTGGAGAAGGG + Intergenic
928792984 2:34981058-34981080 GAGAAGAACGGGGAGGAGACAGG + Intergenic
929034722 2:37679764-37679786 GAGAAGAAAGAGGAGGACTCAGG - Intronic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929325968 2:40611052-40611074 GAGAAAGAGGAGGAGGTGCCGGG + Intronic
929973783 2:46610991-46611013 GAGACCAAGAAGGAAGAGAAAGG - Intronic
930357910 2:50345182-50345204 GAGAACTAGGAGAAGGAGAAAGG + Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930366045 2:50440554-50440576 GAGGACAAGGAGGATAAGATAGG + Intronic
930444647 2:51454758-51454780 AAGAACAAAGAGGCAGAGACAGG - Intergenic
930470079 2:51801366-51801388 GAGAAAAAGGAGGAGTTGCCAGG + Intergenic
930735685 2:54776208-54776230 GTGGAAAAGGAGGAGGAGAAAGG + Intronic
930957605 2:57221921-57221943 GAGAAGACTGAGGAGAAGACTGG - Intergenic
932221132 2:69999877-69999899 GGGAGGAAGGAGGAGGAGCCCGG - Intergenic
932376253 2:71238605-71238627 GAGAACAAGGAGTGGCAGAGGGG + Intergenic
932493604 2:72136033-72136055 GAGGACAAGGAGGTGGAAACAGG - Intronic
932507904 2:72254317-72254339 GAGAAGACAGAGGTGGAGACTGG + Intronic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
932748545 2:74355886-74355908 GAGAAGAAGGGGGAGGAAAGGGG + Intronic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933081906 2:78000146-78000168 GAGAAAAAGATGGAAGAGACAGG + Intergenic
933250923 2:80027603-80027625 GTGAAGAAGTAGGAGCAGACTGG + Intronic
933900899 2:86849360-86849382 GAGAACAAATAGGAGGTGAGAGG - Intronic
934037460 2:88100060-88100082 GAAAACAAGGAGGAAGAGGGGGG - Intronic
934276318 2:91575146-91575168 GAGGACAAGAAGGGGGAGATGGG + Intergenic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935105526 2:100039818-100039840 TGGAACAAGGAGGAAGCGACAGG - Intronic
935274806 2:101466912-101466934 GAGGACAAGGAGGAGGAAATTGG + Intronic
935383380 2:102476722-102476744 GAGAAGGAGGAGGAGGAAAAAGG + Intronic
935488384 2:103686607-103686629 AAGAAGGAGGAGGAGGAGAAGGG + Intergenic
935501539 2:103846826-103846848 GAGAAGAAGGAAGAAGAGAAGGG + Intergenic
935750009 2:106223581-106223603 GAGAAAGAGGAGGAGGGGCCAGG + Intergenic
935779643 2:106499871-106499893 GAGAACAAATAGGAGGTGAGAGG + Intergenic
936272489 2:111059927-111059949 GAGAAGAAGGAGGAGGAAGAGGG + Intronic
936385682 2:112026610-112026632 GAGAACAAGGATTGTGAGACAGG + Intronic
936529988 2:113269284-113269306 TGGAACAATGAGGAGCAGACTGG + Intronic
936731258 2:115384138-115384160 GAGAAAGAGGAGCAGAAGACAGG - Intronic
937024136 2:118683325-118683347 GAGAAAAAGGAGGCAGAGAAAGG + Intergenic
937273353 2:120669323-120669345 GAGAAGCAGGAGGCGGGGACAGG + Intergenic
937276852 2:120690459-120690481 GAGGTCAGGGAGGAGGGGACGGG + Intergenic
938376166 2:130808194-130808216 GAGAGCCAGGAGGAGGTGGCAGG + Intergenic
938736594 2:134191669-134191691 GAGAAAGAGGAGGAGGAGGAGGG - Intronic
939045070 2:137240206-137240228 GAGAACTAGAAAGAGGAGAGAGG - Intronic
939254891 2:139730118-139730140 GAAAACAAATAGGAGGAGATAGG - Intergenic
939379808 2:141420547-141420569 AAGAACAAGGAAGAGCAGAGTGG - Intronic
939513758 2:143140808-143140830 GAGAACAAGGTGCAGCAGAGGGG + Intronic
939749570 2:146026522-146026544 GAGAAGATGGAAGAGGAGACAGG - Intergenic
939966951 2:148619639-148619661 GGGAAAAAGGAGGAGGAGGAGGG - Intergenic
940073471 2:149715473-149715495 GTGACCATGGAGGAGGAGGCTGG - Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
941038233 2:160590606-160590628 GAGGAGAAGGGGGAGGAGAAGGG - Intergenic
941038238 2:160590618-160590640 GAGGAGAAGGGGGAGGAGAAGGG - Intergenic
941038243 2:160590630-160590652 GAGGAGAAGGGGGAGGAGAAGGG - Intergenic
941250153 2:163151484-163151506 GTGAACAAGGAGGAGGATTTTGG - Intergenic
941361332 2:164555154-164555176 GTCAGCAAGGAGGAGGAGAAAGG - Intronic
941413382 2:165188127-165188149 GGGAATAAGGAGGAGCAGAAGGG + Intronic
941481223 2:166016033-166016055 GAGAAGAGGGAGGAAGAGAAAGG + Intronic
941697899 2:168573011-168573033 GAGAAGAGGAAGGAGGAGGCAGG + Intronic
941800709 2:169656512-169656534 GAGGAGGAGGAGAAGGAGACAGG + Intronic
942086363 2:172447756-172447778 AGGAAAATGGAGGAGGAGACAGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942350249 2:175045189-175045211 GAGAGAAAGGAGGAGGGGAGGGG - Intergenic
942419651 2:175794895-175794917 GAGAAAAAGGGGCAGGAGACAGG + Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942800729 2:179872586-179872608 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
942871939 2:180745261-180745283 GAGAAAAAGGTGGAGAGGACCGG + Intergenic
942947078 2:181683417-181683439 GAAAATAAGGAGGAGGAGCGGGG - Intergenic
942965859 2:181891913-181891935 GAGGAGGAGGAGGAGGGGACAGG - Exonic
943311132 2:186326119-186326141 GAGAAAGAGGAGCAGGAGAAAGG - Intergenic
943394015 2:187309915-187309937 GAGTAAAAGAAGGAGGAGATAGG - Intergenic
943570626 2:189569519-189569541 GAGAAAAAGGAGGAGGATAAAGG - Intronic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944545499 2:200795322-200795344 GAGCACAAAGAGGAGGAGGCAGG + Intergenic
944975134 2:205041472-205041494 GAGAACCTGGAGGAGGACACAGG - Intronic
945176217 2:207046205-207046227 GAGGAGGAGGAGGAGGAGAAAGG + Intergenic
945225771 2:207530139-207530161 GAGGAGCAGGAGGAGGAGGCAGG + Intronic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945314758 2:208359936-208359958 GAGAACGTGGAGGAAGTGACTGG - Intronic
945684568 2:212953550-212953572 GAGAAGGAGCAGGAGTAGACAGG + Intergenic
945711352 2:213300236-213300258 GAGAAGAAAGAGGAGGAAAAGGG - Intronic
945889024 2:215408920-215408942 AAGAAGGAGGAGGAGGAGAAAGG - Intronic
945987531 2:216367312-216367334 GAGAAGGAGGAGGAGGAGGGAGG - Intronic
946368725 2:219267082-219267104 GAGAAGAAGGAGGAGGGAAAAGG + Intronic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
946765360 2:223035673-223035695 GGGAACAGAGAGGAGGAGATGGG - Intergenic
946843229 2:223837734-223837756 GAGGAGGAGGAGGAGGAGAAGGG - Intronic
947434430 2:230060726-230060748 GAGGATAAGGAGCAGGAGTCGGG + Intronic
947801504 2:232931122-232931144 GAGAACAGGAAAGAGGTGACAGG + Intronic
947858876 2:233344700-233344722 GAGAACTAGGCAGAGAAGACAGG - Intronic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948106811 2:235421203-235421225 GACAACGAACAGGAGGAGACGGG + Intergenic
948309821 2:236976763-236976785 GAGAACAAGGAGGAGGGGGAAGG - Intergenic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948579344 2:238973432-238973454 GAGGAGGAGGAGGAGGAGAAAGG - Intergenic
948658097 2:239489377-239489399 GGGGACAAGGAGGGGGAGGCAGG - Intergenic
948883588 2:240872315-240872337 GTGAACATGGAGGAGGAGGAGGG + Intronic
948939190 2:241187721-241187743 GAGAAACAGGAGGAGGGGAGTGG + Intergenic
949079390 2:242084747-242084769 GGGTACAAGGAGGAGGTGCCTGG - Intergenic
1168936967 20:1673942-1673964 GGGGACAAGGAGGAGAAGCCTGG - Intergenic
1169384978 20:5141077-5141099 GAGAGAAAGGAGCAGGAGAAAGG - Intronic
1169557232 20:6764145-6764167 GAGAAAGAGGAGGAGAAGAAAGG + Intergenic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1169623254 20:7532024-7532046 GAGAGAAAGGAGAAGGAAACTGG + Intergenic
1170306349 20:14942419-14942441 GAGGAAGAGGAGGAGGAGAAAGG - Intronic
1170306354 20:14942441-14942463 AAGAAAAAGGAGGAGGAGAAAGG - Intronic
1170368208 20:15619797-15619819 GAGAACACCGTGGAGGAGACAGG - Intronic
1170463866 20:16605076-16605098 GAGAATAAAGAAGAGGAGAAGGG + Intergenic
1170528587 20:17266646-17266668 GAGAGCAAGGAAGAGAACACTGG + Intronic
1170579250 20:17685295-17685317 GAGAAAGAGAAGGAGGAGAGGGG + Intergenic
1170587049 20:17742685-17742707 GAGAAGAAGGAGGGGGAGAAGGG + Intergenic
1170779591 20:19412421-19412443 GAGAAGGAGGAAGAAGAGACAGG + Intronic
1170916908 20:20635133-20635155 GAGGAGAATGAGGAGGAGCCAGG + Intronic
1170981116 20:21213799-21213821 CTGAGCAAGGAGGAGGACACAGG - Intronic
1170986447 20:21263702-21263724 GAGGAAGAGGAGGAGGAGAAAGG + Intergenic
1171036318 20:21715075-21715097 GAGGACTAGAAAGAGGAGACGGG - Exonic
1171200670 20:23239137-23239159 GAGAAGAAGGAGATAGAGACAGG - Intergenic
1171255943 20:23689109-23689131 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171263292 20:23751006-23751028 AAGAAAGAGGAGGAGGAGTCAGG - Intronic
1171272356 20:23826800-23826822 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171278796 20:23879821-23879843 TAGAAAGAGGAGGAGGAGCCAGG - Intergenic
1171463368 20:25311289-25311311 GAGAAAAAGGGAGAGGAGTCAGG + Intronic
1172043023 20:32059349-32059371 GAGGAAGAGGAGGAGGAGAAGGG - Intronic
1172356253 20:34282189-34282211 GAGAGCAAGGAGGAAGCCACAGG - Intronic
1172606285 20:36216376-36216398 AAGCACACGGAGGAGGAGTCGGG + Intronic
1172657148 20:36544175-36544197 GAGAACAAGGAGTGGGACCCAGG + Intronic
1172804546 20:37602279-37602301 GAGGACAAGGTGGAGAACACTGG + Intergenic
1173002739 20:39116367-39116389 GAGAACAAAGAAGAGGAAGCTGG + Intergenic
1173192386 20:40886465-40886487 GAGACCAAGGACTTGGAGACAGG + Intergenic
1173395963 20:42679969-42679991 TAGAACAAGGAAGAGGAGAAAGG + Intronic
1173443158 20:43095798-43095820 GAGAAAGAGGGGGAGGAGAGAGG - Intronic
1173736449 20:45364809-45364831 GAGAACAAGCAGCAGGAGCAAGG - Intronic
1173937681 20:46881464-46881486 GGGAACAAGGAGGCTGAGAGGGG - Intergenic
1174287046 20:49481182-49481204 GAGGAGGAGGAGGAGGAGGCAGG - Intronic
1174326896 20:49786411-49786433 GAGGGCATGGAGGAAGAGACAGG - Intergenic
1174528932 20:51195656-51195678 GAGAAAAGGGAGGAGGTGCCGGG + Intergenic
1174677589 20:52373298-52373320 GAGAGCAATGTGAAGGAGACAGG - Intergenic
1174723880 20:52841045-52841067 AAGAATAAGGAAGAGGAGAGGGG - Intergenic
1174897233 20:54462616-54462638 GGGAGCAAGTAGGAGTAGACTGG + Intergenic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1175175121 20:57106885-57106907 CAGAACATGGAGGAAGAGAGAGG - Intergenic
1175298837 20:57928590-57928612 GAGGAGAAGGAGGAGGAGAAGGG - Intergenic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175452092 20:59077925-59077947 GGGAAGAAGGAGGAGGAGGATGG + Intergenic
1175661420 20:60816262-60816284 AAGAAGAAGGAGGAGGAGCAAGG - Intergenic
1175725429 20:61315102-61315124 GAGCCCAAGGAGGAGGAGTCTGG - Intronic
1175829191 20:61952778-61952800 GTGAAGATGGAGGTGGAGACGGG - Intergenic
1176221994 20:63974179-63974201 CAAAACAAGGAAGACGAGACAGG + Exonic
1176227051 20:64006644-64006666 GGGTCCAAGGAGGCGGAGACGGG + Intronic
1176877337 21:14145654-14145676 GAGGAGAAGAAGGAGGAGAAAGG + Intronic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177267665 21:18805449-18805471 AAGAACAAGATGGAGGACACAGG + Intergenic
1177333013 21:19685123-19685145 GACAAGGAGGAGGAGGAGGCAGG - Intergenic
1177483505 21:21724630-21724652 GAGAAGGAGGAGGAGGAGAAGGG - Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177759834 21:25390938-25390960 TAGAATGAAGAGGAGGAGACTGG - Intergenic
1178225849 21:30717538-30717560 AAGTAGAAGGAGGAGGAGAAGGG + Intergenic
1178349881 21:31865018-31865040 AAGAAGAAGGAGGAGGAGAAGGG - Intergenic
1178481590 21:32983982-32984004 GAGATGAAAGAGGAGGAGAGAGG + Intergenic
1178877240 21:36422722-36422744 GACATCAAGGATTAGGAGACAGG - Intergenic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179084890 21:38207704-38207726 GAGAAGGAGGAGGAGGGGAAAGG - Intronic
1179281860 21:39940580-39940602 GAGAGGTAGGAGGAGGAGAAAGG + Intergenic
1180206927 21:46266469-46266491 CAGAACTGGAAGGAGGAGACAGG + Intronic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180592941 22:16956215-16956237 GTGAACAAGAAGGGGGAGAATGG + Intergenic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1181323452 22:22026086-22026108 GAGAAGCTGGAGGAGGAGAGGGG - Intergenic
1181432703 22:22892866-22892888 GAAGCCAAGGAGGAGGAGAGGGG + Intronic
1181508449 22:23377584-23377606 GAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1181609731 22:24004424-24004446 TAGAACACAGAGGAAGAGACAGG - Intergenic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1181883405 22:25999595-25999617 GAGAAGGAGAAGGAGGAGAAAGG - Intronic
1181977208 22:26738467-26738489 GAGAACAAGGAGGAGGGGAAGGG - Intergenic
1181997421 22:26893709-26893731 GAGAACAGAGAAGAGGAGAGGGG + Intergenic
1182414154 22:30210312-30210334 GAGGAGGAGGAGGAGGAGAGAGG + Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182806159 22:33072282-33072304 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
1182931478 22:34178308-34178330 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1183059992 22:35330529-35330551 GAGAACAGGGAGGAAGGGAAGGG - Intronic
1183093825 22:35540739-35540761 GAGGTGAAGGAGGAGGAGCCGGG + Intergenic
1183385432 22:37511457-37511479 GAGAAGGAGAAGGAGGAGGCGGG + Intronic
1183680956 22:39328901-39328923 CAGAAAAATGATGAGGAGACAGG - Intergenic
1183775461 22:39961288-39961310 GAGAAAGAGGAGCGGGAGACAGG + Intronic
1184336857 22:43858916-43858938 GACTGCATGGAGGAGGAGACAGG - Intronic
1184343783 22:43900743-43900765 GAAGACAAGGAGGAGGGGATGGG + Intergenic
1184361454 22:44021387-44021409 GAGAAAAAGGAGCAGGTGAAAGG + Intronic
1184449735 22:44575846-44575868 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1184449765 22:44575980-44576002 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1184842337 22:47059325-47059347 GAGAACTAGAAGGTGCAGACAGG + Intronic
1184872392 22:47249319-47249341 GAGAAATAGGAGGAGAAGAGGGG - Intergenic
1184932522 22:47691815-47691837 TAGAACAAGGAGGCAGAGAAAGG + Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185124200 22:48996560-48996582 GAGGAGGAGGAGGAGGAGAAGGG + Intergenic
1185281752 22:49972641-49972663 GGGACCAGGGAGGAGGAGGCGGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949323686 3:2840362-2840384 GAGGAGAAAGAGGAGGAGAAGGG - Intronic
949369157 3:3316311-3316333 GAGGAGAAGGAGGAAGAGATAGG - Intergenic
949459734 3:4277518-4277540 GAGGAAAAGAAGCAGGAGACAGG + Intronic
949538610 3:5014795-5014817 GAGAAAGAGGAGGAGGACAAAGG + Intergenic
949567239 3:5256265-5256287 GAGAAAAAAGAGAAGGAGAAGGG - Intergenic
949812474 3:8020749-8020771 GGGAAGAAGGAGGAGGGAACAGG + Intergenic
949925696 3:9039275-9039297 GGGCAGAATGAGGAGGAGACAGG - Intronic
951110646 3:18799736-18799758 GAGAAAAAGGAGGGTGTGACAGG - Intergenic
951425772 3:22543415-22543437 GAGAACAAGATGGGGGAAACTGG - Intergenic
952107584 3:30087733-30087755 GAGGAGAAGGAGGAGGAGGGAGG - Intergenic
952303047 3:32121245-32121267 GAAAAGAAGGAAGAGGAGACAGG - Intronic
952851772 3:37735283-37735305 GAGGACAAGAAGGAAGAGAGAGG - Intronic
953151773 3:40331590-40331612 GGGACCCAGGAGGAGGAGCCTGG + Intergenic
953191401 3:40691179-40691201 GAGAACAAGGGGGGTGAGCCAGG - Intergenic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953453476 3:43023204-43023226 GAGACCATGGAGGCGGAGACTGG + Intronic
953612470 3:44458701-44458723 GAGAAAAAGGAGCAGGTGAAAGG - Intronic
953970842 3:47345689-47345711 GAAACCAAGCAGGTGGAGACTGG - Exonic
954272935 3:49523669-49523691 GAGAACTAGGGAGAGGAGCCTGG + Intronic
954557801 3:51532033-51532055 GAGGACAAGGAGGTGTCGACAGG + Intergenic
954702292 3:52456562-52456584 GGGAACAAAGGGGAGGAGGCAGG - Intronic
954745018 3:52782838-52782860 GTGGACAAGCAGGAGGAGATAGG - Intronic
954790587 3:53130332-53130354 GAGTACCTGCAGGAGGAGACCGG + Exonic
954872773 3:53780297-53780319 GAGATAAAGGATGAGGAAACAGG - Intronic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
955092682 3:55768045-55768067 CAGAAAAAGGAGGAAGAGAGTGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955283459 3:57616354-57616376 GAGGAGGAGGAGGAGGAGGCAGG + Intergenic
955307425 3:57848322-57848344 AAGAAACAGGAGGAGGAGAAGGG - Intronic
955346201 3:58163774-58163796 GAGTAAAAAGAGGAGGAGATAGG - Intronic
955478891 3:59369078-59369100 GAGAAACAGGAAGAGGAGAAAGG - Intergenic
955609460 3:60741676-60741698 GATAAGAAGGAGAAGGAGAAAGG - Intronic
955813891 3:62821520-62821542 GAGAAGATGGAGGCAGAGACTGG - Intronic
955818831 3:62874971-62874993 GAGATCGTGGAGGAGGAGAGCGG - Exonic
955941492 3:64150539-64150561 GAGAAGAAGGAGGAGGAAGAAGG - Intronic
955965028 3:64380317-64380339 GGGAACAAGGAGGAGATGAGAGG + Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
957290397 3:78271019-78271041 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic
958720349 3:97836218-97836240 GAGAAAAATCAGGAGGAGAGAGG - Intronic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
958962535 3:100523679-100523701 GAGAAGGAGAAGGAGGAGAAAGG - Intronic
959744359 3:109759408-109759430 GAGAAGGAGGAGGAGGAGACGGG - Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960134733 3:114093890-114093912 GAGGACAAGGAGGAGGTGAGGGG - Intergenic
960357462 3:116671094-116671116 GGGAAGAGGGAGGAGGAGGCAGG + Intronic
960702215 3:120450426-120450448 GAGAGCGGGGAGGAGGAGAGGGG - Intronic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
961133192 3:124487813-124487835 GAGAAGAATGAGGAGGATAAAGG - Intronic
961139862 3:124546773-124546795 GAGAAGCAGGTGGAGGAGGCTGG + Intronic
961266518 3:125647506-125647528 GAAAACAAGGAGCACGAGGCTGG + Intergenic
961476115 3:127147391-127147413 GAGGAAGAAGAGGAGGAGACGGG + Intergenic
961491566 3:127259965-127259987 GAGAAGAAAGAGGAGGAAAAGGG - Intergenic
961770964 3:129249725-129249747 GACAAGAAGGATGAGGAGTCAGG + Exonic
962054411 3:131854796-131854818 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
962079745 3:132125252-132125274 GAGGAGGAGGAGGAGGACACTGG - Intronic
962200157 3:133394410-133394432 GAGAAGGAGGAGGAGGAGGTGGG - Intronic
962203517 3:133417627-133417649 GAGGACAAGGGTGAGTAGACGGG - Intronic
962266960 3:133950667-133950689 GAGAGCAAGGAAGAGAAGTCTGG - Intronic
962364921 3:134772510-134772532 GAGAAAATGGAGGAGAAGAGGGG - Intronic
962400554 3:135055680-135055702 GTGAACAAGGATGACAAGACAGG - Intronic
962491412 3:135897239-135897261 GAGAAGCAGGAGGAGGAGAGGGG - Intergenic
962661562 3:137606246-137606268 GAGAAGAAAGAGGTGGGGACTGG - Intergenic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
962968283 3:140374285-140374307 GAAAAAAAGGAGGAGGAGATGGG - Intronic
963591149 3:147261310-147261332 ATGAAAGAGGAGGAGGAGACTGG - Intergenic
964356608 3:155856838-155856860 AAGAACAGGGAGGAGGACAGTGG - Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964461409 3:156934191-156934213 TACAACCAGTAGGAGGAGACTGG - Intronic
964877745 3:161387904-161387926 GAGTAGAAGGAGGAGCAGAGTGG - Intergenic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
965151729 3:164986230-164986252 GAGAGTAAGGAGCAAGAGACAGG - Intronic
965615278 3:170586130-170586152 GACTCCAAGGAGGCGGAGACAGG - Intronic
965622262 3:170653778-170653800 AAGAAGAAGAAGGAGGAGAAGGG - Intronic
965794120 3:172420719-172420741 GAGAACAAATTGGAGGAGAAGGG - Intergenic
965802754 3:172511527-172511549 GAGAACACAGAGAAGGAGAATGG + Intronic
966149003 3:176845507-176845529 GAGGTCAAGGAGCAGGTGACTGG - Intergenic
966559181 3:181300033-181300055 GAGAAGAAGGAGGAGGAGAAGGG + Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966892164 3:184415440-184415462 GAGAAGAAGGATGAGTACACAGG - Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
967014620 3:185470505-185470527 GAGTAGAAGCAGGAAGAGACGGG - Intronic
967114771 3:186327334-186327356 GAGGAGAAGGAGGAGGAAAGGGG - Intronic
967149878 3:186638744-186638766 CAGAACAAAGAGGAGGAGAATGG - Intronic
967349031 3:188491267-188491289 GTGATAAAGGAGGAGGAGGCTGG + Intronic
967504449 3:190238393-190238415 GAAAAGCAGCAGGAGGAGACAGG + Intergenic
967717889 3:192784083-192784105 GAGATCAAGTAGGATGAGAGGGG + Intergenic
967760432 3:193218230-193218252 GGTAAAAAGGAGGAGGGGACTGG + Intergenic
968359923 3:198139670-198139692 GAGGTGAAGGAGGAGGAGTCGGG + Intergenic
968432653 4:567818-567840 CAGACCCAGGAGGAGGAGTCAGG + Intergenic
968751239 4:2390156-2390178 GTGAAGATGGAGGTGGAGACTGG + Intronic
968856540 4:3128275-3128297 GAGAACAAGCAGGAGGGTTCAGG - Intronic
968889166 4:3358890-3358912 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
968912001 4:3481113-3481135 GTGGAGGAGGAGGAGGAGACAGG + Intronic
969520792 4:7676752-7676774 GAGAGGAAGGAGGAGATGACAGG - Intronic
969520806 4:7676847-7676869 GAGAGGAAGGAGGAGATGACAGG - Intronic
969573364 4:8022990-8023012 GAGGAAGAGGAGGAGGAGAAAGG - Intronic
969803798 4:9590503-9590525 GAGAACATGGCAGAGGTGACGGG - Intergenic
969927413 4:10597827-10597849 GAGACCAAGGTGCAGGAGAAGGG - Intronic
969979531 4:11140488-11140510 GAGGAGAAGGAGGAGGGGAAGGG - Intergenic
970063792 4:12068027-12068049 GAGAAAAAGGAGGAGAAGAACGG + Intergenic
970162080 4:13199026-13199048 GAGAACAAGGATGAAGAGGAAGG + Intergenic
970458908 4:16253306-16253328 GTCAACAAGGAGGAGGTGATAGG - Intergenic
971021598 4:22542289-22542311 GAGAAAAATGAGGATGGGACAGG - Intergenic
971335787 4:25722933-25722955 GAGAAAAAGGAATAGGAGAAGGG + Intergenic
971648748 4:29243262-29243284 AAAAAGAAGGAGGAGGAGAAGGG + Intergenic
972027285 4:34398783-34398805 GAGTAGAAGGAGGAAGGGACAGG + Intergenic
972706787 4:41552541-41552563 GAGAACAAGAAGCAAGAGACAGG - Intronic
972850437 4:43042542-43042564 GAGAGACAGGAGGAGGAGCCAGG - Intergenic
973696818 4:53498312-53498334 GAGAAAGAGGAGGTGGAGAAAGG + Intronic
973758898 4:54099916-54099938 GAGAAAGAGGGGGAGGAGGCCGG + Intronic
973821112 4:54662231-54662253 GATGACAAGTGGGAGGAGACAGG + Intronic
974705951 4:65515875-65515897 TAGAACAAAAAGGAGGAGAAAGG + Intronic
975388524 4:73788134-73788156 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
975483338 4:74906433-74906455 CAGAAGAAGGAGGAAGAGAAAGG + Intergenic
975817701 4:78236152-78236174 GAGAACAGGAAAGAGGAGGCTGG + Intronic
976006030 4:80431543-80431565 GAGAAGAAGGAGAAGGGGAAGGG - Intronic
976737917 4:88329195-88329217 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
976874520 4:89837160-89837182 GAGGACTAGGAGGAGGAGGACGG - Intronic
977066932 4:92329965-92329987 GAGAAAAAGGAAGAGGAGTATGG + Intronic
977135834 4:93303078-93303100 GAGAAGGAGGAAGAGGAAACAGG + Intronic
977286667 4:95116391-95116413 GAAAGCATGGAGGAGGAGAAAGG - Intronic
977380774 4:96271050-96271072 GAGAACAAGTTGGCTGAGACTGG + Intergenic
977634461 4:99281077-99281099 GAGAAAATGGAGGAAGATACAGG + Intronic
977709990 4:100113912-100113934 GAGAAGAATGGGCAGGAGACAGG - Intergenic
977875732 4:102147851-102147873 GAAAACAAGGAGGATGGGATGGG + Intergenic
978237916 4:106482374-106482396 CAGCACAGAGAGGAGGAGACAGG + Intergenic
978637917 4:110832905-110832927 GAGAAGAAGAAAGAGGAGGCAGG + Intergenic
978804892 4:112789463-112789485 GAGACCAAGGAGGTAGAGAAAGG + Intergenic
978935609 4:114371416-114371438 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
979039380 4:115767180-115767202 GAGAAGATGGAAGAGCAGACTGG + Intergenic
979276964 4:118824826-118824848 GAGAACTAGGTGGAGGAGGAGGG + Intronic
979481189 4:121219327-121219349 GAGGAAAAGGAGGAGGAGGGAGG - Intronic
979559559 4:122086961-122086983 GAGAAACAGGAGGAGGAGAAAGG + Intergenic
979897751 4:126181092-126181114 GAGAATGAGGAAGATGAGACTGG - Intergenic
980541531 4:134201881-134201903 GAGAAGCAGGAGGCGGTGACTGG + Intergenic
980931769 4:139189003-139189025 GAGGAGGAGGAGGAGGAGGCTGG - Intergenic
980981424 4:139657576-139657598 GAGGAAGAGGAGGAGGAGAAGGG + Intergenic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981041900 4:140230866-140230888 TAGAACAAAAAGGAGGAGAAAGG - Intergenic
981056306 4:140365658-140365680 GAGGAGAAGGAGGAAGAGAAGGG - Intronic
981254402 4:142644303-142644325 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
981514012 4:145587715-145587737 GAGAAGAAGGAGAAGGGGATGGG + Intergenic
981825488 4:148935905-148935927 GAGAGAGAGGAGGAGGAGCCGGG - Intergenic
982123363 4:152162888-152162910 GAGGATAAGGAAGAGGAGAAAGG + Intergenic
982635675 4:157893971-157893993 TCTAACAAGGAGGAGGAGGCAGG + Intergenic
982686587 4:158497520-158497542 GAGAACATGGAGAAAGATACAGG - Intronic
983143871 4:164188438-164188460 GAGGACAAGGAGGAGGACGTGGG + Intronic
983314348 4:166109693-166109715 GAGAAAGAGAAGGAGGAGATTGG - Intergenic
983523389 4:168734761-168734783 GAGAAGGAGGAGGAGGAGCCAGG + Intronic
983577026 4:169271061-169271083 GAGGAAGAGGAGGAGGAGGCCGG + Exonic
983999663 4:174224989-174225011 GAGAAAAGAGGGGAGGAGACGGG - Intergenic
984558589 4:181241817-181241839 GAGACCAAATAGGTGGAGACTGG + Intergenic
984703428 4:182833000-182833022 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703445 4:182833049-182833071 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703481 4:182833149-182833171 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703487 4:182833168-182833190 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703503 4:182833221-182833243 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703521 4:182833272-182833294 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703559 4:182833370-182833392 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703565 4:182833389-182833411 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703576 4:182833424-182833446 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703625 4:182833550-182833572 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703631 4:182833569-182833591 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703637 4:182833588-182833610 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703648 4:182833623-182833645 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703697 4:182833749-182833771 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703703 4:182833768-182833790 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703709 4:182833787-182833809 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703722 4:182833826-182833848 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703728 4:182833845-182833867 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703740 4:182833883-182833905 GAGGAGAAGGAGGAGGGGAGGGG - Intergenic
984703753 4:182833918-182833940 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703772 4:182833972-182833994 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703778 4:182833991-182834013 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703798 4:182834042-182834064 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703835 4:182834139-182834161 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703841 4:182834158-182834180 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703847 4:182834177-182834199 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703853 4:182834196-182834218 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703864 4:182834231-182834253 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703913 4:182834357-182834379 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703919 4:182834376-182834398 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703925 4:182834395-182834417 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703931 4:182834414-182834436 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703937 4:182834433-182834455 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703950 4:182834472-182834494 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703956 4:182834491-182834513 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703962 4:182834510-182834532 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703968 4:182834529-182834551 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
984703974 4:182834548-182834570 GAGGAGAAGGAGGAGGGGAGAGG - Intergenic
985165791 4:187092724-187092746 TAGAACAGGGAGGAAAAGACAGG - Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
985763366 5:1763327-1763349 GAGAGAAAGGACGAGGAAACGGG - Intergenic
986051457 5:4094284-4094306 GAGAACATGGAGAAGGAAATTGG + Intergenic
986183645 5:5417015-5417037 GAGGAGGAGGAGGAGGAGAAGGG + Intergenic
986335716 5:6753925-6753947 GAAAAACAGCAGGAGGAGACTGG - Intronic
986623180 5:9697066-9697088 GAGGACGAGGAGAAGGAGAAAGG + Intronic
986853996 5:11847476-11847498 GGGAAGGAGGAGGAGGAGGCAGG + Intronic
987095454 5:14545614-14545636 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
987100289 5:14585123-14585145 GAGGAGAAGGAGGAGTAGAGGGG + Intronic
987220212 5:15783489-15783511 GACAGCAATGAGGAGGAGAGAGG + Intronic
987241957 5:16009041-16009063 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
987303819 5:16619151-16619173 GAGAACATGGGGCAGGAGAGAGG + Intergenic
987445799 5:18018247-18018269 GGGAATCAGAAGGAGGAGACAGG + Intergenic
987989581 5:25193188-25193210 TAGAACAAGCAGGTGGAGAGAGG + Intergenic
988165238 5:27580576-27580598 GAAATCAAAGGGGAGGAGACAGG - Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
989075342 5:37559424-37559446 GAGATGAAGGAGGAGGAGAATGG - Intronic
989433352 5:41381486-41381508 GAGAAAAAGGAGACAGAGACTGG + Intronic
989992459 5:50783180-50783202 GAGAAGAGGGAAGGGGAGACAGG + Intronic
990499918 5:56385779-56385801 AAGAAAGAGGAGGAGGAGAGAGG - Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991998077 5:72408023-72408045 GAGAACTGGGAAGAGAAGACAGG + Intergenic
992199326 5:74368328-74368350 GAAAAGGAGGAGGAGGAGGCAGG + Intergenic
993504938 5:88697193-88697215 GAGAAAAATGAGGATGAGAGAGG - Intergenic
993716124 5:91277349-91277371 GAGGAGGAGGAGGAGGAGAAGGG + Intergenic
993740154 5:91528930-91528952 GAGCACAAGTGGGAGGTGACAGG - Intergenic
994091597 5:95814395-95814417 GAGGACAAGGTGGAGAACACTGG + Exonic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
995016788 5:107318875-107318897 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
995032620 5:107496558-107496580 GAGAGCAGGAAGGAGGAGAGGGG - Intronic
995856355 5:116597067-116597089 GAGAGAGAGGAGGAGGAGCCAGG - Intergenic
995915952 5:117245161-117245183 GAAGACAAGGAGGAGGAGAAAGG + Intergenic
996498516 5:124189508-124189530 GAGAACAAGCAGGAAGAATCAGG + Intergenic
996840700 5:127844623-127844645 GAGACAAAGGGTGAGGAGACAGG + Intergenic
997297226 5:132776155-132776177 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
997367160 5:133333382-133333404 GAGAGAAAGGAGGTGGAGATGGG - Intronic
997619530 5:135276564-135276586 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
997777278 5:136621974-136621996 GAGGAAAAGGAGGAGAAGAAGGG - Intergenic
997804944 5:136907570-136907592 GTGAGCAAGGAGGTGGAGAGGGG - Intergenic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998769856 5:145530580-145530602 AAGAATAAGGAGGGAGAGACAGG + Intronic
998800005 5:145859647-145859669 GAGAGGCAGGAGGAGGAGAAGGG + Intergenic
999517349 5:152314554-152314576 GAGAGGGAGGAGGAGGAGAGGGG - Intergenic
999643421 5:153694961-153694983 ATGAACAAGAAGGAGGAGAAAGG + Intronic
1000096556 5:157976166-157976188 GAGGACGAGGAGGAGGAGAAGGG + Intergenic
1000479213 5:161750873-161750895 GAGGACAAGGTGGAGAACACTGG + Intergenic
1000963663 5:167629880-167629902 GAGAAGGAGGAGGAGGAGGGGGG + Intronic
1001334032 5:170783143-170783165 GAGGCCCAGGAGGAGGAGGCGGG - Intronic
1001494170 5:172176300-172176322 GAGAGCAGAGAGGATGAGACAGG - Intronic
1001690897 5:173631603-173631625 GAGGACTGGGAGGAGGAGAGGGG - Intergenic
1001751241 5:174133240-174133262 CTGAACCAGGAGGAGGAGAGGGG - Intronic
1001865199 5:175097851-175097873 AGGAACAAGGAGCAGGAGATGGG - Intergenic
1001890969 5:175338207-175338229 AATAAGAAGGAGGAGGAGAGAGG - Intergenic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1002865119 6:1115071-1115093 GGGAACAAGGAAGAAGACACTGG - Intergenic
1003058412 6:2842904-2842926 GAGCACAGGGGGGTGGAGACTGG + Intergenic
1003412236 6:5875964-5875986 GAGAGCAGGGAGGGTGAGACAGG + Intergenic
1003487853 6:6595242-6595264 GAGAACAAGAAGGAGGGAAGGGG + Intronic
1003510972 6:6780065-6780087 GAGAACAAGGAGTAGAAAGCTGG + Intergenic
1003817626 6:9859942-9859964 ATGAAGAAGGAGGAGGAGAAGGG + Intronic
1004278499 6:14258885-14258907 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1004336927 6:14772229-14772251 AAGCAGAAGGTGGAGGAGACTGG - Intergenic
1004666412 6:17752177-17752199 GAGAATCAGGAGGTTGAGACTGG + Intergenic
1004885352 6:20045971-20045993 AAGAACAAGGGGGATGAAACTGG + Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005886482 6:30101450-30101472 GGTAAAATGGAGGAGGAGACAGG + Intergenic
1005930924 6:30483229-30483251 GTGAAGAAGGAGGCAGAGACTGG - Intergenic
1006043603 6:31274289-31274311 GAGGACAAGGAGCAGGGGAAAGG - Intronic
1006053185 6:31359285-31359307 GAGGACAAGGAGCAGGAGAAAGG - Intergenic
1006238989 6:32661227-32661249 GAGAAGAAGTGCGAGGAGACAGG - Intronic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006335814 6:33420157-33420179 GAGGAGGAGGAGGAGGAGAGAGG - Exonic
1006391565 6:33761840-33761862 GAGACTGAGGATGAGGAGACTGG - Intergenic
1006413278 6:33888149-33888171 GAGAACAAGGAAGAGGGGCAAGG + Intergenic
1006555168 6:34859601-34859623 CAGAACTAGGAGAAGGAGATGGG - Intronic
1006579248 6:35067193-35067215 GAAAGCAAAGAGGAGGGGACAGG - Intronic
1007427254 6:41755603-41755625 AAGAAGGAGGAGGAGGAGAAGGG + Intergenic
1007429604 6:41769088-41769110 GAGGAGGAGGAGGAGGAGAGAGG + Intergenic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1007708130 6:43803935-43803957 GAGGAGAAGGAAGAGGAGAGAGG + Intergenic
1008016425 6:46525624-46525646 GAGAAAAAGGAAGAGAAGAAGGG + Intergenic
1008065540 6:47043857-47043879 GAAAACAAGCAGAAGGAGAATGG - Intergenic
1008246130 6:49175911-49175933 GAGGAGGAGGAGGAGGAGAAAGG + Intergenic
1008339958 6:50352823-50352845 CAGAACAAGAAGGAGGCGAGAGG + Intergenic
1009589760 6:65652400-65652422 GAGGATAGGGAGGAGGAGACAGG + Intronic
1009905676 6:69867518-69867540 GAGAACCAGGAGGCGGCGCCGGG + Intronic
1011003718 6:82620585-82620607 GGGAGGAAGGAGCAGGAGACAGG + Intergenic
1011101957 6:83732010-83732032 GAAAACAAGGGGAAAGAGACAGG + Intergenic
1011154387 6:84313809-84313831 GAGAAGGAAGAGGAGGAGAAGGG - Intergenic
1011410504 6:87061321-87061343 GAGAAGGAGGAGGGAGAGACTGG + Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011837354 6:91450007-91450029 GAGAATAAGGAGTTGAAGACAGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012405784 6:98896198-98896220 GAAGACAAGGTGTAGGAGACTGG - Intronic
1013478221 6:110529378-110529400 GAGGAGGAGGAGGAGGAAACAGG - Intergenic
1013793669 6:113860376-113860398 GAGAAAAAGGCCGAGGAGGCCGG + Exonic
1014249084 6:119097792-119097814 GAGAAAAAGGAGCAGGTGAAAGG - Intronic
1014344795 6:120254608-120254630 ATGAACAAAGAGGAGGAGATGGG + Intergenic
1014453630 6:121611479-121611501 GAGAACAAGAAGGGGGAAGCAGG - Intergenic
1014494367 6:122102254-122102276 AAGAGAAAGGAGGAGGAGAAAGG + Intergenic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1015625955 6:135181323-135181345 GAGAAGGAGGAGGAGGAAACAGG - Exonic
1016003685 6:139067771-139067793 GAGGAGAAGGAGGAGGAGAGGGG - Intergenic
1016471411 6:144378549-144378571 GAGAACAGGGTGAAGGAGGCAGG + Intronic
1016618355 6:146079056-146079078 GGGAGCAGGGAGGAGGAGCCTGG - Intronic
1016634820 6:146275971-146275993 GAGAAGAAAGAGGAGGAGGAAGG + Intronic
1016891834 6:149014916-149014938 GAGAGCAAGGAAGTGCAGACTGG + Intronic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017297211 6:152811949-152811971 GAGAAAGAAGAGGAGGAGAAAGG - Intergenic
1017301103 6:152859052-152859074 GAAAACGAGGAAGAGGAGACTGG - Intergenic
1017339618 6:153305375-153305397 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic
1017339640 6:153305453-153305475 AAGAAGAAGGAGGAGGAGTAGGG - Intergenic
1017437443 6:154429713-154429735 GAGAAGGAGGAGGAGGAGACGGG - Intronic
1017731792 6:157323550-157323572 GAGAACCAGGCGGAGGAGAAAGG + Exonic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1018038028 6:159898485-159898507 GAGGAGGAGGAGGAGGAGTCTGG - Intergenic
1018349285 6:162939613-162939635 GAGAACAAAGAATAGGAGAAAGG - Intronic
1018415864 6:163601692-163601714 GAGGACAGGGAGGAGGGGAGAGG - Intergenic
1018565500 6:165146957-165146979 GAGACCCACCAGGAGGAGACTGG - Intergenic
1018640960 6:165903788-165903810 GAGAACAGCCAGGAGGAAACAGG + Intronic
1018674367 6:166206221-166206243 GTGAAGACGGAGGTGGAGACCGG - Intergenic
1018755145 6:166842354-166842376 GTGAAGATGGAGGTGGAGACTGG + Intronic
1018799725 6:167212516-167212538 GAAAACAAGGAGGAGGAATGGGG + Intergenic
1019260060 7:76952-76974 GAGGTGAAGGAGGAGGAGTCGGG - Intergenic
1019404821 7:877705-877727 GAGAACAGGGAGGGGGAGGCCGG - Intronic
1019535338 7:1526331-1526353 AAGAAGAAGGGGGAGGAGAAAGG + Intergenic
1019535344 7:1526353-1526375 GAGAAGAAGGGGGAGGAGAAAGG + Intergenic
1020086408 7:5313035-5313057 GAGGAGGAGGAGGAGGAGGCCGG + Exonic
1020205900 7:6115651-6115673 GAAACCAAGGAGGAGGACTCAGG + Intronic
1020577401 7:9950017-9950039 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1021158857 7:17246846-17246868 GAGAAAAAGGAGAAGGTGAAAGG - Intergenic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021697163 7:23286454-23286476 GAAAGCAATGAGCAGGAGACGGG - Intergenic
1022473365 7:30694980-30695002 GGGAAGGAGGTGGAGGAGACTGG + Intronic
1022514719 7:30968306-30968328 GAGAGCAAGGAGAATGACACAGG + Intronic
1022594053 7:31694971-31694993 GATCACCAGGAGGATGAGACTGG + Intronic
1022786798 7:33646114-33646136 AAGGAGAAGGAGGAGGAAACTGG - Intergenic
1022886617 7:34653338-34653360 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1022923853 7:35040986-35041008 GAGAGCAAGTAGGAGGAAAAGGG - Intergenic
1023026590 7:36056396-36056418 GAGAAGAAGCAGGAGGAAGCAGG + Intergenic
1024195568 7:47055368-47055390 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1024454194 7:49584373-49584395 GAGAACATGGAGGCAGAGACTGG + Intergenic
1024554093 7:50588557-50588579 GGGAACAAGGAGAAAGACACTGG - Intergenic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024770006 7:52711609-52711631 GAATACAAGGAGGAGAAGAAAGG - Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1024904679 7:54362947-54362969 GAGAACCTGGACTAGGAGACTGG - Intergenic
1025228325 7:57182199-57182221 GAGGAGGAGGGGGAGGAGACAGG - Intergenic
1025228381 7:57182450-57182472 GAGGAGGAGGAGGAGGAAACAGG - Intergenic
1025288171 7:57685618-57685640 GAGACCAAGGAGCAGGAGCATGG + Intergenic
1025664037 7:63572796-63572818 GAGGAGGAGGAGGAGGAGGCCGG + Intergenic
1025888288 7:65620424-65620446 CAGAACAAGGAGGTGGAAATGGG + Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026191906 7:68136493-68136515 GAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1026205600 7:68254936-68254958 AAGAAAAAGGAGGAAGAGAAAGG - Intergenic
1026205746 7:68255695-68255717 GAGAAGAAGGAGGAAGAGGTGGG - Intergenic
1026245377 7:68615082-68615104 GAGGAGAAGAAGGAGGAGAAGGG + Intergenic
1026245417 7:68615282-68615304 GAGAAGAAGGAGGAGGAAGAGGG + Intergenic
1026254224 7:68696942-68696964 GAGGCCAATGAGGAGGAGACAGG - Intergenic
1026767051 7:73166791-73166813 GAGGGGGAGGAGGAGGAGACAGG - Intergenic
1026800667 7:73397912-73397934 GAGAAGGGGGAGGAGGAGAGAGG + Intergenic
1026939755 7:74280683-74280705 GAGAGAGAGGAGGAGGAGGCTGG - Intergenic
1027043536 7:74976527-74976549 GAGGAGGAGGAGGAGGAGACAGG - Intronic
1027080110 7:75225832-75225854 GAGGAGGAGGAGGAGGAGACAGG + Intergenic
1027192612 7:76005883-76005905 GAGGAGGAGGAGGAGGAGAGAGG + Intronic
1027459033 7:78429251-78429273 GAAAACAATGAGGAGGGGATGGG - Intronic
1027487853 7:78784353-78784375 GAGAATGAGGAGCAAGAGACAGG - Intronic
1027759762 7:82262695-82262717 GAGAAATATGAGTAGGAGACAGG - Intronic
1028042220 7:86067422-86067444 GAAAACAATGGGCAGGAGACTGG + Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028246848 7:88489649-88489671 GAGGAGAAGGAGGAGGAAAGAGG - Intergenic
1028268606 7:88759396-88759418 GAGAGGGCGGAGGAGGAGACGGG - Exonic
1028326581 7:89534307-89534329 TAGAAAAATGAGGAGGAGGCAGG + Intergenic
1028792186 7:94865537-94865559 GGGAGCAAGGAGGGGGAGGCGGG - Intergenic
1028910572 7:96203041-96203063 GTGACCAAGGAGAGGGAGACCGG - Intronic
1028981589 7:96973148-96973170 AAGAACAGTGAGGAGGAGCCAGG + Intergenic
1029542336 7:101191232-101191254 GAGAAAAAGGAGCAGGAGAGAGG + Intergenic
1029745105 7:102512261-102512283 GAGAAGGAGGGGGAGGAGACAGG + Intronic
1029763097 7:102611422-102611444 GAGAAGGAGGGGGAGGAGACAGG + Intronic
1029819291 7:103130437-103130459 GAGAAAATGGAGGATGAGAAAGG - Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1029905909 7:104093304-104093326 GAGACCAAGGAAGAGGGGAGAGG - Intergenic
1029983689 7:104902419-104902441 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031667492 7:124503060-124503082 GAGAAGAAGAAGGGGGAGAAAGG + Intergenic
1031854146 7:126901542-126901564 CAGAACAAGGAGGTGGAAATGGG - Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032013589 7:128361727-128361749 GAGGAGGAGGAGGAGGAGAGAGG - Intergenic
1032044753 7:128595679-128595701 GAGGAGGAGGAGGAGGAGAAAGG - Intergenic
1032298883 7:130668631-130668653 GACAAGAAGGACGAGGAGTCTGG - Exonic
1032428361 7:131840290-131840312 GAGATAAAGGAGGAAGAGAGGGG - Intergenic
1032431825 7:131868290-131868312 GAGAAGAAGGAGCAGGTGAAAGG + Intergenic
1032466819 7:132151352-132151374 AAGAAGGAGGAGGAGGAGAAAGG + Intronic
1032523167 7:132561500-132561522 GAGAAGGAGGAGGAGGAGGTGGG - Intronic
1032523313 7:132562093-132562115 GAGAAGGAGGAGGAGGAGAAAGG - Intronic
1032523393 7:132562467-132562489 GAAGAGAAGGAGGAGGAGAAAGG - Intronic
1032523413 7:132562564-132562586 GAAGACAAGGAGGAGGAGAAAGG - Intronic
1032523480 7:132562846-132562868 GAGAAGGAGGAGGAGGAGAAAGG - Intronic
1032523590 7:132563292-132563314 GAGAAGGAGGAGGAAGAGAAAGG - Intronic
1032523660 7:132563594-132563616 GAAGAGAAGGAGGAGGAGAAAGG - Intronic
1033354665 7:140589873-140589895 GACAACAGGGAGGCTGAGACAGG - Intronic
1033443455 7:141400493-141400515 AAGGAGGAGGAGGAGGAGACAGG - Intronic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034435655 7:151061681-151061703 GAGTAGAGGGAGGAGGAGAGAGG - Intronic
1034865079 7:154634672-154634694 GAGACGAAGGAGAAGGAGAAGGG - Intronic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1035537537 8:403835-403857 GGGTACAAGGAGGAGGTGCCTGG - Intergenic
1035585549 8:770305-770327 GAGGACACGGAGGAGGAGCAAGG - Intergenic
1036173094 8:6509378-6509400 GAGACCTGGGAGGAGGAGCCTGG - Intronic
1036463505 8:8974759-8974781 GAGAACAAGGGGGAAGAGAAGGG - Intergenic
1036518643 8:9469445-9469467 GAGAGGAAGAAGGAGGAGAGAGG - Intergenic
1036604518 8:10293756-10293778 GAGGGCAAGGAGGAAGAGAAGGG - Intronic
1037568890 8:20141719-20141741 GAGGGCAAGGAGGAGGGGAGGGG + Intergenic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037630821 8:20654040-20654062 GAGAAGAGAGAGGAGGAGAGAGG - Intergenic
1037699315 8:21259602-21259624 GAAAAAGAGGAGGAGGAGAAGGG + Intergenic
1037778864 8:21854159-21854181 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1037840925 8:22244956-22244978 GCGAAAAAGGATGAGGTGACTGG - Intergenic
1037911522 8:22746543-22746565 GAGGACAGGGAGGAAGAGGCTGG - Intronic
1037918608 8:22788102-22788124 GAGAACCAGGAGCAGCAGGCAGG + Intronic
1038047470 8:23777936-23777958 GGGAAGAAGAAGGGGGAGACAGG + Intergenic
1038106082 8:24436051-24436073 GACCACAAGGAGGAGAGGACAGG + Intergenic
1038313410 8:26463141-26463163 GAGAAGGAGGAGGAGGAGAACGG - Intronic
1038313415 8:26463163-26463185 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1038370626 8:26986399-26986421 GGGGACAAGGAGGAAGAGAAAGG - Intergenic
1038381221 8:27096154-27096176 TAGAACAAGAAGGTGGAGAAAGG + Intergenic
1038422909 8:27444800-27444822 GAGAAGAAATAAGAGGAGACTGG - Intronic
1038425123 8:27459897-27459919 GAGAGCAAGTGGGAGGAGAGGGG + Exonic
1038440385 8:27567363-27567385 GAAAAGAGGGAGGAGGAGAAGGG - Intergenic
1038483642 8:27918788-27918810 GAGAAAGAGGAGGAGGAGGAGGG + Intronic
1038701732 8:29855489-29855511 GAGGGCAAGGAGGATGAGAAAGG - Intergenic
1039317325 8:36387872-36387894 AAGAAGGAGGAGGAGGAGAAGGG - Intergenic
1039454358 8:37697523-37697545 GAGGACGAGGATGCGGAGACCGG - Exonic
1039615103 8:38949298-38949320 GTGGGCAAGGAGGAGGAAACAGG + Intronic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1039926852 8:41941899-41941921 GTAAACAGGGTGGAGGAGACAGG + Intronic
1040615207 8:49028870-49028892 GAGAACAATGAGGATTAGACAGG + Intergenic
1041119057 8:54568125-54568147 TAGAACAAGAAGGAGGAAAAGGG + Intergenic
1041253396 8:55956868-55956890 GGGGAGAAGGAGGAGAAGACAGG + Intronic
1041283809 8:56239177-56239199 GAGAACAGGGAGGAGGATTATGG + Intergenic
1041315724 8:56560185-56560207 GAGAACAAGGAGGGAGAGGGAGG + Intergenic
1041369634 8:57145000-57145022 GAGAATCAAGAGAAGGAGACAGG + Intergenic
1041673073 8:60512291-60512313 GAGGACAAGGAGGAGAGGAAAGG + Intergenic
1042032238 8:64489040-64489062 GAGAGAGAGGAGGAGGAGTCAGG + Intergenic
1042130425 8:65582480-65582502 AAGAAGAAGAAGGAGGAGAAGGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042158546 8:65869048-65869070 GAGGACAAGGAGGTGTTGACAGG - Intergenic
1042661940 8:71164071-71164093 GGCACCAAGGAGGAGGAGATGGG + Intergenic
1043115602 8:76250045-76250067 GAGAAGAAGGAGGAAGAGGAAGG - Intergenic
1043295665 8:78659622-78659644 GAGAACAAAAAGAAGGAGAATGG + Intergenic
1043831309 8:84992355-84992377 GAAAGCAGGGAGGAGGAGAAAGG - Intergenic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044857712 8:96493716-96493738 GAGGAGAAGGAGGAGGACCCGGG + Exonic
1044985527 8:97753315-97753337 GAGAAGAAGAAGGAGGAGGTCGG + Intergenic
1045130036 8:99140687-99140709 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
1045358607 8:101411788-101411810 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1045476214 8:102555132-102555154 CAGAAGAGGGAGGAAGAGACAGG - Intronic
1046145789 8:110156701-110156723 GAGAAAAATGATGAGGAGAAAGG - Intergenic
1046399937 8:113691896-113691918 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1046612884 8:116445248-116445270 AAGAAGCAGGAGGAGGAGAGAGG + Intergenic
1046681719 8:117177953-117177975 GAGTAGGAGGAGGAGGAGAAAGG - Intergenic
1047209587 8:122830656-122830678 GAGGACAAGGAGGTGTCGACAGG + Intronic
1047306641 8:123658088-123658110 GAGAAACATGAGGAGCAGACAGG + Intergenic
1047428305 8:124766859-124766881 GAGAGCAAAGAGGAGGATGCTGG + Intergenic
1047541222 8:125768486-125768508 GAGAAGGAGGAGGAGGACCCAGG + Intergenic
1047767784 8:128003341-128003363 GAGAAGGAGAAGGAGGAGAAGGG - Intergenic
1047943948 8:129855537-129855559 GAGTACTAGGAGGAAGAGCCGGG - Intronic
1048290480 8:133177650-133177672 GAGGAGAGGGAGGAGGAGATGGG - Intergenic
1048348212 8:133594334-133594356 GAGAAAAAGGAGGATCAGAGAGG - Intergenic
1048516584 8:135116824-135116846 GAGGAGGAGGAGGAGGAGAGGGG - Intergenic
1048592386 8:135832873-135832895 GAGACCAGGGAGGAAGGGACAGG - Intergenic
1048652355 8:136492444-136492466 GAGATAATGGAAGAGGAGACAGG - Intergenic
1048762344 8:137808874-137808896 GAGAACACAGAGGATAAGACAGG + Intergenic
1048865294 8:138756356-138756378 GAGGCCAAGGAGGAGGAGGCAGG - Intronic
1049035520 8:140072550-140072572 GAGGAGGAGGAGGAGGAGAAAGG + Intronic
1049043805 8:140132794-140132816 GAGGAGGAGGAGGAGGAAACAGG + Intronic
1049179177 8:141212312-141212334 GAGGCCAAGGAGGAGCAGAAAGG - Exonic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049286435 8:141777954-141777976 TGGAACCAGGAGGAGGAGGCTGG + Intergenic
1049356717 8:142192779-142192801 TAGAACAGGGAGGAGCAGAAGGG + Intergenic
1049361046 8:142212775-142212797 GAGAAGGAGGAGGAGGGGAGAGG - Intronic
1049405253 8:142449533-142449555 GAGGAGAAGGAGGAGGAGAGAGG - Exonic
1049497707 8:142944262-142944284 GAGAACAATGAGGAAGAGTCTGG - Intergenic
1049510182 8:143023284-143023306 GGGACCCAGGAGGAGGACACAGG - Intronic
1049684118 8:143932455-143932477 GAGAAGGAGGAGGAGGAGGTGGG - Exonic
1049761595 8:144334235-144334257 GCGAACAGGGAGGAGGACAAAGG + Intronic
1049982370 9:916181-916203 GAGAACAGGGTGGTGGAGAGGGG - Intronic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1051058303 9:13014605-13014627 GTGAAGAAGGAGGTGGAGATTGG - Intergenic
1051095937 9:13465258-13465280 GAGAAGAAGGAGGAAGAGAAAGG - Intergenic
1051170386 9:14314705-14314727 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1051596129 9:18825971-18825993 CAGTACAAAGAGGAGGAAACAGG - Intronic
1051896717 9:21995519-21995541 GGGGACATGGAGGGGGAGACCGG - Intronic
1052430913 9:28365612-28365634 GGGAACACGAAGGAGAAGACAGG + Intronic
1052531182 9:29686295-29686317 GAGAAGGAGGAGGAGGGGAGAGG + Intergenic
1052843782 9:33316504-33316526 AGAAACAAGGAGGAAGAGACTGG - Intronic
1053127709 9:35596375-35596397 GAGAAAAAGGTGGAGAAGAGGGG + Intergenic
1053148775 9:35729962-35729984 TAGAAAAAGGATGAGAAGACAGG + Intronic
1053504052 9:38625587-38625609 GAAAAGGAGGAGGAGGAGAAGGG - Intergenic
1054753234 9:68930084-68930106 GATACCAAGGAGGAGAAGAGAGG - Intronic
1055195115 9:73581554-73581576 GAGAAAAAGGAGGAGCAGGAGGG - Intergenic
1055256498 9:74377696-74377718 GAGAACGACTAGTAGGAGACTGG + Intergenic
1055298150 9:74854572-74854594 GAGAAGAAGGAGGAGGTTGCTGG - Intronic
1056332713 9:85534886-85534908 GAGAGAGAGGAGAAGGAGACAGG - Intergenic
1056482061 9:87015922-87015944 GAGAACAAGTGGGAGGGGAGGGG + Intergenic
1056709346 9:88978096-88978118 AAGGAGGAGGAGGAGGAGACGGG - Intergenic
1057105824 9:92415188-92415210 CAGAACAAGAAGGAGCAGAAGGG - Exonic
1057173142 9:92975784-92975806 GAGGAGGAGGAGGAGGACACCGG + Intronic
1057497373 9:95571852-95571874 GAGAAGGAGGAGGAGGAGAGGGG + Intergenic
1057768400 9:97943998-97944020 GTGAGCAAGGAGGAGGAGAAGGG - Intronic
1058457206 9:105148668-105148690 GAAAGAAAGGAGGAGGAGGCAGG + Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058913285 9:109541023-109541045 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059021354 9:110579785-110579807 GAGAGAGAGGAGGAGGAGAGAGG - Exonic
1059151880 9:111956415-111956437 GAGATCAGGGAGAAGGAGAGAGG - Intergenic
1059509546 9:114831353-114831375 GATGAAAAGGAGGATGAGACGGG - Intergenic
1059666578 9:116451984-116452006 GAGAAGGAGGAGGAAAAGACGGG - Intronic
1059788450 9:117612962-117612984 GAGGAGAAAGAGGAGGAGAAGGG + Intergenic
1059796713 9:117705458-117705480 GAGGACAAGGAGGAGGACTATGG - Intronic
1059902418 9:118943025-118943047 GAGAATAATGAGGAAGAAACAGG - Intergenic
1059914983 9:119089194-119089216 AGGAGCAAGGAGGAGAAGACTGG + Intergenic
1060237256 9:121873611-121873633 GAGGAGGAGGAGGAGGAGGCGGG - Intronic
1060440408 9:123633280-123633302 GAGAACATGGAGGTGAGGACAGG - Intronic
1060475792 9:123985624-123985646 GAGACCAAGGTGGATGAAACTGG - Intergenic
1060693565 9:125686553-125686575 GAGGAAAAGGAGGATGTGACTGG + Intronic
1060771260 9:126333772-126333794 AAGAGGAAGGAGGGGGAGACTGG + Intronic
1061053020 9:128207140-128207162 AAGAGTAAGGAGGAGCAGACTGG + Intronic
1061613637 9:131764783-131764805 GAGAAGGAGGAGGAGGAGAGAGG - Intergenic
1061812310 9:133169411-133169433 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1062194136 9:135263891-135263913 GAGGGGAAGGAGGAGGAGAGGGG - Intergenic
1062348644 9:136127873-136127895 GAGGAGGAGGAGGAGGAGGCTGG + Intergenic
1062484872 9:136769759-136769781 GAGAACAAGCAGGTGGGGACTGG - Intergenic
1062744627 9:138203490-138203512 GAGGTGAAGGAGGAGGAGTCGGG + Intergenic
1062744633 9:138203510-138203532 GGGGAGAAGGAGGAGGAGTCGGG + Intergenic
1203775619 EBV:71542-71564 GAGGACGAGAAGGAGGAGACTGG - Intergenic
1203360744 Un_KI270442v1:217892-217914 GCGAACGAGGAGGTGGGGACAGG + Intergenic
1185499258 X:584794-584816 GAGAAAGAGGAAGAGGAGAGGGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1185591607 X:1281052-1281074 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
1185591619 X:1281096-1281118 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
1185603643 X:1355116-1355138 GAGGAGGAGGAGGAGGAGAATGG + Intronic
1185626688 X:1487624-1487646 GAGGGCAGGGAGGATGAGACAGG - Intronic
1185642917 X:1598343-1598365 GGGGACAAGGAGGAGCAGGCCGG - Intronic
1185707372 X:2277580-2277602 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707391 X:2277669-2277691 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707410 X:2277758-2277780 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707430 X:2277847-2277869 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707449 X:2277936-2277958 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707488 X:2278112-2278134 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707508 X:2278201-2278223 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707547 X:2278377-2278399 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707567 X:2278466-2278488 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707587 X:2278555-2278577 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707607 X:2278644-2278666 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707645 X:2278824-2278846 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707664 X:2278913-2278935 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707683 X:2279002-2279024 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707703 X:2279091-2279113 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707722 X:2279180-2279202 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707741 X:2279269-2279291 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707874 X:2279876-2279898 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707894 X:2279965-2279987 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707914 X:2280054-2280076 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707934 X:2280143-2280165 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707972 X:2280323-2280345 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707991 X:2280412-2280434 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708010 X:2280501-2280523 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708030 X:2280590-2280612 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708049 X:2280679-2280701 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708068 X:2280768-2280790 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708238 X:2281549-2281571 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708258 X:2281638-2281660 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708278 X:2281727-2281749 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708337 X:2281997-2282019 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708357 X:2282086-2282108 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185745563 X:2569932-2569954 GAGAGAGAGGAGGAGGAGCCAGG + Intergenic
1185787482 X:2903110-2903132 GAGAAAAAGAAGAAGGAGAAGGG - Intergenic
1185814493 X:3142397-3142419 AAGAAGAAGGAGGAGGAGGTGGG + Intergenic
1185814980 X:3146291-3146313 GAGGAGGAGGAGGAGGAGAGAGG - Intergenic
1185872504 X:3675684-3675706 GAGGAGAGGGAGGAGGAGAAAGG - Intronic
1185887146 X:3792979-3793001 GAGGACGAGGAGGAAGAGAGTGG + Intergenic
1185953333 X:4460828-4460850 GAGGAGGAGGAGGAGGAGAGGGG - Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1186020673 X:5251402-5251424 GAGAGAAAGTAGGAGGTGACTGG + Intergenic
1186730227 X:12402117-12402139 GAGGAGAAGGAGGAAGAGACTGG + Intronic
1186731969 X:12419843-12419865 GAGATAAAGGAGGAGGAGCCAGG - Intronic
1186788035 X:12971585-12971607 GAGAAGAAGGAAGAGGAGGGAGG - Intergenic
1186875886 X:13817257-13817279 GAGAGCAAGGAGGAAGAGCCCGG - Exonic
1186974970 X:14892342-14892364 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1187117677 X:16369950-16369972 GAGACCACAGAGGTGGAGACTGG - Intergenic
1187447630 X:19373014-19373036 GAGCAGAAGGAGGGGGAGGCGGG + Intronic
1187518908 X:19996425-19996447 GAAGACAAGGAGGAGGGAACAGG - Intergenic
1187927613 X:24264301-24264323 GAGAAGATGGAAGAGCAGACTGG - Intergenic
1188730894 X:33645456-33645478 AAGAAAAAGGAGGATGAGAAAGG + Intergenic
1188993292 X:36850978-36851000 GAGAAGGAGGAGGAGGAGAAAGG - Intergenic
1189197072 X:39161922-39161944 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1189322142 X:40093403-40093425 AAGAGGAGGGAGGAGGAGACTGG + Intronic
1189463860 X:41263444-41263466 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
1189561367 X:42194563-42194585 GAGGACAGGGAGAAGGACACTGG - Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189861155 X:45273830-45273852 GAGAGAAAGAAGGATGAGACAGG + Intergenic
1189947099 X:46190572-46190594 GAGAAGAAGGGGGATGAGAAGGG - Intergenic
1190237507 X:48628324-48628346 GGGAAGAAGGTTGAGGAGACAGG + Intergenic
1190384650 X:49873089-49873111 GTGACCAAGAAGGAGGAGAGTGG - Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1192079611 X:68033836-68033858 GAGAAAGAGGAGGAGGTGCCAGG - Intergenic
1192145648 X:68680482-68680504 GAGGGCAAGGATGAGGACACAGG + Intronic
1192184363 X:68936646-68936668 GAGAAGGAGGAAGAGGAGAATGG + Intergenic
1192217925 X:69176995-69177017 GAGACAAAGGAGGAGGACTCTGG - Intergenic
1192282121 X:69698440-69698462 GAGGACAAGGAGGTGTCGACAGG + Intronic
1193483646 X:82059534-82059556 GAGCTGAAGAAGGAGGAGACTGG + Intergenic
1194267367 X:91771462-91771484 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1194557361 X:95376917-95376939 GAGACCCAGAAGGAGGAGAGTGG + Intergenic
1194637607 X:96364552-96364574 GCGAAAGAGGAGGAGGAGAGAGG - Intergenic
1194723124 X:97363921-97363943 GAGAACAAGGACCAGGGGAAAGG - Intronic
1195211137 X:102652861-102652883 AAAGGCAAGGAGGAGGAGACTGG + Exonic
1195217292 X:102713812-102713834 AAAGGCAAGGAGGAGGAGACTGG + Exonic
1195481319 X:105348793-105348815 GAGAACAAGAATTAGGAGAAAGG + Intronic
1195505327 X:105649928-105649950 GAAAGTAAGGAGGAGGAGAGAGG + Intronic
1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG + Intronic
1195923724 X:110005058-110005080 GAGGAGGAGGAAGAGGAGACTGG + Intronic
1196245635 X:113396123-113396145 AAAAACAAGGATCAGGAGACAGG - Intergenic
1196311446 X:114171418-114171440 AAGAAAGAGGAGGAGGAGAATGG - Intergenic
1196495344 X:116318022-116318044 AAGAACAAGGAGCAGTAGCCAGG + Intergenic
1196856463 X:119989959-119989981 GAGAAGCAGGAGGAGGAGGATGG + Intergenic
1197314127 X:124942920-124942942 GAGACTAAGGAGGATCAGACAGG + Intronic
1197683766 X:129416052-129416074 GGGAACAAGGAGGAGGACATGGG + Intergenic
1197856798 X:130921751-130921773 GAGAAAAAGGAGGAAGAGGAAGG - Intergenic
1197906082 X:131427282-131427304 GAGAAGCAGGAGGAGGAGAGAGG - Intergenic
1197947225 X:131852295-131852317 GAGGACAAGGAGGTGTCGACAGG + Intergenic
1198302771 X:135347582-135347604 GAGAAAAAGGAAGAGGACTCTGG - Intronic
1198388537 X:136150324-136150346 GGGAACTAGGAGGTGGAGAGTGG - Intronic
1198539698 X:137624243-137624265 GAGAAAAGGGAGGAAGAGAGAGG - Intergenic
1198935190 X:141896806-141896828 GAGGACAAGGAAGAGGAGGAGGG - Intronic
1199093021 X:143713262-143713284 GAGAATAAGGAGAATGGGACTGG - Intronic
1199470223 X:148187137-148187159 GAGAAAAATGAGGATGAGAGAGG - Intergenic
1199751580 X:150824268-150824290 GAGGAGGAGGAGGAGGAGAAAGG + Intronic
1200081458 X:153578807-153578829 TGGAAGATGGAGGAGGAGACGGG + Intronic
1200259336 X:154603868-154603890 GAGGAAAGGGAGGAGGAGAACGG - Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200584572 Y:4992399-4992421 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1200751126 Y:6945198-6945220 GAGAAGAAAGTGGAGGAGAGAGG - Intronic
1201247871 Y:12024216-12024238 GAGGAGGAGGAGGAGGAGAAAGG - Intergenic
1201304631 Y:12540247-12540269 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1201366172 Y:13208685-13208707 GAGAAGAAGGGGGAGAAGAAGGG + Intergenic
1201366176 Y:13208697-13208719 GAGAAGAAGGGGGAGAAGAAGGG + Intergenic
1201366180 Y:13208709-13208731 GAGAAGAAGGGGGAGAAGAAGGG + Intergenic
1201453001 Y:14136300-14136322 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic
1201739707 Y:17310945-17310967 GAAGAGAAGGAGGAGGAGAAGGG - Intergenic
1202602965 Y:26613241-26613263 GAGAACACGGAGGCAGAGAAAGG + Intergenic